The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	0	41484	3226492	integrase,portal,transposase,tail,protease,capsid,terminase	Lactobacillus_phage(94.74%)	49	25522:25535	37531:37544
WP_015380192.1|1324_2146_-	hypothetical protein	NA	A0A2P0ZLE2	Lactobacillus_phage	100.0	6.8e-154
WP_160248158.1|2149_6697_-|tail	phage tail tape measure protein	tail	A0A2P0ZLF1	Lactobacillus_phage	82.7	0.0e+00
WP_003643912.1|6715_6937_-	hypothetical protein	NA	A0A2P0ZLD9	Lactobacillus_phage	98.6	3.9e-32
WP_015380190.1|6960_7275_-	hypothetical protein	NA	A0A2P0ZLF3	Lactobacillus_phage	90.4	9.5e-48
WP_015380189.1|7366_7978_-	hypothetical protein	NA	A0A2P0ZLF5	Lactobacillus_phage	96.6	3.3e-105
WP_015380188.1|7992_8415_-	hypothetical protein	NA	A0A2P0ZLE4	Lactobacillus_phage	97.1	6.3e-71
WP_015380187.1|8411_8819_-	hypothetical protein	NA	A0A2P0ZLD7	Lactobacillus_phage	94.1	2.0e-66
WP_015380186.1|8815_9205_-	hypothetical protein	NA	A0A2P0ZLD1	Lactobacillus_phage	87.6	3.8e-62
WP_015380185.1|9185_9491_-	hypothetical protein	NA	A0A2P0ZLD5	Lactobacillus_phage	94.1	6.6e-46
WP_015380184.1|9629_10808_-|capsid	phage major capsid protein	capsid	A0A2P0ZLD6	Lactobacillus_phage	99.7	2.3e-219
WP_015380183.1|10828_11581_-|protease	Clp protease ClpP	protease	A0A2P0ZLE3	Lactobacillus_phage	99.6	7.1e-134
WP_015380182.1|11567_12710_-|portal	phage portal protein	portal	A0A2P0ZLC9	Lactobacillus_phage	97.4	5.3e-213
WP_015380181.1|12728_14408_-|terminase	terminase large subunit	terminase	A0A2P0ZLE5	Lactobacillus_phage	98.8	0.0e+00
WP_015380180.1|14404_14692_-	hypothetical protein	NA	A0A2P0ZLC8	Lactobacillus_phage	96.8	2.2e-43
WP_015380179.1|14800_15052_-	hypothetical protein	NA	A0A2P0ZLD2	Lactobacillus_phage	91.6	3.9e-36
WP_144063628.1|15196_15436_-	hypothetical protein	NA	A0A2P0ZLD3	Lactobacillus_phage	81.0	6.1e-31
WP_102115504.1|15438_15777_-	HNH endonuclease	NA	A0A2P0ZLC6	Lactobacillus_phage	92.0	3.4e-59
WP_015380177.1|15760_15976_-	hypothetical protein	NA	A0A2P0ZLC2	Lactobacillus_phage	87.3	1.4e-29
WP_015380176.1|16181_16751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160248159.1|16935_18111_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_015380175.1|18290_18980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015380174.1|19055_19469_-	hypothetical protein	NA	A0A2P0ZLC0	Lactobacillus_phage	99.3	1.4e-70
WP_015380173.1|19480_19792_-	hypothetical protein	NA	A0A2P0ZLD0	Lactobacillus_phage	91.3	2.1e-47
WP_015380172.1|19928_20408_-	hypothetical protein	NA	A0A2P0ZL79	Lactobacillus_phage	93.2	2.7e-78
WP_015380170.1|20585_20918_-	VRR-NUC domain-containing protein	NA	A0A2P0ZLB6	Lactobacillus_phage	95.5	3.7e-58
WP_015380169.1|21175_22450_-	helicase	NA	A0A2P0ZLC4	Lactobacillus_phage	97.4	4.8e-239
WP_015380168.1|22446_23241_-	hypothetical protein	NA	A0A2P0ZLB0	Lactobacillus_phage	85.6	7.1e-124
WP_015380167.1|23678_24233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015380166.1|24246_24870_-	hypothetical protein	NA	A0A2P0ZLB9	Lactobacillus_phage	98.4	2.0e-102
WP_015380165.1|24872_25589_-	AAA family ATPase	NA	A0A2P0ZLB2	Lactobacillus_phage	98.6	7.8e-114
25522:25535	attL	CACCAGATAAAGAA	NA	NA	NA	NA
WP_043992724.1|25585_26962_-	DEAD/DEAH box helicase	NA	A0A2P0ZLA5	Lactobacillus_phage	96.5	3.1e-236
WP_160248160.1|26961_27441_-	siphovirus Gp157 family protein	NA	A0A2P0ZLB3	Lactobacillus_phage	93.1	3.2e-79
WP_021730257.1|27543_27714_-	hypothetical protein	NA	A0A2P0ZLA6	Lactobacillus_phage	98.2	5.5e-26
WP_015380160.1|27685_27871_-	hypothetical protein	NA	A0A2P0ZLA3	Lactobacillus_phage	88.5	7.0e-27
WP_015380158.1|28020_28302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043993003.1|28416_28689_-	DUF771 domain-containing protein	NA	E9LUT3	Lactobacillus_phage	66.7	4.5e-30
WP_015380156.1|28754_28958_-	hypothetical protein	NA	A0A2P0ZLA4	Lactobacillus_phage	85.1	5.5e-25
WP_015380155.1|28961_29171_-	hypothetical protein	NA	A0A2P0ZL97	Lactobacillus_phage	98.6	1.6e-30
WP_015380154.1|29477_29867_+	helix-turn-helix transcriptional regulator	NA	A0A2P0ZLA1	Lactobacillus_phage	97.6	1.5e-66
WP_003643876.1|29876_30308_+	hypothetical protein	NA	A0A2P0ZLA0	Lactobacillus_phage	100.0	7.6e-80
WP_015380153.1|30331_30772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380152.1|30859_31483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380151.1|31605_34398_+	N-6 DNA methylase	NA	Q6NE04	Leptospira_phage	35.4	9.4e-147
WP_015380150.1|34568_35699_+|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	48.2	1.2e-92
WP_080125236.1|36286_38557_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	31.4	2.6e-118
37531:37544	attR	CACCAGATAAAGAA	NA	NA	NA	NA
WP_003643147.1|38618_38906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643148.1|39020_39533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080125234.1|39646_40126_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013355445.1|40818_41484_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	51726	52584	3226492		Cedratvirus(100.0%)	1	NA	NA
WP_160248163.1|51726_52584_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	33.0	2.1e-17
>prophage 3
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	57844	59360	3226492		Lactobacillus_virus(50.0%)	2	NA	NA
WP_160248164.1|57844_58492_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	47.5	5.3e-45
WP_011101356.1|58673_59360_-	glycerophosphoryl diester phosphodiesterase	NA	M1ICP4	Paramecium_bursaria_Chlorella_virus	27.5	6.3e-12
>prophage 4
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	62511	63612	3226492		Bacillus_virus(100.0%)	1	NA	NA
WP_011101354.1|62511_63612_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	7.7e-28
>prophage 5
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	69931	74100	3226492	tRNA	Staphylococcus_phage(100.0%)	3	NA	NA
WP_003643180.1|69931_72358_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.1	0.0e+00
WP_021357522.1|72853_73504_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_075060691.1|73503_74100_+	SAM-dependent methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	45.5	2.1e-35
>prophage 6
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	89087	90275	3226492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003644222.1|89087_90275_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.2	3.2e-144
>prophage 7
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	100480	101368	3226492		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_015380118.1|100480_101368_-	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	34.2	1.6e-12
>prophage 8
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	114056	119332	3226492		Streptococcus_phage(50.0%)	4	NA	NA
WP_003644210.1|114056_116162_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	48.1	2.0e-157
WP_003643297.1|116317_116554_-	YkuJ family protein	NA	NA	NA	NA	NA
WP_003644209.1|116745_117933_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_015380113.1|118093_119332_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	27.9	3.4e-16
>prophage 9
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	126096	132157	3226492	integrase,protease	Agrobacterium_phage(25.0%)	5	121190:121203	130781:130794
121190:121203	attL	GAAAATCATTTGGA	NA	NA	NA	NA
WP_003644206.1|126096_128316_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	40.4	7.3e-126
WP_015380112.1|128430_128982_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6D2	Bacillus_phage	42.8	2.4e-30
WP_003643287.1|129175_129565_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015380111.1|130105_131071_-	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	36.4	1.3e-10
130781:130794	attR	GAAAATCATTTGGA	NA	NA	NA	NA
WP_003643240.1|131077_132157_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	1.4e-18
>prophage 10
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	142131	146396	3226492		Streptococcus_phage(33.33%)	3	NA	NA
WP_160248167.1|142131_143709_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.1	7.7e-29
WP_003643226.1|144006_145329_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	1.5e-25
WP_015380105.1|145499_146396_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	35.4	5.5e-48
>prophage 11
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	149457	149856	3226492		Hokovirus(100.0%)	1	NA	NA
WP_003643222.1|149457_149856_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	39.9	9.3e-16
>prophage 12
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	153176	153908	3226492		Clostridium_phage(100.0%)	1	NA	NA
WP_021356761.1|153176_153908_+	gamma-D-glutamate-meso-diaminopimelate muropeptidase	NA	A0A0A8WF62	Clostridium_phage	43.7	1.0e-15
>prophage 13
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	172543	173677	3226492		Streptococcus_phage(100.0%)	1	NA	NA
WP_064523011.1|172543_173677_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	77.3	5.5e-170
>prophage 14
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	195305	202373	3226492	integrase	Catovirus(33.33%)	7	194119:194132	202855:202868
194119:194132	attL	CACCATTGTAAATT	NA	NA	NA	NA
WP_013355388.1|195305_196253_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI6	Catovirus	33.9	4.4e-40
WP_015380066.1|196270_197044_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_013355386.1|197030_197759_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_015380065.1|197770_198541_-	Polysaccharide biosynthesis protein, chain length regulator	NA	NA	NA	NA	NA
WP_072533917.1|198896_199499_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	41.3	4.8e-32
WP_015380061.1|200645_201875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015380060.1|201977_202373_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	42.2	1.7e-17
202855:202868	attR	CACCATTGTAAATT	NA	NA	NA	NA
>prophage 15
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	211603	216211	3226492		Streptococcus_phage(33.33%)	4	NA	NA
WP_043992692.1|211603_212722_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	79.5	1.5e-172
WP_003643315.1|212871_213588_-	aquaporin family protein	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	32.7	5.6e-19
WP_003643314.1|213777_214707_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_160248177.1|215092_216211_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	28.4	6.0e-20
>prophage 16
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	225773	230156	3226492		Diachasmimorpha_longicaudata_entomopoxvirus(33.33%)	5	NA	NA
WP_120787326.1|225773_227108_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.9	7.6e-38
WP_015380046.1|227120_228128_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_015380044.1|228314_228515_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	3.1e-20
WP_003641352.1|228858_229224_+	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_015380043.1|229379_230156_-	lysozyme	NA	A0A141HSE6	Bacillus_phage	30.1	7.6e-06
>prophage 17
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	233625	239993	3226492		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_160248179.1|233625_235965_-	cation-translocating P-type ATPase	NA	M1HI01	Paramecium_bursaria_Chlorella_virus	24.2	5.4e-39
WP_043992687.1|236231_236807_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011101269.1|237263_238637_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	50.0	3.2e-124
WP_015380038.1|238970_239993_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	26.5	3.3e-17
>prophage 18
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	244517	252414	3226492		Ralstonia_phage(33.33%)	6	NA	NA
WP_003641339.1|244517_246557_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	33.3	7.9e-95
WP_003644128.1|246573_248841_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.7	4.8e-133
WP_003641337.1|249281_250451_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_160248180.1|250563_251112_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_015380034.1|251134_251722_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_015380033.1|251772_252414_-	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	42.0	6.7e-24
>prophage 19
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	257456	260950	3226492		Bacillus_phage(50.0%)	2	NA	NA
WP_003641327.1|257456_259217_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	24.3	2.2e-24
WP_015380030.1|259216_260950_-	thiol reductant ABC exporter subunit CydD	NA	A0A076FI99	Aureococcus_anophage	22.6	1.0e-10
>prophage 20
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	275043	276432	3226492		Lactobacillus_phage(100.0%)	1	NA	NA
WP_011101260.1|275043_276432_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	35.0	9.0e-58
>prophage 21
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	283957	284956	3226492	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_160248181.1|283957_284956_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	3.4e-51
>prophage 22
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	296225	296963	3226492		Pithovirus(100.0%)	1	NA	NA
WP_003645514.1|296225_296963_-	metal ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.1	4.4e-11
>prophage 23
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	315945	317654	3226492		Bacillus_phage(50.0%)	2	NA	NA
WP_015379998.1|315945_316833_-	energy-coupling factor ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.6	4.3e-13
WP_003644096.1|316808_317654_-	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.0e-21
>prophage 24
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	339771	359538	3226492	tRNA,protease	uncultured_Mediterranean_phage(33.33%)	11	NA	NA
WP_003641250.1|339771_341868_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	9.4e-67
WP_003638057.1|342009_342480_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003641249.1|342496_342910_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_011101245.1|343172_343853_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_003641247.1|344506_348148_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.3	1.3e-63
WP_016511247.1|348165_351771_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	25.1	1.5e-51
WP_003644087.1|352028_352631_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641244.1|352809_355314_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.3	2.9e-123
WP_003644086.1|355332_355800_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003644085.1|357342_358620_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.5	9.4e-94
WP_003641239.1|358902_359538_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	47.5	8.9e-53
>prophage 25
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	370534	371735	3226492	transposase	Lactococcus_phage(50.0%)	2	NA	NA
WP_003641227.1|370534_370735_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	78.8	3.0e-23
WP_086989537.1|370959_371735_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
>prophage 26
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	381283	383185	3226492		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_015379980.1|381283_383185_+	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	33.0	1.3e-35
>prophage 27
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	388955	465905	3226492	integrase,bacteriocin,transposase,tRNA,protease	Lactobacillus_phage(22.22%)	62	428507:428528	431341:431362
WP_021357097.1|388955_389285_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_160248188.1|389420_390749_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_015379974.1|390897_391791_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043992670.1|391939_392917_+	hydroxyacid dehydrogenase	NA	A0A285PXZ1	Cedratvirus	32.3	2.1e-32
WP_015379972.1|392931_394329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086989537.1|394631_395407_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_015379971.1|395740_397075_-	gluconate transporter	NA	NA	NA	NA	NA
WP_015379970.1|397324_398539_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	33.8	2.5e-48
WP_015379969.1|398554_399697_+	lactonase family protein	NA	NA	NA	NA	NA
WP_160248189.1|399789_400458_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_016526995.1|400589_401159_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003641207.1|401209_401974_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_080125228.1|401970_403221_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_015379965.1|403184_404186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101231.1|404605_405370_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003641203.1|405722_406049_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015379963.1|406240_407122_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_015379962.1|407164_408973_-	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	36.1	1.0e-77
WP_003641200.1|409230_409428_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003644064.1|409647_409914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015379961.1|409964_411197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015379960.1|411232_412639_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_015379959.1|413090_414098_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	43.0	1.4e-63
WP_015379958.1|414136_415432_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.4	1.1e-57
WP_160248465.1|416971_417601_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_015379956.1|417709_418183_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015379953.1|418458_420348_-	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	26.2	5.2e-16
WP_003645746.1|420534_421461_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.8	3.2e-19
WP_015379952.1|421531_422083_-	helix-turn-helix domain-containing protein	NA	X2CXD8	Lactobacillus_phage	48.4	8.4e-07
WP_015379951.1|422182_422935_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003644054.1|423584_423707_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_015379946.1|427596_428127_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_080125226.1|428440_428674_-	hypothetical protein	NA	NA	NA	NA	NA
428507:428528	attL	CTCATTGGCAGCGATAAGGTTA	NA	NA	NA	NA
WP_120787327.1|428640_429045_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_080125224.1|429049_429631_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_160248190.1|429641_430559_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	44.3	7.7e-74
WP_043992664.1|431897_433484_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	62.7	3.5e-175
431341:431362	attR	CTCATTGGCAGCGATAAGGTTA	NA	NA	NA	NA
WP_160248191.1|433497_436371_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_003645758.1|436598_439133_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.4	3.5e-68
WP_003644050.1|439314_439887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644049.1|439992_440325_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003645760.1|440686_441697_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_013355307.1|441828_442659_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_003641176.1|442832_443273_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003644046.1|443333_443756_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003641174.1|443770_443953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160248192.1|443965_444511_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003641172.1|444522_444777_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003645763.1|445017_446865_-	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	23.7	5.8e-20
WP_003645764.1|446854_447238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379937.1|447722_450230_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_043992660.1|450503_451802_+	MFS transporter	NA	NA	NA	NA	NA
WP_015640093.1|451878_452754_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	28.9	2.8e-20
WP_003645768.1|452762_453470_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003645769.1|453625_453970_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080125222.1|454189_454876_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_160248467.1|455438_455807_+	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	42.7	1.3e-16
WP_015379932.1|456040_456409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004271307.1|458231_459155_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	6.7e-33
WP_003641157.1|461206_461725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641156.1|461748_463680_-	AAA family ATPase	NA	G3MAX6	Bacillus_virus	38.1	2.5e-42
WP_003645774.1|464348_465905_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.8	1.5e-16
>prophage 28
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	477166	480506	3226492		Klosneuvirus(50.0%)	4	NA	NA
WP_003644029.1|477166_477604_-	NUDIX domain-containing protein	NA	A0A1V0SJK7	Klosneuvirus	40.6	3.6e-05
WP_015379922.1|477692_478988_+	GTPase HflX	NA	NA	NA	NA	NA
WP_003641140.1|479099_479660_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011101192.1|479744_480506_+	sulfite exporter TauE/SafE family protein	NA	Q6EVM7	Oenoccocus_phage	39.6	1.7e-42
>prophage 29
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	491735	494486	3226492		Planktothrix_phage(50.0%)	3	NA	NA
WP_003641125.1|491735_492476_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	1.5e-35
WP_003641122.1|493008_493260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355278.1|493493_494486_-	D-2-hydroxyacid dehydrogenase	NA	M1HI29	Paramecium_bursaria_Chlorella_virus	34.3	3.8e-42
>prophage 30
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	498893	501980	3226492		Bacillus_phage(100.0%)	5	NA	NA
WP_003645788.1|498893_499475_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	27.3	8.5e-10
WP_003641114.1|499625_499775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015379915.1|499851_500271_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003645789.1|500324_501143_-	pyridoxal kinase	NA	NA	NA	NA	NA
WP_003641111.1|501506_501980_-	alcohol dehydrogenase	NA	A0A218KDM1	Bacillus_phage	51.7	2.4e-10
>prophage 31
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	507598	509581	3226492		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003645793.1|507598_509581_-	acetyltransferase	NA	W6MVL2	Pseudomonas_phage	29.1	3.3e-29
>prophage 32
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	517914	521329	3226492		Moraxella_phage(50.0%)	4	NA	NA
WP_003644001.1|517914_519222_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.5	3.7e-45
WP_003641099.1|519501_519663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003644000.1|519877_520351_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003645798.1|520519_521329_+	LicD family protein	NA	A0A1V0SD50	Indivirus	32.4	7.2e-07
>prophage 33
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	541463	543281	3226492		Chlorella_virus(100.0%)	1	NA	NA
WP_003641075.1|541463_543281_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	36.5	1.4e-90
>prophage 34
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	553046	559999	3226492	tRNA	Cafeteria_roenbergensis_virus(25.0%)	9	NA	NA
WP_160248469.1|553046_553811_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	45.8	2.3e-55
WP_003645814.1|553873_554410_+	exonuclease	NA	A0A2I6PEZ7	Staphylococcus_phage	32.5	5.2e-22
WP_003641062.1|554633_555149_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003643982.1|555154_555616_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_003641060.1|555725_556703_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003643980.1|556726_557419_-	uracil-DNA glycosylase	NA	A0A1R3T3N6	Sphenicid_alphaherpesvirus	40.6	4.5e-42
WP_003641058.1|557534_558404_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_015379900.1|558427_558991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641056.1|559264_559999_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	2.0e-32
>prophage 35
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	569776	572687	3226492		Staphylococcus_phage(50.0%)	2	NA	NA
WP_003641053.1|569776_570247_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	61.0	8.6e-45
WP_064523191.1|570272_572687_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.4	2.7e-86
>prophage 36
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	576422	577751	3226492		Streptococcus_phage(100.0%)	1	NA	NA
WP_003643976.1|576422_577751_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	71.1	7.3e-174
>prophage 37
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	584588	591427	3226492		Streptococcus_phage(40.0%)	6	NA	NA
WP_003641041.1|584588_585179_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.0	3.0e-55
WP_003645820.1|585337_586312_+	phosphoglycerate dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	28.6	4.4e-19
WP_015379894.1|586522_588175_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003641038.1|588599_589532_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	36.8	6.7e-49
WP_003645822.1|589544_590546_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	55.0	3.2e-97
WP_003641036.1|590542_591427_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.5	4.2e-08
>prophage 38
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	595873	602865	3226492		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_015379892.1|595873_598729_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.4	3.2e-299
WP_015379891.1|598763_600767_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_015379890.1|600915_601563_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_064523214.1|601668_602865_-	MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	19.5	1.2e-05
>prophage 39
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	606383	614153	3226492		Streptococcus_phage(33.33%)	7	NA	NA
WP_003646085.1|606383_608111_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	56.9	7.7e-192
WP_003646084.1|608329_608782_+	DUF3290 domain-containing protein	NA	NA	NA	NA	NA
WP_015379885.1|608782_609415_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_015379884.1|609520_610459_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.6	2.0e-85
WP_011101153.1|610651_612064_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_160248197.1|612454_613135_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003641010.1|613232_614153_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.8	2.5e-72
>prophage 40
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	618675	620252	3226492		Bacillus_virus(50.0%)	2	NA	NA
WP_003641003.1|618675_619431_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.1	1.4e-15
WP_015379880.1|619442_620252_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	6.3e-11
>prophage 41
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	623299	625424	3226492		Bacillus_phage(100.0%)	2	NA	NA
WP_015379877.1|623299_624703_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	2.1e-25
WP_003640997.1|624695_625424_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.9	2.5e-35
>prophage 42
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	632085	635245	3226492		Streptococcus_phage(66.67%)	3	NA	NA
WP_160248199.1|632085_633438_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	40.4	2.5e-68
WP_003640991.1|633504_634152_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	40.4	4.5e-36
WP_003643949.1|634342_635245_-	phosphate ABC transporter substrate-binding protein	NA	E3SM63	Prochlorococcus_phage	28.7	9.2e-11
>prophage 43
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	638967	646639	3226492	tRNA,protease	uncultured_virus(50.0%)	6	NA	NA
WP_015379874.1|638967_640593_-	chaperonin GroEL	NA	A0A240F766	uncultured_virus	54.3	1.9e-155
WP_003640985.1|640648_640933_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	40.2	3.5e-09
WP_015379873.1|641125_641770_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003640983.1|641934_642612_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003643947.1|642780_644763_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.7	2.0e-50
WP_003640980.1|645592_646639_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.7	3.5e-62
>prophage 44
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	649748	650519	3226492		Bacillus_phage(100.0%)	1	NA	NA
WP_003640975.1|649748_650519_+	phosphonate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.8	4.9e-13
>prophage 45
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	654240	668959	3226492		Streptococcus_phage(40.0%)	17	NA	NA
WP_015379869.1|654240_655236_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.9	7.7e-51
WP_003640969.1|655374_656160_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_015379868.1|656163_657060_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.3	1.9e-80
WP_015379867.1|657158_657506_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_160248200.1|657530_658550_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.2	1.1e-31
WP_003640965.1|658566_658896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016510978.1|658892_659558_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640957.1|659955_660207_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003637790.1|660221_660821_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640956.1|660836_661145_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003644909.1|661166_662864_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
WP_003640954.1|663389_663896_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_160248201.1|663898_664507_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015379864.1|664729_664960_+	redoxin NrdH	NA	X2KRY7	Enterococcus_phage	40.0	1.7e-09
WP_160248202.1|665098_667264_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.3	9.8e-269
WP_003640950.1|667291_668302_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	60.5	3.1e-108
WP_003643936.1|668383_668959_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	41.7	4.9e-26
>prophage 46
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	682384	683797	3226492	tRNA	Moumouvirus(100.0%)	1	NA	NA
WP_015379855.1|682384_683797_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.0	3.1e-45
>prophage 47
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	689588	694334	3226492	transposase	Bacillus_phage(33.33%)	5	NA	NA
WP_160248203.1|689588_690125_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	45.8	1.4e-35
WP_160248204.1|690263_690560_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_015379853.1|690568_691252_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_003643927.1|691327_692659_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.3	5.4e-68
WP_160248205.1|692564_694334_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.0	2.7e-91
>prophage 48
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	719586	725002	3226492		Bacillus_virus(66.67%)	3	NA	NA
WP_031263668.1|719586_722241_-	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	28.9	6.8e-70
WP_003640900.1|722696_723524_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.0	6.5e-72
WP_003640899.1|723523_725002_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.1	2.5e-106
>prophage 49
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	728005	729979	3226492		Streptococcus_phage(50.0%)	2	NA	NA
WP_003640895.1|728005_728797_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	36.1	3.5e-30
WP_003640894.1|729157_729979_+	nicotinamide mononucleotide transporter	NA	A0A2K9VCL6	Lactobacillus_phage	42.2	3.3e-52
>prophage 50
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	744177	752049	3226492	tRNA,protease	Tupanvirus(25.0%)	6	NA	NA
WP_003642090.1|744177_745677_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.5	1.6e-89
WP_015379834.1|745780_746788_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003642088.1|746787_747675_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_003643854.1|747823_750061_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	47.8	6.0e-104
WP_003642086.1|750140_750683_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	26.0	1.5e-08
WP_003642085.1|750702_752049_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	23.8	2.6e-09
>prophage 51
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	763665	766465	3226492		Pneumococcus_phage(50.0%)	3	NA	NA
WP_160248210.1|763665_764172_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	32.1	1.9e-05
WP_015379829.1|764280_765303_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_003646529.1|765295_766465_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.6	2.9e-17
>prophage 52
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	774025	784766	3226492		Bacillus_virus(20.0%)	8	NA	NA
WP_015379823.1|774025_774796_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	9.8e-30
WP_003643845.1|774811_775825_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_015379822.1|775845_776898_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015379821.1|777593_779573_-	potassium transport system protein kup 1	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	35.6	2.1e-68
WP_003637688.1|779864_780257_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A291I9M9	Lactobacillus_phage	36.0	5.7e-10
WP_003642062.1|780665_781793_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.6	2.5e-29
WP_003642061.1|781792_782155_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_015379820.1|783179_784766_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	1.0e-73
>prophage 53
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	799976	903192	3226492	transposase,bacteriocin,tRNA,protease	uncultured_Mediterranean_phage(15.38%)	98	NA	NA
WP_160248212.1|799976_801308_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.5	8.0e-96
WP_003642042.1|801774_803388_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	1.2e-143
WP_003642041.1|803560_804169_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003642040.1|804213_804654_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_160248159.1|805012_806188_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_024971479.1|806376_807309_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_160248213.1|807323_808676_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.9	5.2e-26
WP_015379810.1|808695_809505_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_043992605.1|809674_810661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379808.1|810743_811766_-	YdcF family protein	NA	NA	NA	NA	NA
WP_003643830.1|812054_813035_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
WP_015379807.1|813400_814225_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003646504.1|814460_815843_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	33.2	5.7e-28
WP_003642030.1|815911_816748_-	pur operon repressor	NA	NA	NA	NA	NA
WP_003642029.1|817240_817504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160248214.1|817518_818061_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_015379806.1|818610_818886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642024.1|819242_820046_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003642023.1|820032_820731_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
WP_015379805.1|820998_821943_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_015379804.1|822252_823119_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003642020.1|823251_823503_-	Veg protein	NA	NA	NA	NA	NA
WP_003642019.1|823607_824498_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003643826.1|824494_825058_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_003643825.1|825044_825821_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_015379801.1|826072_826561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043992601.1|827123_828014_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_015379798.1|828047_829232_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_015379797.1|829561_829888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379796.1|830366_832418_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	4.5e-90
WP_015379795.1|832739_833129_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_015379793.1|833723_834566_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003642011.1|834565_835270_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_003642010.1|835291_836251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642009.1|836243_837518_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642008.1|837563_838481_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_043992598.1|838880_839894_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_015379789.1|840006_840753_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015379788.1|840902_841799_-	ROK family protein	NA	NA	NA	NA	NA
WP_003642002.1|841919_843356_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	9.7e-31
WP_043992963.1|843373_844729_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642000.1|844951_845374_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003641999.1|845363_845552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379786.1|845558_846920_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641997.1|846992_847703_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043992597.1|848108_849125_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015379784.1|849558_850335_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_015379783.1|850593_852903_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027821496.1|852997_853201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379782.1|853338_854025_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015379781.1|854118_854799_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_160248215.1|854885_855554_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_160248216.1|855621_856311_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015379778.1|856397_857777_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_004271307.1|860229_861153_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	6.7e-33
WP_160248217.1|861352_862528_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003643807.1|863124_863274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379772.1|863405_864152_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015379769.1|865258_865426_+|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnJ	bacteriocin	NA	NA	NA	NA
WP_003641972.1|865456_865630_+|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnK	bacteriocin	NA	NA	NA	NA
WP_003643805.1|865626_866295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643803.1|866319_866472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641969.1|866706_866910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379767.1|867114_867630_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_120787350.1|867785_867989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080125207.1|868095_868407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050495850.1|868868_869057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643800.1|869068_869212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011100995.1|869873_871058_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_015379763.1|871102_872479_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_003641966.1|873006_873822_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_015379762.1|873981_874854_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015379761.1|874924_875716_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003646460.1|875719_876874_+	MFS transporter	NA	NA	NA	NA	NA
WP_015379760.1|876877_877495_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003641945.1|877690_878413_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	3.2e-30
WP_003643774.1|878427_880257_-	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_160248218.1|880271_881789_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_043992584.1|882254_883586_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003641941.1|883663_884635_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_003643770.1|884635_886162_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_015379757.1|886399_886846_+	ribonuclease H-like protein	NA	NA	NA	NA	NA
WP_015379756.1|887017_887569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004271307.1|887586_888510_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	6.7e-33
WP_015379753.1|890395_891295_-	oxidoreductase	NA	NA	NA	NA	NA
WP_003646441.1|891431_892352_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_003641936.1|892517_893090_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_015379751.1|893193_893649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641934.1|893667_894138_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_011100975.1|894247_895444_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|895474_895984_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_003643763.1|896096_896465_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_015379750.1|896729_898235_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_015379749.1|898392_899061_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_015379748.1|899254_899818_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003641927.1|900047_900317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379746.1|900419_901379_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_016511449.1|901875_903192_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	29.6	6.6e-34
>prophage 54
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	906385	907477	3226492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003641921.1|906385_907477_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.7	7.2e-18
>prophage 55
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	928617	930560	3226492		Mycoplasma_phage(100.0%)	2	NA	NA
WP_015379732.1|928617_929715_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	42.0	5.3e-37
WP_003643740.1|929726_930560_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	22.5	3.8e-11
>prophage 56
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	939998	947391	3226492	protease	Bacillus_phage(25.0%)	8	NA	NA
WP_015379729.1|939998_940715_+	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	38.2	1.1e-19
WP_021356464.1|940711_941629_+	sce7725 family protein	NA	NA	NA	NA	NA
WP_080125206.1|941638_942013_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
WP_027821531.1|942417_943050_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XCL7	Enterococcus_phage	59.2	1.5e-15
WP_015379725.1|944101_944905_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2K9V574	Lactobacillus_phage	49.6	8.7e-13
WP_015379724.1|945026_945746_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015379723.1|945841_946603_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015379722.1|946731_947391_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.4	1.4e-13
>prophage 57
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	965036	967104	3226492		Bacillus_phage(100.0%)	2	NA	NA
WP_015379715.1|965036_965741_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.1	6.2e-31
WP_003643713.1|965727_967104_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	5.8e-25
>prophage 58
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	973920	974696	3226492	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_086989537.1|973920_974696_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
>prophage 59
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	979052	979457	3226492		Synechococcus_phage(100.0%)	1	NA	NA
WP_003646390.1|979052_979457_-	glycerol-3-phosphate cytidylyltransferase	NA	E3SJ88	Synechococcus_phage	42.1	1.1e-16
>prophage 60
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	988316	991782	3226492		Lactobacillus_phage(50.0%)	3	NA	NA
WP_003641839.1|988316_989105_-	nicotinamide mononucleotide transporter	NA	A0A2H4PB74	Lactobacillus_phage	75.4	4.3e-97
WP_003641837.1|989466_990258_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_015379705.1|990870_991782_+	cysteine synthase family protein	NA	A0A1X9I5K7	Streptococcus_phage	41.3	1.1e-56
>prophage 61
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1001843	1007043	3226492		Lactobacillus_phage(33.33%)	7	NA	NA
WP_011100931.1|1001843_1002392_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	29.3	2.1e-10
WP_003641832.1|1002692_1004039_-	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
WP_011100930.1|1004273_1004738_+	nucleoside-diphosphate kinase	NA	L7Y4C4	Megavirus	41.9	5.0e-21
WP_003641830.1|1004979_1005381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015379694.1|1005445_1006000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003646379.1|1006289_1006616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641827.1|1006710_1007043_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	36.8	2.9e-15
>prophage 62
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1020428	1028181	3226492		Clostridioides_phage(25.0%)	9	NA	NA
WP_003641816.1|1020428_1020632_+	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	39.7	9.8e-06
WP_003641815.1|1020644_1021058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355131.1|1021143_1021614_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003646372.1|1022205_1023036_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.2	4.0e-53
WP_021356729.1|1023055_1023538_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003643692.1|1023878_1024448_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015379685.1|1024477_1025884_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	7.3e-15
WP_015379684.1|1025880_1026540_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_015379683.1|1026660_1028181_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	30.9	1.6e-44
>prophage 63
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1035143	1037851	3226492		Streptococcus_phage(100.0%)	3	NA	NA
WP_003641796.1|1035143_1036217_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	50.3	6.4e-96
WP_015379677.1|1036232_1037411_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	41.1	1.1e-83
WP_015379676.1|1037407_1037851_+	GNAT family N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	37.1	7.6e-19
>prophage 64
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1062560	1063336	3226492	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_139588855.1|1062560_1063336_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.3	1.3e-26
>prophage 65
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1069379	1070486	3226492		Planktothrix_phage(100.0%)	1	NA	NA
WP_003641775.1|1069379_1070486_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	8.6e-27
>prophage 66
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1089716	1092351	3226492		Staphylococcus_phage(33.33%)	3	NA	NA
WP_003646339.1|1089716_1090634_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	2.6e-21
WP_003646338.1|1090896_1091691_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	2.0e-09
WP_003641754.1|1091859_1092351_-	hypothetical protein	NA	A8ATW6	Listeria_phage	36.1	1.9e-18
>prophage 67
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1096695	1098396	3226492		Planktothrix_phage(100.0%)	1	NA	NA
WP_003646334.1|1096695_1098396_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.4	1.7e-18
>prophage 68
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1106872	1107721	3226492		Klosneuvirus(100.0%)	1	NA	NA
WP_003646328.1|1106872_1107721_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	30.1	1.3e-27
>prophage 69
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1113457	1119299	3226492		Wolbachia_phage(33.33%)	6	NA	NA
WP_003641733.1|1113457_1113880_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	33.3	2.4e-06
WP_003646321.1|1114025_1114499_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003646320.1|1114612_1115215_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003641730.1|1115280_1115475_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_003646319.1|1115517_1116276_-	nucleoside phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	46.8	2.0e-35
WP_015379642.1|1116560_1119299_+	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.4	3.1e-62
>prophage 70
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1129451	1129922	3226492		Paenibacillus_phage(100.0%)	1	NA	NA
WP_021357176.1|1129451_1129922_+	NUDIX hydrolase	NA	D0R7J3	Paenibacillus_phage	33.8	4.9e-16
>prophage 71
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1140057	1142811	3226492		Acanthocystis_turfacea_Chlorella_virus(50.0%)	4	NA	NA
WP_003643656.1|1140057_1140774_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	33.6	4.1e-22
WP_071540923.1|1140778_1141270_-	DUF111 family protein	NA	NA	NA	NA	NA
WP_003641713.1|1141248_1142040_-	LarC family nickel insertion protein	NA	NA	NA	NA	NA
WP_003641712.1|1142070_1142811_-	nickel pincer cofactor biosynthesis protein LarB	NA	A0A288TYA6	Enterococcus_phage	47.2	4.7e-21
>prophage 72
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1146809	1147535	3226492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_016526846.1|1146809_1147535_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	1.1e-11
>prophage 73
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1157819	1158824	3226492		Megavirus(100.0%)	1	NA	NA
WP_015379621.1|1157819_1158824_+	NADP-dependent oxidoreductase	NA	K7Z7U2	Megavirus	31.1	7.6e-06
>prophage 74
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1161829	1163848	3226492		Streptococcus_phage(100.0%)	1	NA	NA
WP_160248239.1|1161829_1163848_-	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	D0R0F5	Streptococcus_phage	30.7	7.9e-71
>prophage 75
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1171246	1172263	3226492		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_021357210.1|1171246_1172263_+	choloylglycine hydrolase family protein	NA	M1HS66	Paramecium_bursaria_Chlorella_virus	36.0	7.6e-30
>prophage 76
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1177792	1178218	3226492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003641672.1|1177792_1178218_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	51.6	2.1e-29
>prophage 77
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1191970	1200375	3226492		Bacillus_phage(40.0%)	8	NA	NA
WP_003641660.1|1191970_1193233_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.3e-15
WP_003641659.1|1193343_1194159_-	MBL fold metallo-hydrolase	NA	A0A0D3MKU5	Leuconostoc_phage	28.0	2.8e-11
WP_003646175.1|1194517_1195372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003646176.1|1195383_1196709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379607.1|1196689_1198564_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.6	4.2e-34
WP_003637294.1|1198577_1199285_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.1	2.9e-44
WP_003641655.1|1199858_1200083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643615.1|1200174_1200375_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.6	2.8e-21
>prophage 78
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1207905	1210302	3226492		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_003643612.1|1207905_1210302_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.9	1.6e-09
>prophage 79
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1218364	1235489	3226492		Streptococcus_phage(37.5%)	14	NA	NA
WP_015379599.1|1218364_1219603_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	52.6	3.1e-110
WP_003643611.1|1219621_1220419_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.2	1.0e-45
WP_003641639.1|1220440_1221664_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	33.6	2.4e-54
WP_003641638.1|1221885_1223310_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	53.1	9.7e-124
WP_003641637.1|1223325_1223778_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_003643610.1|1223790_1225803_-	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_003641635.1|1225983_1226220_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003646183.1|1226258_1226840_-	single-stranded DNA-binding protein	NA	A0A218MNB4	uncultured_virus	72.1	2.7e-40
WP_003637271.1|1226876_1227176_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_015379597.1|1227797_1230359_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	37.4	2.1e-113
WP_003641632.1|1230523_1232470_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.7	5.5e-146
WP_003641631.1|1232466_1233591_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003641630.1|1233591_1233825_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_160248246.1|1234349_1235489_-	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	29.9	4.3e-13
>prophage 80
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1254190	1254613	3226492		Staphylococcus_virus(100.0%)	1	NA	NA
WP_003641613.1|1254190_1254613_+	helix-turn-helix domain-containing protein	NA	Q9G039	Staphylococcus_virus	53.1	1.2e-10
>prophage 81
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1266615	1267419	3226492		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003646226.1|1266615_1267419_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.1	1.0e-08
>prophage 82
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1278823	1280938	3226492	protease	Cronobacter_phage(100.0%)	1	NA	NA
WP_003642931.1|1278823_1280938_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	38.7	3.1e-118
>prophage 83
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1295163	1296846	3226492		Aeromonas_phage(100.0%)	1	NA	NA
WP_160248257.1|1295163_1296846_+	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	25.7	3.2e-17
>prophage 84
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1312368	1313022	3226492		Synechococcus_phage(100.0%)	1	NA	NA
WP_016511066.1|1312368_1313022_+	fructose-6-phosphate aldolase	NA	R9TM64	Synechococcus_phage	49.8	8.6e-51
>prophage 85
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1316144	1317119	3226492		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_015379561.1|1316144_1317119_+	choloylglycine hydrolase family protein	NA	M1HS66	Paramecium_bursaria_Chlorella_virus	33.5	5.8e-27
>prophage 86
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1329707	1331156	3226492		Pandoravirus(100.0%)	1	NA	NA
WP_013356042.1|1329707_1331156_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	26.5	4.5e-36
>prophage 87
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1352094	1356127	3226492		Streptococcus_phage(50.0%)	3	NA	NA
WP_003643072.1|1352094_1352853_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	31.4	2.6e-22
WP_003643071.1|1352886_1353843_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003643070.1|1353835_1356127_+	FAD-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	51.7	6.7e-42
>prophage 88
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1365886	1370282	3226492		Herpes_simplex_virus(50.0%)	3	NA	NA
WP_015379541.1|1365886_1367767_-	beta-galactosidase large subunit	NA	L0N6M2	Herpes_simplex_virus	35.4	6.4e-99
WP_003643061.1|1368049_1369213_+	galactokinase	NA	NA	NA	NA	NA
WP_015379540.1|1369277_1370282_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.3	9.1e-52
>prophage 89
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1381824	1382859	3226492		Enterobacteria_phage(100.0%)	1	NA	NA
WP_027822204.1|1381824_1382859_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	24.2	4.3e-12
>prophage 90
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1393262	1393913	3226492		Indivirus(100.0%)	1	NA	NA
WP_003643044.1|1393262_1393913_-	aquaporin	NA	A0A1V0SCL5	Indivirus	41.6	1.9e-05
>prophage 91
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1406740	1419496	3226492		Cafeteria_roenbergensis_virus(16.67%)	13	NA	NA
WP_160248274.1|1406740_1408657_-	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.6	4.7e-73
WP_003643545.1|1408965_1409631_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003643544.1|1409828_1410053_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_015379519.1|1410065_1410620_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_003643025.1|1410747_1410951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643024.1|1411050_1411320_-	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_015379518.1|1411343_1411664_-	thioredoxin family protein	NA	A0A2K9L3H4	Tupanvirus	39.1	5.2e-09
WP_015379517.1|1412048_1412789_+	aquaporin family protein	NA	M1HQW3	Paramecium_bursaria_Chlorella_virus	31.7	2.2e-26
WP_003645579.1|1412942_1414847_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.2	1.3e-94
WP_015379515.1|1415796_1416768_+	SGNH/GDSL hydrolase family protein	NA	A0A2H4PRU1	Lactococcus_phage	31.4	1.7e-34
WP_015379514.1|1416865_1417561_-	YdcF family protein	NA	NA	NA	NA	NA
WP_015379513.1|1417561_1418275_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_015379512.1|1418542_1419496_-	Dyp-type peroxidase	NA	S4VXK8	Pandoravirus	29.1	1.9e-19
>prophage 92
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1438127	1438646	3226492		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_003645538.1|1438127_1438646_+	RNase III inhibitor	NA	A0A0K1L687	Scale_drop_disease_virus	58.0	5.4e-32
>prophage 93
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1441954	1442815	3226492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003643521.1|1441954_1442815_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	1.9e-58
>prophage 94
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1446003	1448616	3226492		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_003645544.1|1446003_1448616_+	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	30.0	2.2e-73
>prophage 95
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1459512	1462635	3226492		Streptococcus_phage(50.0%)	2	NA	NA
WP_003645551.1|1459512_1461552_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	27.1	3.3e-56
WP_003643511.1|1461648_1462635_+	choloylglycine hydrolase family protein	NA	M1HS66	Paramecium_bursaria_Chlorella_virus	33.2	2.8e-29
>prophage 96
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1474269	1474770	3226492		Lactobacillus_phage(100.0%)	1	NA	NA
WP_003645558.1|1474269_1474770_-	hypothetical protein	NA	A0A291I9Q0	Lactobacillus_phage	58.0	1.3e-43
>prophage 97
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1486055	1490337	3226492		Streptococcus_phage(50.0%)	2	NA	NA
WP_015381041.1|1486055_1487900_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.8	1.7e-64
WP_160248281.1|1488669_1490337_+	glycine/betaine ABC transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	1.5e-06
>prophage 98
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1493731	1499365	3226492		Staphylococcus_phage(50.0%)	4	NA	NA
WP_015381038.1|1493731_1494652_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	28.4	1.6e-10
WP_003643490.1|1495712_1496024_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_003642837.1|1496248_1497070_-	pyruvate formate lyase-activating protein	NA	NA	NA	NA	NA
WP_160248283.1|1497106_1499365_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.3	4.0e-164
>prophage 99
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1512352	1512922	3226492		Vibrio_phage(100.0%)	1	NA	NA
WP_015381032.1|1512352_1512922_+	GTP cyclohydrolase I FolE	NA	A0A088F7Y4	Vibrio_phage	43.5	8.3e-34
>prophage 100
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1517893	1518532	3226492		Bacillus_phage(100.0%)	1	NA	NA
WP_021357430.1|1517893_1518532_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	50.8	5.7e-07
>prophage 101
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1522147	1530110	3226492	transposase	Paenibacillus_phage(50.0%)	6	NA	NA
WP_015381025.1|1522147_1523266_-	vitamin B12 independent methionine synthase	NA	A0A218MNE0	uncultured_virus	43.5	2.4e-69
WP_003643477.1|1523727_1524774_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003642499.1|1525102_1526047_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_086989537.1|1526098_1526874_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_003643475.1|1526974_1529017_-	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.7	8.0e-63
WP_086989537.1|1529335_1530110_+|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
>prophage 102
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1542868	1550122	3226492	bacteriocin	Staphylococcus_virus(20.0%)	6	NA	NA
WP_015381013.1|1542868_1543846_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	71.2	1.4e-137
WP_015381012.1|1543888_1545178_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	37.0	3.5e-72
WP_003645480.1|1545494_1546793_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.6	3.8e-18
WP_015381011.1|1547015_1547345_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_015381010.1|1547539_1548874_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	7.9e-27
WP_015381009.1|1549009_1550122_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.3	1.3e-35
>prophage 103
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1580588	1582833	3226492		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_015380988.1|1580588_1582034_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	37.7	4.9e-83
WP_015380987.1|1582182_1582833_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.5	1.7e-22
>prophage 104
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1591961	1597928	3226492		Lactobacillus_phage(33.33%)	6	NA	NA
WP_003645325.1|1591961_1592537_+	zinc ribbon domain-containing protein	NA	D6PSS6	Lactobacillus_phage	31.1	2.1e-21
WP_015380981.1|1592705_1593521_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003642441.1|1593992_1594754_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.0	3.5e-27
WP_003642440.1|1594765_1595473_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003642439.1|1595541_1596345_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003642438.1|1596701_1597928_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	28.6	2.0e-21
>prophage 105
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1606853	1624882	3226492	transposase	Bacillus_phage(20.0%)	19	NA	NA
WP_003645330.1|1606853_1607705_+	nucleoid occlusion protein	NA	A0A1C9EHY8	Gordonia_phage	30.1	1.0e-11
WP_003642431.1|1607707_1608475_+	ParA family protein	NA	Q8JL10	Natrialba_phage	32.3	3.7e-29
WP_003645331.1|1608464_1609355_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	32.2	2.5e-16
WP_003639829.1|1609379_1609571_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_003642429.1|1609601_1610702_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_003642428.1|1610723_1611449_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_003642427.1|1611734_1612886_+	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	39.6	8.0e-52
WP_003645333.1|1613154_1614084_+	foldase	NA	NA	NA	NA	NA
WP_015380977.1|1614259_1614949_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_003642424.1|1615039_1615729_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.8	4.8e-36
WP_003642423.1|1615745_1616906_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	6.2e-28
WP_003645334.1|1616975_1618310_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	25.9	4.4e-09
WP_015380976.1|1618883_1619381_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003642420.1|1619517_1620303_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_003642419.1|1620323_1620674_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_160248290.1|1620745_1621669_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	6.7e-33
WP_003642418.1|1621791_1622514_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003642413.1|1623956_1624511_-	DUF4352 domain-containing protein	NA	D7RWL3	Brochothrix_phage	26.8	1.5e-11
WP_003642412.1|1624519_1624882_-	DUF4064 domain-containing protein	NA	D7RWL4	Brochothrix_phage	45.1	4.5e-09
>prophage 106
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1634964	1641486	3226492		Staphylococcus_phage(33.33%)	6	NA	NA
WP_015380966.1|1634964_1635855_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.3	1.6e-31
WP_015380964.1|1636617_1637382_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_015380963.1|1637409_1637775_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	51.7	1.5e-07
WP_015380962.1|1638250_1639339_-	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_003643427.1|1640222_1640789_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015380960.1|1640772_1641486_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.4	9.8e-16
>prophage 107
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1645111	1646383	3226492		Lactococcus_phage(100.0%)	1	NA	NA
WP_003645352.1|1645111_1646383_-	DUF805 domain-containing protein	NA	Q9AZW5	Lactococcus_phage	41.7	4.7e-21
>prophage 108
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1654493	1654961	3226492		Streptomyces_phage(100.0%)	1	NA	NA
WP_003587210.1|1654493_1654961_-	DNA starvation/stationary phase protection protein	NA	A0A222Z0F3	Streptomyces_phage	29.2	1.6e-06
>prophage 109
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1659254	1660715	3226492		Lactobacillus_phage(100.0%)	1	NA	NA
WP_015380955.1|1659254_1660715_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	27.7	1.1e-29
>prophage 110
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1665209	1670702	3226492	transposase	Tupanvirus(50.0%)	4	NA	NA
WP_015380952.1|1665209_1666997_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	30.5	1.6e-19
WP_015380951.1|1666993_1667656_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015380949.1|1668599_1669934_+	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_086989537.1|1669926_1670702_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
>prophage 111
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1682114	1687567	3226492		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
WP_003642355.1|1682114_1682861_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	27.2	8.1e-05
WP_015380942.1|1683154_1684048_+	SDR family oxidoreductase	NA	M1HZA6	Acanthocystis_turfacea_Chlorella_virus	25.0	7.9e-07
WP_003643401.1|1684028_1684541_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160248295.1|1684785_1685781_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003643400.1|1685777_1686776_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.8	1.0e-18
WP_003642350.1|1686772_1687567_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	9.8e-17
>prophage 112
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1706284	1707208	3226492	transposase	unidentified_phage(100.0%)	1	NA	NA
WP_160248290.1|1706284_1707208_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	6.7e-33
>prophage 113
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1712060	1712714	3226492		Synechococcus_phage(100.0%)	1	NA	NA
WP_003643386.1|1712060_1712714_+	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	29.0	2.9e-14
>prophage 114
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1735612	1741958	3226492		uncultured_virus(33.33%)	4	NA	NA
WP_015380915.1|1735612_1737538_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.7	5.0e-83
WP_003642307.1|1737903_1739025_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	27.8	3.2e-13
WP_003644879.1|1740094_1741267_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_003642303.1|1741562_1741958_-	transglycosylase	NA	A0A249XZV3	Enterococcus_phage	60.0	2.1e-15
>prophage 115
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1745522	1751569	3226492		Bacillus_phage(66.67%)	4	NA	NA
WP_003644885.1|1745522_1746413_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.4	1.6e-55
WP_015380911.1|1746504_1747704_-	amidohydrolase	NA	NA	NA	NA	NA
WP_160248304.1|1748070_1749795_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.8	1.4e-31
WP_064523657.1|1749787_1751569_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.8	6.2e-43
>prophage 116
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1757543	1758318	3226492	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_086989537.1|1757543_1758318_+|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
>prophage 117
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1764217	1765774	3226492	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_160248308.1|1764217_1765774_+|transposase	transposase	transposase	A0A146ICT8	Staphylococcus_phage	39.9	1.6e-79
>prophage 118
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1772744	1774265	3226492		Streptococcus_phage(100.0%)	1	NA	NA
WP_015380885.1|1772744_1774265_+	Y-family DNA polymerase	NA	D0R0A3	Streptococcus_phage	28.2	7.6e-26
>prophage 119
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1781133	1782850	3226492		Lactobacillus_phage(100.0%)	2	NA	NA
WP_021356995.1|1781133_1781796_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2K9V574	Lactobacillus_phage	48.4	8.5e-14
WP_160248311.1|1782235_1782850_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2K9V574	Lactobacillus_phage	61.5	3.3e-12
>prophage 120
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1792173	1792949	3226492	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_086989537.1|1792173_1792949_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
>prophage 121
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1796829	1798830	3226492		Planktothrix_phage(100.0%)	1	NA	NA
WP_015380873.1|1796829_1798830_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.2	1.7e-33
>prophage 122
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1810689	1812174	3226492		Brazilian_cedratvirus(50.0%)	2	NA	NA
WP_003646065.1|1810689_1811469_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	24.0	3.2e-12
WP_003646064.1|1811469_1812174_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	9.0e-14
>prophage 123
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1819657	1820431	3226492		Pithovirus(100.0%)	1	NA	NA
WP_033617702.1|1819657_1820431_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	25.8	1.6e-08
>prophage 124
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1826652	1828410	3226492		Bacillus_phage(100.0%)	1	NA	NA
WP_160248316.1|1826652_1828410_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	41.6	2.7e-107
>prophage 125
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1856446	1862695	3226492		Enterococcus_phage(50.0%)	6	NA	NA
WP_021357074.1|1856446_1856857_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	42.9	1.3e-12
WP_003644789.1|1856999_1857473_-	lipoprotein	NA	NA	NA	NA	NA
WP_003644788.1|1857921_1860144_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	59.0	3.6e-250
WP_043992898.1|1860076_1860658_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	60.2	2.3e-55
WP_160248318.1|1860868_1861549_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003642201.1|1861564_1862695_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.0	5.7e-18
>prophage 126
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1869554	1870850	3226492		Shearwaterpox_virus(100.0%)	1	NA	NA
WP_027821778.1|1869554_1870850_+	alkaline phosphatase family protein	NA	A0A1V0QG10	Shearwaterpox_virus	21.3	1.4e-07
>prophage 127
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1875023	1877531	3226492		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_015380833.1|1875023_1877531_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.3	3.3e-135
>prophage 128
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1880708	1882331	3226492		Klosneuvirus(100.0%)	1	NA	NA
WP_015380830.1|1880708_1882331_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	26.9	8.4e-47
>prophage 129
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1898460	1900248	3226492		Bacillus_phage(100.0%)	1	NA	NA
WP_003644847.1|1898460_1900248_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.0	2.5e-44
>prophage 130
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1919253	1919955	3226492		Planktothrix_phage(100.0%)	1	NA	NA
WP_003644830.1|1919253_1919955_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	2.5e-32
>prophage 131
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1927538	1931309	3226492		Staphylococcus_phage(33.33%)	3	NA	NA
WP_015380802.1|1927538_1928438_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	3.5e-18
WP_016511814.1|1928793_1929858_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A288TY55	Enterococcus_phage	70.8	1.8e-18
WP_015380800.1|1930325_1931309_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1S5RCR7	Lactobacillus_phage	56.4	2.9e-10
>prophage 132
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1950411	1951092	3226492		Planktothrix_phage(100.0%)	1	NA	NA
WP_003642105.1|1950411_1951092_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	3.5e-31
>prophage 133
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1959607	1963301	3226492	tRNA	Lactobacillus_virus(50.0%)	3	NA	NA
WP_080125268.1|1959607_1960855_+	glycosyl hydrolase	NA	Q5ULM6	Lactobacillus_virus	43.8	2.4e-33
WP_015380778.1|1960954_1961620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380777.1|1962044_1963301_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	43.1	2.7e-85
>prophage 134
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1970894	1972646	3226492		Staphylococcus_phage(100.0%)	2	NA	NA
WP_024521812.1|1970894_1971761_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	6.7e-51
WP_015380773.1|1971779_1972646_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.6	7.4e-50
>prophage 135
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	1992369	1993044	3226492		Lactococcus_phage(100.0%)	1	NA	NA
WP_003645837.1|1992369_1993044_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	27.0	4.2e-08
>prophage 136
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2000991	2005171	3226492		Staphylococcus_phage(50.0%)	4	NA	NA
WP_003581836.1|2000991_2001735_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	1.5e-27
WP_015474704.1|2001712_2002960_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015380759.1|2002964_2003636_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015380758.1|2003737_2005171_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.0	2.5e-95
>prophage 137
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2010787	2012139	3226492		Listeria_phage(50.0%)	3	NA	NA
WP_003642553.1|2010787_2011009_+	DUF2829 domain-containing protein	NA	A8AT88	Listeria_phage	35.2	6.7e-08
WP_003642554.1|2011008_2011755_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_003642555.1|2011770_2012139_+	HIT family protein	NA	D7NW73	Streptomyces_phage	40.6	6.8e-13
>prophage 138
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2027344	2031487	3226492		Staphylococcus_phage(50.0%)	5	NA	NA
WP_015380745.1|2027344_2028223_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.7	4.6e-15
WP_003642574.1|2028219_2028591_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015380744.1|2028618_2028894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015380743.1|2028916_2030698_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003642577.1|2030728_2031487_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	4.6e-32
>prophage 139
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2036937	2049470	3226492		Lactobacillus_phage(22.22%)	12	NA	NA
WP_003642583.1|2036937_2037546_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	54.5	7.9e-59
WP_003644728.1|2037560_2038856_+	NADPH-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	59.8	3.5e-56
WP_003642585.1|2039422_2039908_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
WP_015380738.1|2039891_2041022_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_015380737.1|2041024_2041756_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	38.6	1.2e-37
WP_003642588.1|2041757_2042012_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_015380736.1|2042011_2042692_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_064522672.1|2042684_2044904_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	38.9	1.0e-143
WP_027822324.1|2044888_2046343_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.8	7.3e-50
WP_015380733.1|2046339_2047365_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	1.2e-59
WP_003645867.1|2047357_2047936_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
WP_011101892.1|2047937_2049470_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.9	6.7e-46
>prophage 140
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2055755	2058748	3226492		Moraxella_phage(50.0%)	2	NA	NA
WP_003645873.1|2055755_2057039_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.7	8.1e-45
WP_003645874.1|2057407_2058748_-	purine permease	NA	Q9KX94	Enterobacteria_phage	28.6	1.4e-34
>prophage 141
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2062236	2065547	3226492		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_011101888.1|2062236_2063172_+	aspartate carbamoyltransferase	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	32.7	6.5e-28
WP_160248336.1|2063175_2064468_+	dihydroorotase	NA	NA	NA	NA	NA
WP_160248338.1|2064464_2065547_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	8.0e-54
>prophage 142
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2076149	2079899	3226492		Bacillus_phage(100.0%)	1	NA	NA
WP_015825811.1|2076149_2079899_+	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	22.6	1.3e-13
>prophage 143
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2087407	2092667	3226492		Cyanophage(50.0%)	5	NA	NA
WP_015380714.1|2087407_2088892_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.5	1.4e-77
WP_003642623.1|2089009_2089357_-	SdpI family protein	NA	NA	NA	NA	NA
WP_015380713.1|2089764_2090709_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013355818.1|2090794_2091172_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003645896.1|2091503_2092667_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	33.7	1.1e-56
>prophage 144
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2099956	2100613	3226492		Pandoravirus(100.0%)	1	NA	NA
WP_015380711.1|2099956_2100613_+	HD domain-containing protein	NA	S4W232	Pandoravirus	31.2	4.6e-12
>prophage 145
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2118573	2120931	3226492		Enterococcus_phage(100.0%)	1	NA	NA
WP_064522690.1|2118573_2120931_+	cell wall hydrolase	NA	A0A249Y0X5	Enterococcus_phage	51.9	2.2e-40
>prophage 146
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2138414	2140503	3226492		Staphylococcus_phage(50.0%)	3	NA	NA
WP_003642672.1|2138414_2139125_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	2.7e-10
WP_003642673.1|2139114_2139888_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003642674.1|2139948_2140503_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	40.5	4.1e-30
>prophage 147
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2151855	2152752	3226492		Lactobacillus_virus(100.0%)	1	NA	NA
WP_003642684.1|2151855_2152752_-	ribonuclease	NA	C1KFJ1	Lactobacillus_virus	36.3	5.5e-32
>prophage 148
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2160527	2164857	3226492		Staphylococcus_phage(50.0%)	2	NA	NA
WP_003642695.1|2160527_2162321_-	glycerophosphoryl diester phosphodiesterase	NA	A0A173GBD0	Staphylococcus_phage	26.4	4.2e-07
WP_003646579.1|2162703_2164857_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	49.1	2.7e-170
>prophage 149
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2174444	2175269	3226492		Tetraselmis_virus(100.0%)	1	NA	NA
WP_060417561.1|2174444_2175269_+	SDR family oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	25.7	3.6e-06
>prophage 150
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2184368	2185088	3226492		Klosneuvirus(100.0%)	1	NA	NA
WP_003642716.1|2184368_2185088_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	A0A1V0SIZ6	Klosneuvirus	25.1	3.5e-05
>prophage 151
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2188126	2190887	3226492		Pacmanvirus(50.0%)	3	NA	NA
WP_015380674.1|2188126_2189197_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	23.7	4.1e-18
WP_015380673.1|2189383_2189938_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_015380672.1|2190113_2190887_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	43.1	1.0e-42
>prophage 152
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2194561	2195344	3226492		Indivirus(100.0%)	1	NA	NA
WP_003642726.1|2194561_2195344_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	27.2	4.1e-07
>prophage 153
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2199535	2200822	3226492		Pandoravirus(100.0%)	1	NA	NA
WP_160248353.1|2199535_2200822_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	24.0	2.7e-08
>prophage 154
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2209764	2212220	3226492	transposase	Streptococcus_phage(50.0%)	2	NA	NA
WP_015380661.1|2209764_2211318_+	ABC-F family ATP-binding cassette domain-containing protein	NA	Q6DMX7	Streptococcus_phage	27.0	9.5e-40
WP_086989537.1|2211444_2212220_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
>prophage 155
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2224802	2228528	3226492		Bacillus_phage(50.0%)	3	NA	NA
WP_003646617.1|2224802_2225531_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.1	2.1e-34
WP_015380651.1|2225527_2227051_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011101808.1|2227346_2228528_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	29.9	3.9e-46
>prophage 156
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2235775	2237539	3226492		Bacillus_phage(100.0%)	1	NA	NA
WP_015380648.1|2235775_2237539_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	40.9	4.8e-96
>prophage 157
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2246741	2281851	3226492	integrase,portal,tail,capsid,terminase	Lactobacillus_phage(47.37%)	40	2239446:2239460	2263149:2263163
2239446:2239460	attL	TTACACAGTTTTATC	NA	NA	NA	NA
WP_064522727.1|2246741_2247863_-|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	32.4	9.9e-47
WP_015380643.1|2249530_2250196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015380642.1|2250192_2250555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015380641.1|2250558_2251422_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	34.8	3.2e-29
WP_043992873.1|2252057_2252777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043992872.1|2252880_2253729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043992871.1|2253752_2254166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015380637.1|2254231_2254654_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	35.1	1.0e-12
WP_015380636.1|2254668_2255172_-	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	43.2	2.2e-22
WP_043992870.1|2255317_2255572_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015380634.1|2255750_2256056_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_015380633.1|2256122_2256635_+	transcriptional regulator	NA	D6PST4	Lactobacillus_phage	44.7	2.5e-29
WP_024272298.1|2256702_2256873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080125261.1|2257023_2257410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380630.1|2257406_2258306_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	47.7	7.9e-63
WP_080125258.1|2258217_2259090_+	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	49.2	1.8e-72
WP_015380628.1|2259170_2260079_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_003642800.1|2260075_2260363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380627.1|2260359_2260878_+	hypothetical protein	NA	O03915	Lactobacillus_phage	68.4	3.5e-55
WP_013355743.1|2260874_2261255_+	endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_003642805.1|2261465_2261927_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	1.1e-39
WP_015380625.1|2262191_2262809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015380624.1|2263705_2263903_+	hypothetical protein	NA	NA	NA	NA	NA
2263149:2263163	attR	GATAAAACTGTGTAA	NA	NA	NA	NA
WP_080125256.1|2263880_2264057_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	57.1	1.4e-08
WP_160248359.1|2264214_2264724_+	helix-turn-helix domain-containing protein	NA	A0A2H4IYT3	uncultured_Caudovirales_phage	36.8	4.5e-07
WP_015380621.1|2264704_2266030_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1S5SA45	Streptococcus_phage	55.9	1.7e-138
WP_144063632.1|2266032_2267628_+|portal	phage portal protein	portal	B5LPR1	Bacillus_virus	37.8	3.8e-84
WP_015380619.1|2267620_2268706_+|capsid	Putative minor capsid protein	capsid	A0A059T7W2	Listeria_phage	30.5	6.2e-38
WP_015380618.1|2268769_2269381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380617.1|2269394_2270342_+|capsid	N4-gp56 family major capsid protein	capsid	A8ASJ6	Listeria_phage	59.5	3.0e-89
WP_015380615.1|2270701_2271106_+	hypothetical protein	NA	A5GYM1	Lactococcus_phage	27.5	2.6e-05
WP_015380614.1|2271106_2271496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380613.1|2271492_2271894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380612.1|2271893_2272319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380611.1|2272336_2272954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380610.1|2273072_2273591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043992865.1|2273587_2274229_+	hypothetical protein	NA	O03936	Lactobacillus_phage	26.7	9.7e-07
WP_160248361.1|2274244_2279893_+|tail	phage tail tape measure protein	tail	A0A1S5SFC1	Streptococcus_phage	25.8	2.2e-22
WP_015380607.1|2279893_2280712_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_015380606.1|2280723_2281851_+	hypothetical protein	NA	O03938	Lactobacillus_phage	42.0	6.8e-72
>prophage 158
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2285001	2294690	3226492	holin	Lactobacillus_phage(71.43%)	9	NA	NA
WP_015380600.1|2285001_2286369_+	hypothetical protein	NA	A0A2K9VCK7	Lactobacillus_phage	47.1	2.6e-33
WP_015380599.1|2286365_2286611_+	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	84.2	1.4e-17
WP_015380598.1|2286622_2287795_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	89.0	2.0e-199
WP_015380597.1|2287795_2288092_+	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	77.6	1.2e-39
WP_015380596.1|2288078_2288456_+|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	71.2	3.2e-18
WP_043992864.1|2289376_2290228_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011101730.1|2290450_2290843_+	YxeA family protein	NA	NA	NA	NA	NA
WP_003644665.1|2291070_2292801_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	2.6e-46
WP_003641422.1|2292800_2294690_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	9.4e-58
>prophage 159
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2298021	2299041	3226492		Mycobacterium_phage(100.0%)	1	NA	NA
WP_021356211.1|2298021_2299041_+	serine hydrolase	NA	A0A249XPW4	Mycobacterium_phage	24.2	4.1e-07
>prophage 160
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2302677	2310960	3226492		Enterococcus_phage(25.0%)	8	NA	NA
WP_003644660.1|2302677_2303256_+	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	49.7	7.3e-46
WP_003641433.1|2303269_2304352_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_160248365.1|2304344_2305211_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_015380590.1|2305501_2306521_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	41.5	7.1e-52
WP_003641436.1|2306579_2307818_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	50.6	1.4e-94
WP_003639227.1|2307897_2308527_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003645418.1|2308844_2309018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015825748.1|2309679_2310960_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	37.1	9.2e-65
>prophage 161
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2321772	2325335	3226492		Staphylococcus_phage(50.0%)	5	NA	NA
WP_003644657.1|2321772_2322045_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	47.7	9.8e-17
WP_003641449.1|2322028_2322256_+	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_003644656.1|2322403_2323609_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_043992860.1|2323639_2323936_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
WP_003641452.1|2324303_2325335_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	1.5e-28
>prophage 162
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2337248	2338529	3226492		Bacillus_phage(100.0%)	1	NA	NA
WP_003641463.1|2337248_2338529_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	47.8	9.7e-99
>prophage 163
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2351669	2354339	3226492	tRNA	Catovirus(100.0%)	1	NA	NA
WP_015380573.1|2351669_2354339_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	43.2	3.1e-163
>prophage 164
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2361961	2362603	3226492		Bacillus_virus(100.0%)	1	NA	NA
WP_003641493.1|2361961_2362603_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.6	8.2e-30
>prophage 165
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2366050	2367316	3226492		Streptococcus_phage(100.0%)	1	NA	NA
WP_015380569.1|2366050_2367316_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	32.5	5.5e-54
>prophage 166
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2371822	2383267	3226492	transposase	Bacillus_phage(25.0%)	8	NA	NA
WP_160248376.1|2371822_2372965_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	65.6	8.6e-123
WP_003644638.1|2373195_2374755_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_003641506.1|2374879_2375686_+	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_003641507.1|2375713_2378404_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	23.1	6.9e-38
WP_043992855.1|2378571_2380608_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.4	1.1e-56
WP_071542669.1|2381091_2381271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542858.1|2381261_2381477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160248378.1|2381581_2383267_-|transposase	IS1182 family transposase	transposase	A0A146ICT8	Staphylococcus_phage	40.6	1.1e-89
>prophage 167
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2388648	2406232	3226492	tRNA	Bacillus_phage(14.29%)	17	NA	NA
WP_003641514.1|2388648_2389659_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	29.6	9.6e-09
WP_003641515.1|2389676_2390711_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003641516.1|2391020_2392163_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.9	3.0e-83
WP_003645451.1|2392240_2392624_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_003641518.1|2392753_2393887_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_160248382.1|2393979_2394936_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_003645450.1|2394938_2396282_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.6	1.5e-46
WP_003645449.1|2396609_2399252_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	32.0	1.5e-61
WP_003641523.1|2399638_2399908_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_003641524.1|2399904_2400339_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003641525.1|2400351_2400648_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_003645448.1|2400779_2401031_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_016511478.1|2401090_2403454_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	53.1	8.5e-24
WP_003641528.1|2403609_2403921_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	45.8	4.2e-16
WP_003641529.1|2404088_2404772_-	YslB family protein	NA	NA	NA	NA	NA
WP_003645446.1|2404809_2405631_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003641531.1|2405623_2406232_+	XTP/dITP diphosphatase	NA	X5LRP0	Ugandan_cassava_brown_streak_virus	28.6	6.8e-10
>prophage 168
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2426043	2426652	3226492		Escherichia_phage(100.0%)	1	NA	NA
WP_027822798.1|2426043_2426652_+	metallophosphatase	NA	H6W7Z4	Escherichia_phage	37.5	4.4e-09
>prophage 169
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2431103	2431688	3226492		Indivirus(100.0%)	1	NA	NA
WP_003641564.1|2431103_2431688_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	44.2	8.5e-26
>prophage 170
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2458755	2461143	3226492		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003645941.1|2458755_2461143_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.9	2.4e-82
>prophage 171
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2477228	2480027	3226492	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_015380541.1|2477228_2480027_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	27.8	6.2e-90
>prophage 172
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2493556	2503966	3226492		Virus_Rctr197k(20.0%)	9	NA	NA
WP_120787341.1|2493556_2496106_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.1	2.8e-49
WP_003645927.1|2496260_2497226_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	33.0	2.5e-38
WP_003645926.1|2497585_2499076_+	peptidoglycan endopeptidase	NA	D2KRB9	Lactobacillus_phage	42.6	2.5e-13
WP_003645925.1|2499249_2499453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003645924.1|2499674_2500634_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	29.7	3.8e-15
WP_003640828.1|2500696_2502373_-	ribonuclease J	NA	NA	NA	NA	NA
WP_003640827.1|2502369_2502588_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_003640826.1|2502869_2503376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003645922.1|2503405_2503966_-	peptide deformylase	NA	A0A2I7S809	Vibrio_phage	36.5	1.0e-12
>prophage 173
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2507723	2509136	3226492		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003640822.1|2507723_2509136_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	2.8e-46
>prophage 174
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2525839	2528738	3226492		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_003640809.1|2525839_2526331_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	37.6	3.3e-23
WP_015380528.1|2526323_2527370_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_015380527.1|2527472_2528198_+	ComE operon protein 1, DNA receptor	NA	NA	NA	NA	NA
WP_003645663.1|2528252_2528738_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	55.3	1.2e-33
>prophage 175
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2538234	2546852	3226492	protease	Hokovirus(25.0%)	9	NA	NA
WP_003640798.1|2538234_2539422_+	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	29.7	2.5e-32
WP_003645655.1|2539625_2540948_+	trigger factor	NA	NA	NA	NA	NA
WP_003640796.1|2541242_2542508_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.9	1.6e-141
WP_003640795.1|2542666_2543260_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003640794.1|2543261_2543558_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	51.6	2.9e-22
WP_003644577.1|2543804_2544212_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_003640792.1|2544267_2544438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640791.1|2544643_2546119_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_003640790.1|2546111_2546852_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	2.2e-31
>prophage 176
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2551530	2552472	3226492		Catovirus(100.0%)	1	NA	NA
WP_003640785.1|2551530_2552472_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI6	Catovirus	35.2	7.0e-38
>prophage 177
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2563486	2564242	3226492		Escherichia_phage(100.0%)	1	NA	NA
WP_160248397.1|2563486_2564242_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.8	7.4e-22
>prophage 178
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2568769	2571643	3226492		Bacillus_phage(50.0%)	2	NA	NA
WP_015380514.1|2568769_2571106_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.4	3.0e-74
WP_003640768.1|2571124_2571643_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.1	9.5e-29
>prophage 179
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2578280	2613269	3226492	portal,tail,protease,head,capsid,holin,terminase	Lactobacillus_phage(91.89%)	43	NA	NA
WP_043992828.1|2578280_2578481_-	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	97.0	5.5e-25
WP_015380507.1|2578662_2579361_-	hypothetical protein	NA	Q9AZW5	Lactococcus_phage	36.8	2.1e-18
WP_027822123.1|2579369_2579756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015380505.1|2579813_2580092_-	hypothetical protein	NA	D2KRD5	Lactobacillus_phage	59.3	1.3e-21
WP_043992826.1|2580101_2580440_-	helix-turn-helix transcriptional regulator	NA	Q8W5Y0	Listeria_phage	42.2	1.0e-15
WP_015380504.1|2580687_2580909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120787352.1|2580914_2581622_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	62.2	6.8e-70
WP_003641364.1|2581633_2581843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380501.1|2581958_2582285_-	hypothetical protein	NA	E9LUT2	Lactobacillus_phage	98.1	2.7e-53
WP_015380500.1|2582342_2582603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380499.1|2582745_2582994_+	hypothetical protein	NA	E9LUT6	Lactobacillus_phage	84.1	1.9e-35
WP_015380498.1|2582996_2583197_+	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	89.4	1.7e-26
WP_043992823.1|2583208_2583433_+	hypothetical protein	NA	E9LUT8	Lactobacillus_phage	86.3	1.2e-28
WP_043992822.1|2583651_2583909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380497.1|2584015_2584819_+	hypothetical protein	NA	E9LUM6	Lactobacillus_phage	56.9	6.4e-40
WP_043992819.1|2584812_2585688_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	41.6	2.2e-49
WP_015380494.1|2586150_2586462_+	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	88.3	6.1e-47
WP_015380493.1|2586572_2587178_+	hypothetical protein	NA	E9LUN9	Lactobacillus_phage	95.0	3.1e-111
WP_160248399.1|2587251_2587401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043992815.1|2587424_2587826_+	hypothetical protein	NA	K4I239	Lactobacillus_phage	54.5	5.5e-32
WP_160248401.1|2587898_2588324_+	DUF1642 domain-containing protein	NA	E9LUP3	Lactobacillus_phage	61.7	2.2e-39
WP_015380489.1|2588826_2589255_+	phage transcriptional activator RinA	NA	E9LUP5	Lactobacillus_phage	86.5	1.1e-65
WP_015380487.1|2589588_2589768_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	86.4	3.1e-19
WP_043992814.1|2589736_2590246_+	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	91.5	2.2e-78
WP_064522844.1|2590443_2590899_+|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	97.4	9.4e-81
WP_160248403.1|2590908_2592807_+|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	93.8	0.0e+00
WP_015380483.1|2592796_2592991_+	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	93.8	3.7e-26
WP_015380482.1|2592993_2594187_+|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	98.7	3.1e-224
WP_015380481.1|2594164_2594920_+|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	93.2	3.9e-124
WP_015380480.1|2594919_2596152_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	94.1	4.3e-213
WP_015380479.1|2596224_2596563_+|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	91.1	5.8e-51
WP_015380478.1|2596546_2596909_+|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	97.5	6.4e-64
WP_015380473.1|2597220_2597412_+	hypothetical protein	NA	E9LUR0	Lactobacillus_phage	98.4	1.5e-27
WP_160248405.1|2597424_2602647_+|tail	phage tail protein	tail	E9LUR1	Lactobacillus_phage	71.5	0.0e+00
WP_015380471.1|2602718_2604491_+	hypothetical protein	NA	E9LUR2	Lactobacillus_phage	96.6	0.0e+00
WP_064522848.1|2604557_2606927_+	hypothetical protein	NA	E9LUR3	Lactobacillus_phage	92.9	0.0e+00
WP_015380469.1|2606943_2609742_+	hypothetical protein	NA	E9LUR4	Lactobacillus_phage	73.3	2.1e-223
WP_015380468.1|2609734_2609977_+	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	92.5	6.2e-31
WP_015380466.1|2610125_2611223_+	collagen-like protein	NA	A0A2P0ZLF6	Lactobacillus_phage	87.1	8.1e-62
WP_015380465.1|2611219_2611432_+	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	80.3	2.0e-17
WP_015380464.1|2611443_2612622_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	89.0	6.9e-200
WP_003644510.1|2612621_2612885_+|holin	holin	holin	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
WP_015380463.1|2612894_2613269_+	nitrate/sulfonate/bicarbonate ABC transporter permease	NA	A0A2K9VCG4	Lactobacillus_phage	76.2	2.6e-20
>prophage 180
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2617506	2621828	3226492		Bacillus_virus(50.0%)	4	NA	NA
WP_003645638.1|2617506_2618298_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	4.5e-30
WP_003644505.1|2618278_2619463_+	LCP family protein	NA	NA	NA	NA	NA
WP_003645636.1|2619614_2620187_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_160248407.1|2620886_2621828_-	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	48.7	1.8e-78
>prophage 181
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2625729	2630021	3226492	tRNA	Phage_Wrath(50.0%)	7	NA	NA
WP_003640747.1|2625729_2626362_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.2	2.3e-16
WP_003644501.1|2626513_2626753_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003640745.1|2626850_2627087_+	YneF family protein	NA	NA	NA	NA	NA
WP_003645630.1|2627143_2627779_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003645629.1|2627890_2628649_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_015380454.1|2628632_2628938_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003640741.1|2629022_2630021_+	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
>prophage 182
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2634648	2635428	3226492		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003640735.1|2634648_2635428_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	1.1e-23
>prophage 183
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2639786	2649340	3226492		Bradyrhizobium_phage(50.0%)	6	NA	NA
WP_015380449.1|2639786_2644100_+	DNA polymerase III subunit alpha	NA	A0A1X9SH08	Bradyrhizobium_phage	34.0	1.0e-14
WP_003640728.1|2644395_2644872_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003640727.1|2644892_2646110_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003640726.1|2646154_2646454_+	YlxR family protein	NA	NA	NA	NA	NA
WP_003640725.1|2646443_2646749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003645962.1|2646763_2649340_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.3	9.6e-21
>prophage 184
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2661684	2674177	3226492	integrase	Tupanvirus(33.33%)	10	2661646:2661661	2675650:2675665
2661646:2661661	attL	TCAATAAAAATACTAA	NA	NA	NA	NA
WP_003640711.1|2661684_2663553_+	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	47.2	7.7e-137
WP_003640710.1|2663654_2664797_+	molecular chaperone DnaJ	NA	A0A2K9L588	Tupanvirus	32.0	4.3e-21
WP_003645971.1|2665230_2666406_+	serine hydrolase	NA	NA	NA	NA	NA
WP_003640708.1|2666437_2666587_+	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_003640707.1|2666629_2668156_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	27.6	7.6e-42
WP_015380443.1|2668152_2669367_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	30.5	5.5e-27
WP_003640705.1|2669390_2669633_+	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_003640704.1|2669629_2670907_+	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_003640703.1|2671070_2672906_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.1	1.5e-23
WP_015380442.1|2673022_2674177_-|integrase	site-specific integrase	integrase	A0A0A8WIE1	Clostridium_phage	44.7	2.5e-98
2675650:2675665	attR	TCAATAAAAATACTAA	NA	NA	NA	NA
>prophage 185
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2679663	2696851	3226492	tRNA	Salmonella_phage(14.29%)	16	NA	NA
WP_003640696.1|2679663_2681931_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	S4TRQ0	Salmonella_phage	43.6	2.4e-07
WP_003640695.1|2681940_2682387_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_003645975.1|2682459_2683083_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_015380437.1|2683190_2684033_-	phosphotransferase	NA	NA	NA	NA	NA
WP_003645977.1|2684301_2685150_-	SH3 domain-containing protein	NA	C8CHK8	Thermus_virus	38.9	3.0e-11
WP_003640691.1|2685540_2686821_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015380436.1|2686862_2688659_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SFI4	Hokovirus	30.2	3.0e-05
WP_003644477.1|2688739_2689270_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_003640688.1|2689472_2690348_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	29.7	5.9e-23
WP_015380435.1|2690721_2691882_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_160248415.1|2691994_2692891_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	30.3	7.4e-21
WP_015380433.1|2692948_2693674_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003640684.1|2693816_2694635_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_003638914.1|2694867_2695056_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003640683.1|2695097_2695541_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	35.6	5.5e-17
WP_003644473.1|2695873_2696851_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	49.3	2.2e-50
>prophage 186
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2703058	2706127	3226492		Helicobacter_phage(50.0%)	2	NA	NA
WP_160248416.1|2703058_2704939_+	DNA primase	NA	A0A1S5RH72	Helicobacter_phage	30.1	9.4e-50
WP_003640674.1|2705020_2706127_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	37.4	3.7e-38
>prophage 187
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2711116	2712016	3226492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_015380426.1|2711116_2712016_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.6	8.8e-30
>prophage 188
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2715999	2716887	3226492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003645994.1|2715999_2716887_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.0	2.5e-21
>prophage 189
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2728886	2729661	3226492	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_086989537.1|2728886_2729661_+|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
>prophage 190
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2748735	2752369	3226492		Streptococcus_phage(50.0%)	2	NA	NA
WP_003646019.1|2748735_2750025_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.2	8.3e-106
WP_015380403.1|2750092_2752369_+	HAD-IC family P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.9	2.8e-32
>prophage 191
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2757932	2762106	3226492		Hokovirus(50.0%)	3	NA	NA
WP_015380400.1|2757932_2760329_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	31.5	7.9e-118
WP_003644447.1|2760483_2760990_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003646029.1|2761164_2762106_+	daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.9	1.6e-26
>prophage 192
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2767865	2775038	3226492		Vibrio_phage(50.0%)	3	NA	NA
WP_003646034.1|2767865_2770469_+	ATP-dependent chaperone ClpB	NA	A0A2I7SAX5	Vibrio_phage	34.0	1.9e-125
WP_003640606.1|2771126_2771327_-	YjzD family protein	NA	NA	NA	NA	NA
WP_003646035.1|2771687_2775038_+	DNA polymerase III subunit alpha	NA	A0A291AVG1	Streptomyces_phage	32.8	6.4e-150
>prophage 193
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2780341	2787378	3226492		uncultured_Mediterranean_phage(50.0%)	8	NA	NA
WP_003644441.1|2780341_2781232_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	33.3	4.6e-39
WP_160248420.1|2781270_2781654_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003640597.1|2781619_2782387_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.3	3.3e-09
WP_015380396.1|2782373_2782973_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.7	1.2e-11
WP_003640595.1|2782972_2783689_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_003644438.1|2783988_2784573_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_015380395.1|2784908_2785952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380394.1|2785938_2787378_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	38.9	5.1e-56
>prophage 194
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2791867	2792143	3226492		Bacillus_phage(100.0%)	1	NA	NA
WP_003640587.1|2791867_2792143_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	69.7	6.8e-26
>prophage 195
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2795626	2805354	3226492	tRNA	unidentified_phage(20.0%)	10	NA	NA
WP_015380389.1|2795626_2796850_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	50.0	1.3e-44
WP_003640581.1|2796906_2797359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380388.1|2797540_2799439_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.4	8.6e-51
WP_003640579.1|2799451_2800402_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	61.5	3.8e-116
WP_003640578.1|2800411_2800903_+	dihydrofolate reductase	NA	A0A1L7N103	Ralstonia_phage	37.9	9.4e-18
WP_003640577.1|2801009_2801861_+	DegV family protein	NA	NA	NA	NA	NA
WP_043993018.1|2802011_2802956_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_003640575.1|2802968_2803613_+	YpmS family protein	NA	NA	NA	NA	NA
WP_015380386.1|2803624_2803846_+	YozE family protein	NA	NA	NA	NA	NA
WP_003640573.1|2803875_2805354_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.9	1.8e-19
>prophage 196
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2810595	2829483	3226492	tRNA,protease	Bacillus_virus(25.0%)	14	NA	NA
WP_013355560.1|2810595_2811525_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	33.8	3.5e-05
WP_003640567.1|2811714_2812863_+	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	33.2	1.6e-47
WP_015380382.1|2813415_2814270_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_015380381.1|2814262_2815030_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	35.6	7.5e-22
WP_160248422.1|2815108_2815975_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003645027.1|2816063_2818211_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	37.3	4.1e-102
WP_015380379.1|2818489_2819815_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_003640561.1|2819894_2820839_+	tyrosine recombinase XerC	NA	S5M872	Bacillus_phage	26.5	4.2e-14
WP_003638820.1|2820822_2821365_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_003640560.1|2821382_2822801_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	27.9	2.1e-30
WP_003640559.1|2822827_2823706_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003644419.1|2823901_2824528_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003640557.1|2825012_2827019_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.7	1.6e-124
WP_015380376.1|2827032_2829483_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.9	8.1e-94
>prophage 197
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2839661	2840993	3226492		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_160248482.1|2839661_2840993_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.1	7.9e-27
>prophage 198
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2865724	2866624	3226492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_016511704.1|2865724_2866624_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.9	4.3e-37
>prophage 199
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2869843	2872228	3226492	transposase	unidentified_phage(50.0%)	3	NA	NA
WP_004271307.1|2869843_2870767_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	6.7e-33
WP_015380351.1|2871107_2871518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160248424.1|2871628_2872228_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	39.3	2.5e-33
>prophage 200
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2876764	2877688	3226492		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_011101547.1|2876764_2877688_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.1	1.2e-10
>prophage 201
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2884591	2891959	3226492		Aureococcus_anophage(33.33%)	6	NA	NA
WP_160248425.1|2884591_2885269_-	ATP-binding cassette domain-containing protein	NA	A0A076FI99	Aureococcus_anophage	28.9	2.1e-07
WP_003645067.1|2885268_2886021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015640385.1|2886168_2887227_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_003645069.1|2887308_2888652_-	glycosyl hydrolase family 25	NA	A0A2P0ZKX1	Lactobacillus_phage	32.2	2.9e-37
WP_015640382.1|2889385_2890465_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_015380342.1|2890618_2891959_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.9	1.7e-05
>prophage 202
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2897586	2902335	3226492		Bacillus_phage(33.33%)	4	NA	NA
WP_003640485.1|2897586_2898156_-	DUF1273 domain-containing protein	NA	U5J9F7	Bacillus_phage	25.9	8.6e-07
WP_003644374.1|2898270_2898894_+	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	38.7	3.2e-23
WP_015380338.1|2898905_2901197_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_003645078.1|2901381_2902335_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.0	2.7e-21
>prophage 203
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2907298	2915713	3226492	tRNA	Bacillus_phage(50.0%)	7	NA	NA
WP_015380332.1|2907298_2908366_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.5	1.6e-30
WP_011101531.1|2908739_2908946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015380331.1|2909001_2909727_-	DnaD domain protein	NA	A0A0N7AE27	Bacillus_phage	40.4	7.4e-11
WP_003640473.1|2909804_2911103_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	29.1	3.0e-55
WP_003640472.1|2911120_2912326_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_080125243.1|2912342_2912843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003645087.1|2912908_2915713_-	ATP-dependent helicase DinG	NA	A0A127AW80	Bacillus_phage	24.1	5.2e-36
>prophage 204
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2931106	2934475	3226492		Klosneuvirus(50.0%)	4	NA	NA
WP_003644352.1|2931106_2932456_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	24.0	1.4e-18
WP_015380323.1|2932893_2933166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640454.1|2933305_2933605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640453.1|2933698_2934475_-	potassium channel family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	35.0	1.4e-23
>prophage 205
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2941060	2941836	3226492	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_086989537.1|2941060_2941836_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
>prophage 206
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2945922	2948728	3226492		Apis_mellifera_filamentous_virus(50.0%)	2	NA	NA
WP_003640437.1|2945922_2946528_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	32.1	7.0e-15
WP_160248427.1|2947555_2948728_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	37.8	1.9e-40
>prophage 207
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2979217	2985861	3226492		Acinetobacter_phage(60.0%)	6	NA	NA
WP_015825530.1|2979217_2980000_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	34.3	7.6e-30
WP_003640394.1|2979996_2981016_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.8	2.9e-53
WP_003640393.1|2981040_2981616_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	39.1	2.6e-35
WP_015380291.1|2981599_2983036_-	anthranilate synthase component I family protein	NA	S4VT78	Pandoravirus	32.8	8.3e-22
WP_015380290.1|2983508_2985104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015380289.1|2985096_2985861_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	3.7e-21
>prophage 208
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	2996295	2996766	3226492		Pseudoalteromonas_phage(100.0%)	1	NA	NA
WP_015380280.1|2996295_2996766_-	alcohol dehydrogenase	NA	M4SQJ2	Pseudoalteromonas_phage	46.3	4.2e-07
>prophage 209
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	3014560	3015256	3226492		Indivirus(100.0%)	1	NA	NA
WP_003640377.1|3014560_3015256_-	ribonuclease III	NA	A0A1V0SDK0	Indivirus	33.0	2.7e-18
>prophage 210
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	3024412	3038331	3226492	holin,tRNA	Noumeavirus(20.0%)	13	NA	NA
WP_003645152.1|3024412_3026437_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1Q1PNS5	Noumeavirus	30.5	2.9e-20
WP_003640367.1|3026433_3027180_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_015380274.1|3027197_3028541_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_003645154.1|3028537_3029491_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	31.4	1.7e-10
WP_016511359.1|3029514_3031932_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_043993016.1|3031954_3033181_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.1	2.6e-40
WP_003640362.1|3033344_3033557_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003640361.1|3033553_3034174_-	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	33.6	1.4e-10
WP_003645156.1|3034366_3034702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003640359.1|3034907_3035561_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_160248434.1|3035560_3036496_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003644316.1|3036508_3037138_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_043992759.1|3037134_3038331_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	46.2	3.0e-17
>prophage 211
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	3042981	3045178	3226492		Gordonia_phage(50.0%)	2	NA	NA
WP_015380268.1|3042981_3044325_-	exodeoxyribonuclease VII large subunit	NA	A0A160DEV2	Gordonia_phage	30.8	6.7e-26
WP_003645162.1|3044317_3045178_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	40.1	1.1e-32
>prophage 212
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	3057680	3058415	3226492		Enterococcus_phage(100.0%)	1	NA	NA
WP_003640330.1|3057680_3058415_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	44.3	4.5e-16
>prophage 213
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	3071053	3071683	3226492		Catovirus(100.0%)	1	NA	NA
WP_003640313.1|3071053_3071683_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.6	1.7e-35
>prophage 214
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	3075479	3076526	3226492	tRNA	Bodo_saltans_virus(100.0%)	1	NA	NA
WP_003644299.1|3075479_3076526_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	37.9	4.0e-26
>prophage 215
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	3082392	3092526	3226492		Bacillus_virus(40.0%)	6	NA	NA
WP_015380255.1|3082392_3085578_+	SMC family ATPase	NA	G3MAB6	Bacillus_virus	20.9	6.3e-06
WP_160248442.1|3085712_3086681_-	1,4-dihydroxy-2-naphthoate prenyltransferase	NA	NA	NA	NA	NA
WP_015380253.1|3087051_3088695_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.7	7.2e-22
WP_003638551.1|3088694_3089381_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.4	3.9e-30
WP_003640299.1|3089571_3090921_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.8	1.3e-85
WP_003645183.1|3091089_3092526_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	29.3	2.6e-28
>prophage 216
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	3107148	3120773	3226492	tRNA	Bacillus_phage(28.57%)	13	NA	NA
WP_015380242.1|3107148_3108411_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	38.6	3.0e-68
WP_015380241.1|3108582_3108894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640279.1|3109136_3109493_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003638526.1|3109529_3109724_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003644288.1|3109745_3110267_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	38.0	1.9e-16
WP_003644287.1|3110488_3112453_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.4	3.4e-103
WP_003644286.1|3112785_3113721_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	30.3	2.8e-26
WP_043992744.1|3113724_3115128_-	helicase DnaB	NA	NA	NA	NA	NA
WP_003640274.1|3115149_3115665_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_003645195.1|3115706_3116300_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_015380239.1|3116309_3117134_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	33.0	8.9e-29
WP_043992742.1|3117145_3119794_-	DNA polymerase I	NA	F8WQ35	Bacillus_phage	35.1	8.9e-46
WP_003640270.1|3120056_3120773_-	Bax inhibitor-1/YccA family protein	NA	A2VCJ8	Vaccinia_virus	25.2	2.9e-07
>prophage 217
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	3124712	3128046	3226492		environmental_halophage(50.0%)	3	NA	NA
WP_015380235.1|3124712_3125951_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	46.4	3.6e-106
WP_160248451.1|3125934_3127236_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003640263.1|3127248_3128046_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	25.5	1.8e-10
>prophage 218
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	3132358	3135253	3226492		Mycobacterium_phage(100.0%)	1	NA	NA
WP_160248453.1|3132358_3135253_-	cell division protein FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.7	2.3e-87
>prophage 219
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	3139394	3140132	3226492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003644277.1|3139394_3140132_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	1.4e-20
>prophage 220
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	3150194	3157850	3226492		Staphylococcus_phage(80.0%)	9	NA	NA
WP_015380228.1|3150194_3151511_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.0	1.3e-08
WP_003640242.1|3151664_3152291_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011101408.1|3152426_3153068_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_015380227.1|3153156_3153720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003640239.1|3153896_3154457_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003640238.1|3154487_3154967_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.3	4.1e-34
WP_015380226.1|3154963_3156178_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.4	3.8e-84
WP_003640236.1|3156179_3156782_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.9	1.8e-23
WP_003644273.1|3156782_3157850_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	32.8	1.2e-38
>prophage 221
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	3163560	3173398	3226492		Lactobacillus_phage(87.5%)	9	NA	NA
WP_003645220.1|3163560_3164556_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.8	3.1e-52
WP_015380221.1|3165182_3165320_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003643094.1|3165415_3165856_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	99.3	8.0e-77
WP_003643095.1|3165926_3166487_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
WP_015380220.1|3166574_3169013_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.5	0.0e+00
WP_160248458.1|3169015_3169630_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	99.5	3.1e-111
WP_003643099.1|3169973_3170921_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_015640259.1|3171106_3172078_+	Nisin resistance protein	NA	A0A2P0ZL68	Lactobacillus_phage	98.8	2.0e-181
WP_015640258.1|3172168_3173398_-	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	97.7	2.7e-215
>prophage 222
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	3196555	3201190	3226492	tRNA	Planktothrix_phage(50.0%)	3	NA	NA
WP_043992731.1|3196555_3198550_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	40.4	5.3e-35
WP_003645237.1|3198819_3199296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003645238.1|3199501_3201190_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.9	1.2e-75
>prophage 223
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	3209450	3211252	3226492		Tupanvirus(50.0%)	2	NA	NA
WP_160248463.1|3209450_3210074_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	41.2	2.2e-27
WP_003645244.1|3210076_3211252_-	sulfate adenylyltransferase	NA	A0A2P1ELS9	Moumouvirus	31.7	1.4e-48
>prophage 224
NZ_CP028334	Lactobacillus plantarum strain SRCM101167 chromosome, complete genome	3226492	3222138	3223962	3226492		Lactobacillus_phage(100.0%)	4	NA	NA
WP_015380198.1|3222138_3222423_-	hypothetical protein	NA	A0A2P0ZLE8	Lactobacillus_phage	96.8	2.0e-41
WP_015380197.1|3222422_3222632_-	hypothetical protein	NA	A0A2P0ZLG4	Lactobacillus_phage	58.0	1.3e-08
WP_015380196.1|3222637_3223018_-	hypothetical protein	NA	A0A2P0ZLF7	Lactobacillus_phage	75.2	7.2e-50
WP_015380194.1|3223470_3223962_-	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	65.0	1.6e-49
>prophage 1
NZ_CP028336	Lactobacillus plantarum strain SRCM101167 plasmid unnamed2, complete sequence	50704	3679	13026	50704	transposase	Enterobacteria_phage(37.5%)	10	NA	NA
WP_021730698.1|3679_4486_-	ParA family protein	NA	A0A1V0DZZ0	Clostridioides_phage	30.1	3.9e-21
WP_160248550.1|4845_5775_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.8	2.3e-25
WP_021731007.1|5835_6672_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.4	1.2e-33
WP_027822971.1|6704_7733_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	45.1	4.0e-71
WP_160248552.1|7742_8324_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.3	2.8e-37
WP_021730701.1|8327_9197_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	59.7	1.7e-99
WP_160248553.1|9331_10507_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.2	3.1e-27
WP_160248555.1|10594_10954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015639693.1|11183_11462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160248557.1|12240_13026_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	37.2	1.0e-37
>prophage 1
NZ_CP028337	Lactobacillus plantarum strain SRCM101167 plasmid unnamed3, complete sequence	47265	7936	14778	47265	transposase	Enterococcus_phage(33.33%)	6	NA	NA
WP_085764182.1|7936_10105_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.2	6.2e-255
WP_021729931.1|10211_11138_+	ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4P8A9	Corynebacterium_phage	31.4	1.9e-35
WP_020923860.1|11152_12103_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	54.6	9.4e-99
WP_160248622.1|12230_13043_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	32.7	3.0e-13
WP_016526668.1|13156_13789_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	33.2	3.6e-14
WP_021356783.1|13875_14778_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	40.3	1.1e-51
>prophage 1
NZ_CP028338	Lactobacillus plantarum strain SRCM101167 plasmid unnamed4, complete sequence	26244	0	5501	26244	integrase	Bacillus_phage(100.0%)	7	130:143	9740:9753
130:143	attL	ATGACCGATGAAGA	NA	NA	NA	NA
WP_020923865.1|1145_1409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016511518.1|1444_1912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020923867.1|2134_2311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068226441.1|2270_3440_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_001748276.1|4234_4504_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001748275.1|4490_4862_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_063207285.1|4913_5501_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	34.8	3.2e-20
9740:9753	attR	TCTTCATCGGTCAT	NA	NA	NA	NA
>prophage 2
NZ_CP028338	Lactobacillus plantarum strain SRCM101167 plasmid unnamed4, complete sequence	26244	9315	14327	26244		Erysipelothrix_phage(100.0%)	2	NA	NA
WP_160248635.1|9315_12315_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	46.3	1.2e-232
WP_160248637.1|12323_14327_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	35.5	2.5e-101
>prophage 3
NZ_CP028338	Lactobacillus plantarum strain SRCM101167 plasmid unnamed4, complete sequence	26244	17417	18005	26244	integrase	Bacillus_phage(100.0%)	1	9275:9298	18807:18830
9275:9298	attL	TATTTGTATATTATAGACCCTATA	NA	NA	NA	NA
WP_160248643.1|17417_18005_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	33.7	6.3e-21
WP_160248643.1|17417_18005_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	33.7	6.3e-21
18807:18830	attR	TATTTGTATATTATAGACCCTATA	NA	NA	NA	NA
>prophage 4
NZ_CP028338	Lactobacillus plantarum strain SRCM101167 plasmid unnamed4, complete sequence	26244	23886	24339	26244	integrase	Bacillus_phage(100.0%)	1	NA	NA
WP_160248648.1|23886_24339_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	34.0	1.1e-15
