The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028249	Pediococcus acidilactici strain SRCM102732 chromosome, complete genome	2018117	800	37678	2018117	terminase,plate,tail,portal,integrase,capsid,holin	Lactobacillus_phage(45.83%)	49	4834:4849	42053:42068
WP_160212151.1|800_2054_-	1,4-beta-N-acetylmuramidase	NA	D2IYY2	Enterococcus_phage	58.3	1.1e-70
WP_160212152.1|2037_2292_-|holin	holin	holin	NA	NA	NA	NA
WP_144235585.1|2291_2537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124781.1|2612_4103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124782.1|4118_4940_-	collagen-like protein	NA	NA	NA	NA	NA
4834:4849	attL	CCTGATAAATCAGTAA	NA	NA	NA	NA
WP_065124783.1|4952_5990_-|plate	BppU family phage baseplate upper protein	plate	E9LUJ9	Lactobacillus_phage	35.5	6.8e-18
WP_065124784.1|5979_6390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124785.1|6370_6601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160212153.1|6593_7715_-	hypothetical protein	NA	O03938	Lactobacillus_phage	42.4	1.7e-78
WP_159225198.1|7720_8545_-|tail	phage tail family protein	tail	M4ZS20	Bacillus_phage	25.9	1.3e-16
WP_160212154.1|8545_13642_-	tape measure protein	NA	O03937	Lactobacillus_phage	29.3	6.7e-26
WP_160212155.1|13675_14296_-	hypothetical protein	NA	O03936	Lactobacillus_phage	41.6	3.2e-31
WP_160212156.1|14305_14698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160212157.1|14768_15236_-	Ig domain-containing protein	NA	A0A220BZ11	Staphylococcus_phage	43.0	1.8e-18
WP_160212158.1|15855_16251_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_160212159.1|16250_16595_-|capsid	capsid protein	capsid	O03933	Lactobacillus_phage	43.2	1.0e-15
WP_160212160.1|16594_16945_-|capsid	capsid protein	capsid	O03932	Lactobacillus_phage	54.6	1.5e-25
WP_160212161.1|16941_17361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160212162.1|17432_18329_-	hypothetical protein	NA	Q6SED2	Lactobacillus_prophage	65.7	5.9e-111
WP_160212163.1|18340_18904_-|capsid	capsid protein	capsid	A0A059T7N8	Listeria_phage	42.9	6.5e-15
WP_160212164.1|18994_20110_-|capsid	capsid protein	capsid	U3PFU0	Lactobacillus_phage	29.3	5.2e-40
WP_160212165.1|20127_21681_-|portal	phage portal protein	portal	O03928	Lactobacillus_phage	59.2	5.9e-167
WP_160212166.1|21693_23001_-|terminase	PBSX family phage terminase large subunit	terminase	A0A059T5E2	Listeria_phage	54.9	1.6e-133
WP_160212167.1|22987_23680_-|terminase	terminase	terminase	V5URT8	Oenococcus_phage	44.4	1.6e-15
WP_160212168.1|23963_24530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160212169.1|24903_25335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160212170.1|25540_25951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160212171.1|26335_26578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160212172.1|26570_26762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159206544.1|26762_26954_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_160212173.1|27092_27257_+	YjzC family protein	NA	A0A0A7RTS6	Clostridium_phage	73.6	3.2e-15
WP_160212174.1|27426_27858_-	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	57.1	3.2e-38
WP_160212175.1|27860_28268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160212176.1|28212_28935_-	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	66.5	2.6e-85
WP_160212177.1|28939_29818_-	helix-turn-helix domain-containing protein	NA	A0A097BYA5	Leuconostoc_phage	46.6	2.4e-40
WP_160212178.1|29810_30638_-	hypothetical protein	NA	Q8SDH6	Lactococcus_phage	34.1	7.1e-10
WP_160212179.1|30637_31531_-	DUF1351 domain-containing protein	NA	U5U3Y3	Lactobacillus_phage	31.6	5.0e-25
WP_160212180.1|31717_31861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160212181.1|31874_32141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160212182.1|32122_32590_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_160212183.1|32672_32888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004165747.1|32884_33127_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004165746.1|33288_33660_+	helix-turn-helix transcriptional regulator	NA	A8ATX5	Listeria_phage	35.2	6.0e-09
WP_159225223.1|33671_34079_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_160212184.1|34152_34671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160212185.1|34679_35105_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_159216943.1|35424_36102_+	hypothetical protein	NA	A0A173G9H4	Propionibacterium_phage	67.6	6.0e-07
WP_159216930.1|36190_36415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160212186.1|36502_37678_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9I5L3	Streptococcus_phage	26.1	4.8e-36
42053:42068	attR	CCTGATAAATCAGTAA	NA	NA	NA	NA
>prophage 2
NZ_CP028249	Pediococcus acidilactici strain SRCM102732 chromosome, complete genome	2018117	974934	1030182	2018117	transposase,tRNA	unidentified_phage(26.67%)	50	NA	NA
WP_128212102.1|974934_976008_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.2	6.3e-43
WP_128211732.1|976028_976616_+	phenolic acid decarboxylase	NA	NA	NA	NA	NA
WP_002829878.1|976637_977162_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053905821.1|977351_978140_-	glucose 1-dehydrogenase	NA	A0A0M4JSW6	Mollivirus	28.7	2.2e-13
WP_002831159.1|978344_978578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053905820.1|979013_980405_+|tRNA	asparagine--tRNA ligase	tRNA	A0A1V0SDB6	Indivirus	35.7	4.9e-72
WP_128211730.1|980504_981884_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_004166656.1|982016_982319_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002831165.1|982471_983125_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_053905819.1|983108_984536_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.3	2.5e-10
WP_053905818.1|984546_985122_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_128211776.1|986834_988985_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	59.9	1.5e-256
WP_002829866.1|988995_989583_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	53.8	2.6e-51
WP_053905816.1|989597_990374_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	1.8e-07
WP_053905815.1|990354_991416_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_128211778.1|991363_992593_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.2	4.2e-83
WP_053905813.1|992589_993030_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_002831175.1|993022_994429_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_002831177.1|994671_995295_-	MarC family protein	NA	NA	NA	NA	NA
WP_053905812.1|995523_996411_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053905811.1|996526_998002_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_053905810.1|998064_998661_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_053905809.1|998653_999070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053905808.1|999204_999573_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_053905822.1|999920_1000112_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_119178960.1|1000153_1000528_+	antitoxin HicB	NA	A0A1L2JY34	Aeribacillus_phage	35.9	8.4e-11
WP_053905806.1|1000628_1000961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053905805.1|1001044_1002187_-	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_053905804.1|1002600_1003536_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002829849.1|1003711_1004749_+	zinc-dependent alcohol dehydrogenase family protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	29.5	6.4e-08
WP_004166638.1|1005088_1006258_-	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_128211920.1|1006404_1006731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004166637.1|1006740_1007202_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_004166634.1|1009054_1010071_-	general stress protein	NA	NA	NA	NA	NA
WP_004166633.1|1010092_1011463_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_036671510.1|1011628_1011877_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_160212201.1|1012448_1013378_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	29.9	1.6e-18
WP_128474541.1|1013670_1015335_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_126130461.1|1015556_1016486_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	29.9	1.2e-18
WP_126130462.1|1016463_1017402_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_008842402.1|1019212_1020547_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.2	2.2e-29
WP_005919347.1|1020699_1021230_-	MFS transporter	NA	NA	NA	NA	NA
WP_075139729.1|1021244_1021478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124623.1|1022075_1023026_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_080561955.1|1022941_1023472_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	38.7	7.2e-16
WP_008842398.1|1023441_1024035_+	AlwI family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_128472081.1|1026164_1027730_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_024862528.1|1028168_1028534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002831219.1|1028688_1028919_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_128212102.1|1029108_1030182_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.2	6.3e-43
>prophage 3
NZ_CP028249	Pediococcus acidilactici strain SRCM102732 chromosome, complete genome	2018117	1503469	1512032	2018117		Synechococcus_phage(33.33%)	9	NA	NA
WP_053906056.1|1503469_1504051_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.2	1.5e-22
WP_053906057.1|1504050_1505097_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	37.7	2.7e-54
WP_053906058.1|1505099_1506569_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.3	1.6e-57
WP_053906059.1|1506553_1508758_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.2	3.1e-145
WP_128211717.1|1508775_1509450_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002831740.1|1509446_1509707_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_053906060.1|1509693_1510428_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	42.5	1.4e-41
WP_053906061.1|1510405_1511566_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_053906062.1|1511549_1512032_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	1.1e-18
>prophage 4
NZ_CP028249	Pediococcus acidilactici strain SRCM102732 chromosome, complete genome	2018117	1542125	1549446	2018117	tRNA	Staphylococcus_phage(28.57%)	7	NA	NA
WP_002830297.1|1542125_1542971_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.6	2.1e-17
WP_053906266.1|1543365_1543848_-	dihydrofolate reductase	NA	G9J252	Bacillus_phage	35.4	1.0e-21
WP_002831862.1|1543865_1544816_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	59.9	5.1e-113
WP_053906265.1|1544820_1546716_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.3	2.5e-50
WP_053906264.1|1546718_1547927_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	35.1	1.1e-43
WP_053906263.1|1548042_1548912_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	37.6	1.3e-54
WP_002830304.1|1548975_1549446_-	nucleoside deoxyribosyltransferase	NA	K4I206	Lactobacillus_phage	34.6	2.7e-14
>prophage 5
NZ_CP028249	Pediococcus acidilactici strain SRCM102732 chromosome, complete genome	2018117	1573283	1658110	2018117	terminase,plate,protease,tRNA,tail,portal,integrase,head,holin,capsid	Lactobacillus_phage(39.53%)	100	1618670:1618690	1658252:1658272
WP_002830328.1|1573283_1573994_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002830329.1|1574089_1575229_-	RNA polymerase sigma factor RpoD	NA	M4SMP8	Cyanophage	35.1	8.5e-38
WP_053906253.1|1575246_1577103_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	33.1	8.6e-56
WP_053906252.1|1577448_1579521_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002830333.1|1579520_1580420_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_002830334.1|1580705_1581467_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_002830335.1|1581469_1582384_-	GTPase Era	NA	NA	NA	NA	NA
WP_004165942.1|1582408_1582792_-	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_002830337.1|1582775_1583246_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_053906251.1|1583250_1584219_-	phosphate starvation-inducible protein PhoH	NA	L7TP00	Rhizobium_phage	47.6	1.8e-49
WP_002830339.1|1584230_1584674_-	GatB/YqeY domain-containing protein	NA	A0A0K2FLI9	Brevibacillus_phage	35.9	1.5e-14
WP_002830340.1|1584732_1584918_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002830341.1|1585117_1585927_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_053906250.1|1585949_1586354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053906249.1|1586571_1587462_-	deoxyribonuclease IV	NA	A0A2L2DJK8	Acanthamoeba_polyphaga_mimivirus	32.3	6.2e-28
WP_128211461.1|1587464_1588670_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_053906247.1|1588662_1589820_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_002830347.1|1589832_1590711_-	YitT family protein	NA	NA	NA	NA	NA
WP_053906246.1|1590992_1592774_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002830351.1|1592789_1594064_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	25.7	7.8e-24
WP_128211936.1|1594477_1595347_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	38.7	2.2e-22
WP_002830353.1|1595331_1595955_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_002830354.1|1596045_1596495_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_002830361.1|1596504_1598736_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	S4TRQ0	Salmonella_phage	38.5	7.6e-06
WP_002830362.1|1598843_1599173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160212216.1|1599187_1599925_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_053906245.1|1599934_1600882_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_053906244.1|1601207_1602506_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	1.3e-63
WP_002831915.1|1602729_1602960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002830367.1|1603774_1603975_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	54.8	1.3e-10
WP_053906243.1|1604511_1605696_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_053906242.1|1605927_1606923_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	44.4	8.4e-74
WP_002830371.1|1606945_1608529_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_002831922.1|1608703_1609162_-	flavodoxin	NA	NA	NA	NA	NA
WP_002831923.1|1609263_1609713_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053906241.1|1609815_1611453_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.0	2.3e-28
WP_128211754.1|1611782_1612520_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_128211752.1|1612731_1613109_-	general stress protein	NA	NA	NA	NA	NA
WP_002831926.1|1613701_1614211_+	membrane protein	NA	NA	NA	NA	NA
WP_002831927.1|1614333_1614600_+	membrane protein	NA	NA	NA	NA	NA
WP_053906569.1|1615059_1615482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053906572.1|1616163_1616802_-	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002830382.1|1617205_1618315_-	L-lactate oxidase	NA	NA	NA	NA	NA
1618670:1618690	attL	AAGGAGAGTACAGGATTTGAA	NA	NA	NA	NA
WP_128211675.1|1619415_1620537_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N7IR99	Lactobacillus_phage	52.7	3.0e-96
WP_128211673.1|1620520_1620763_-|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	57.9	7.6e-05
WP_128211677.1|1620762_1621047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075139822.1|1621096_1621243_-	XkdX family protein	NA	NA	NA	NA	NA
WP_128211671.1|1621242_1621521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128211669.1|1621520_1622480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128211667.1|1622472_1624206_-|plate	phage baseplate upper protein	plate	O03968	Lactobacillus_phage	49.4	3.0e-66
WP_128211665.1|1624205_1624517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128211663.1|1624517_1624838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159215560.1|1624827_1625913_-	hypothetical protein	NA	A0A0M7RDS2	Lactobacillus_phage	43.5	2.8e-75
WP_128211658.1|1625971_1626805_-|tail	phage tail family protein	tail	A0A0M7RF73	Lactobacillus_phage	36.8	2.5e-47
WP_128211656.1|1626817_1631932_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0K0MWQ1	Streptococcus_phage	33.3	1.2e-86
WP_128211654.1|1632138_1632543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159215558.1|1632679_1633282_-|tail	phage tail protein	tail	O36159	Streptococcus_virus	48.2	8.4e-45
WP_159215557.1|1633294_1633669_-	DUF806 family protein	NA	Q38220	Leuconostoc_phage	32.4	1.3e-14
WP_128211804.1|1633671_1634085_-|tail	phage tail protein	tail	A0A286QQY0	Streptococcus_phage	54.5	4.0e-30
WP_159216229.1|1634084_1634441_-|head	phage head closure protein	head	A8YQJ4	Lactobacillus_phage	35.5	4.3e-12
WP_128211808.1|1634421_1634745_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9AZM1	Lactococcus_phage	33.3	3.7e-07
WP_128211810.1|1634760_1635231_-	Ig domain-containing protein	NA	A0A1D6Z291	Staphylococcus_phage	47.0	1.9e-20
WP_128211818.1|1635313_1636528_-|capsid	phage major capsid protein	capsid	D2KRA9	Lactobacillus_phage	59.6	1.1e-83
WP_128211820.1|1636648_1637239_-|head,protease	HK97 family phage prohead protease	head,protease	Q9AZE1	Lactococcus_phage	49.2	5.0e-42
WP_128211812.1|1637222_1638335_-|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	36.3	9.7e-63
WP_128211814.1|1638535_1640410_-|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	41.4	3.0e-141
WP_128211816.1|1640409_1640874_-|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	61.3	4.5e-46
WP_128212003.1|1641072_1641372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128212001.1|1641368_1641824_-	HNH endonuclease	NA	Q9AZM8	Lactococcus_phage	38.6	5.4e-28
WP_159215554.1|1641908_1642229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128211997.1|1642450_1642885_-	RNA polymerase subunit sigma-70	NA	O03925	Lactobacillus_phage	34.8	1.2e-13
WP_128211995.1|1643221_1643485_-	hypothetical protein	NA	A0A2K9VC51	Lactobacillus_phage	58.1	1.1e-20
WP_159215567.1|1643498_1643741_-	hypothetical protein	NA	A8ASM5	Listeria_phage	55.2	4.9e-12
WP_159215553.1|1643810_1644176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128211852.1|1644192_1644393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159215552.1|1644392_1644533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128211854.1|1644535_1644907_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_128211856.1|1645039_1645441_-	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	46.3	5.3e-27
WP_128211858.1|1645421_1646054_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_128211860.1|1646171_1646987_-	ATP-binding protein	NA	O03914	Lactobacillus_phage	45.3	6.9e-58
WP_128211862.1|1646967_1647720_-	hypothetical protein	NA	A0A1W6JNI1	Staphylococcus_phage	49.8	2.3e-52
WP_128211864.1|1647758_1647989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128211866.1|1647972_1648656_-	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	64.8	1.7e-81
WP_128211868.1|1648667_1649093_-	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	58.2	2.1e-42
WP_128211870.1|1649085_1649784_-	ERF family protein	NA	I6TJU2	Staphylococcus_virus	38.3	7.6e-21
WP_128211872.1|1649784_1650240_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_159215551.1|1650463_1651126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128211987.1|1651235_1651490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128211985.1|1651590_1651920_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_128211989.1|1652216_1652999_-	phage antirepressor	NA	A0A1Q1PVU2	Staphylococcus_phage	58.8	4.9e-85
WP_128211983.1|1653104_1653299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159215550.1|1653290_1653428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002831840.1|1653441_1653651_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_128211981.1|1653718_1654027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159215549.1|1654016_1654223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002831842.1|1654479_1654821_+	helix-turn-helix transcriptional regulator	NA	D2IZV9	Enterococcus_phage	38.1	2.3e-15
WP_128212081.1|1654829_1655237_+	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	36.1	4.0e-14
WP_159215548.1|1655299_1656427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053905909.1|1656573_1656771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128212073.1|1656994_1658110_+|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	52.2	1.5e-100
1658252:1658272	attR	AAGGAGAGTACAGGATTTGAA	NA	NA	NA	NA
>prophage 1
NZ_CP028250	Pediococcus acidilactici strain SRCM102732 plasmid unnamed1, complete sequence	55369	23355	28259	55369	transposase	Lactobacillus_phage(50.0%)	7	NA	NA
WP_160212222.1|23355_23868_-	alcohol dehydrogenase	NA	A8ATW6	Listeria_phage	40.4	4.2e-21
WP_053906092.1|23897_24182_-	cytosolic protein	NA	NA	NA	NA	NA
WP_128211906.1|24557_24683_+	helix-turn-helix domain-containing protein	NA	Q6J1X3	Lactobacillus_phage	90.2	9.3e-15
WP_085058321.1|24851_25556_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.3	2.2e-129
WP_128211902.1|25592_25694_+	hypothetical protein	NA	Q6J1X2	Lactobacillus_phage	97.0	4.2e-10
WP_024863179.1|26116_26719_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	41.4	2.5e-20
WP_128212102.1|27185_28259_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.2	6.3e-43
