The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP034952	Geobacillus stearothermophilus strain B5 chromosome, complete genome	3390870	168573	238520	3390870	tRNA,protease,coat,transposase	Bacillus_phage(16.67%)	57	NA	NA
WP_060475512.1|168573_169569_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014194633.1|170472_170919_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_033007523.1|171343_171976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160268524.1|172251_172809_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	69.9	1.7e-52
WP_160270602.1|172976_173783_+	DUF817 domain-containing protein	NA	NA	NA	NA	NA
WP_081132854.1|173847_174336_-	DinB family protein	NA	NA	NA	NA	NA
WP_160268526.1|174385_175138_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_160268528.1|175195_176569_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_160268530.1|176992_178240_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	36.9	8.4e-63
WP_055359031.1|178537_180085_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_160270603.1|180155_181364_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.2	1.4e-30
WP_033016526.1|181515_182124_+	DedA family protein	NA	NA	NA	NA	NA
WP_160268532.1|182186_183176_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_047817675.1|183172_184180_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_015373766.1|184247_185174_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015373767.1|185180_185972_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.3	3.2e-15
WP_094239463.1|188988_189507_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_094239464.1|189678_189933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015373773.1|191039_191744_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_081107437.1|191829_192318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033017188.1|193238_194423_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3V0V2	Geobacillus_virus	41.4	1.8e-75
WP_160268534.1|194701_196663_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.9	1.6e-140
WP_100664191.1|197122_198460_+	Trk family potassium uptake protein	NA	NA	NA	NA	NA
WP_160268536.1|199507_200146_+	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_160268538.1|200213_201197_+	sporulation protein	NA	NA	NA	NA	NA
WP_015373782.1|201345_201852_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_160268540.1|201985_202927_+	ROK family protein	NA	NA	NA	NA	NA
WP_033010289.1|203091_203913_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_033016518.1|204318_205392_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_160268542.1|205720_206449_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_160268544.1|206459_207071_+	DedA family protein	NA	NA	NA	NA	NA
WP_160268546.1|207067_208210_+	UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_033010295.1|208368_209463_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_160268548.1|209478_210855_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_160270605.1|210927_211653_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_160268550.1|211805_213173_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_160268552.1|213429_214833_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.2	7.4e-68
WP_033010298.1|214844_215462_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_160268554.1|215580_215970_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_044743921.1|216049_217069_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_033010307.1|217311_218478_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	30.2	1.3e-30
WP_033010302.1|218592_218874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003253417.1|218878_219229_+	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	2.0e-14
WP_061580987.1|219771_221934_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_094239478.1|221991_222105_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_033010304.1|222197_222659_+	SprT family protein	NA	U5J9G1	Bacillus_phage	26.3	5.0e-05
WP_033010045.1|230065_230524_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047817699.1|230520_231261_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_033010040.1|231220_231673_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_047817700.1|231669_232683_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	45.1	4.0e-71
WP_033016753.1|233432_235364_-	ABC-F type ribosomal protection protein	NA	A0A2K9L3Z8	Tupanvirus	34.1	2.1e-60
WP_033016803.1|235459_235948_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_033010037.1|235963_236605_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_031406010.1|236622_236775_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_033016804.1|236795_237545_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_033010036.1|237609_237789_-	YdiK family protein	NA	NA	NA	NA	NA
WP_160268556.1|237785_238520_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP034952	Geobacillus stearothermophilus strain B5 chromosome, complete genome	3390870	261117	269477	3390870		Synechococcus_phage(33.33%)	8	NA	NA
WP_033009942.1|261117_262413_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.6	3.8e-18
WP_033009943.1|262488_263217_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	41.9	9.6e-43
WP_049624734.1|263204_263459_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_160268566.1|263455_264142_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_050368120.1|264125_266354_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.8	1.3e-170
WP_160268568.1|266329_267742_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	5.4e-50
WP_033016678.1|267807_268848_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	43.6	1.0e-66
WP_049624731.1|268844_269477_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	37.4	2.7e-25
>prophage 3
NZ_CP034952	Geobacillus stearothermophilus strain B5 chromosome, complete genome	3390870	285688	320073	3390870	tRNA,holin,transposase	Bacillus_virus(40.0%)	26	NA	NA
WP_014194780.1|285688_285979_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_160268584.1|285991_287449_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_160268586.1|287462_288893_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_160268588.1|289069_290374_+	homocysteine synthase	NA	A0A0B5JD48	Pandoravirus	26.2	9.2e-20
WP_033016662.1|291210_292092_+	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_160268590.1|292075_292816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055357787.1|292812_293514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160268592.1|293526_294180_+	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	32.2	3.6e-25
WP_050368131.1|294852_295482_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_160268594.1|295706_296834_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	36.0	1.9e-29
WP_160268596.1|296850_297753_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_160268598.1|298186_298624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042382642.1|298768_300259_+	TIGR02677 family protein	NA	NA	NA	NA	NA
WP_042382644.1|300261_301458_+	TIGR02678 family protein	NA	NA	NA	NA	NA
WP_160268600.1|301417_305539_+	TIGR02680 family protein	NA	NA	NA	NA	NA
WP_160268602.1|305535_306756_+	TIGR02679 family protein	NA	NA	NA	NA	NA
WP_033024571.1|306898_307825_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_160268604.1|309343_310144_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_160268606.1|310136_311387_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.8	3.3e-11
WP_160268608.1|312133_313414_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_160268610.1|313506_313863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160268612.1|314174_315542_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_033016933.1|316234_316543_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_064213564.1|317328_318129_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_033011707.1|318121_319375_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.3	1.2e-11
WP_033011705.1|319527_320073_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP034952	Geobacillus stearothermophilus strain B5 chromosome, complete genome	3390870	625375	668971	3390870	transposase	Trichoplusia_ni_ascovirus(12.5%)	34	NA	NA
WP_160270627.1|625375_626749_+|transposase	IS1380-like element ISGsp2 family transposase	transposase	NA	NA	NA	NA
WP_160268795.1|627106_628378_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_160268797.1|628447_629728_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_047817873.1|629727_630570_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_160268799.1|630642_632178_+	alpha-amylase	NA	NA	NA	NA	NA
WP_053532441.1|632196_633216_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_160268801.1|634414_635278_-	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	45.5	4.6e-60
WP_013523104.1|635508_635802_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_160268822.1|635826_636246_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_160268824.1|636387_639798_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	46.7	1.7e-09
WP_160268826.1|639790_641638_-	bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_160268828.1|642090_643149_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.4	3.8e-40
WP_033010565.1|643145_643955_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_160268830.1|643951_644755_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_160268832.1|644755_645829_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_160268834.1|646254_646572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160268836.1|646696_647200_-	DUF1572 domain-containing protein	NA	NA	NA	NA	NA
WP_100659177.1|647555_648386_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_094239668.1|648339_649065_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.6	4.9e-23
WP_160268838.1|649485_651144_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_011229840.1|652518_653655_-|transposase	IS110-like element ISGka2 family transposase	transposase	Q9JMN8	Wolbachia_phage	27.1	1.2e-31
WP_160268604.1|653891_654692_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_160268606.1|654684_655935_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.8	3.3e-11
WP_015374086.1|657672_659052_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_094239669.1|659172_659781_+	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_160268839.1|660433_661615_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_013146140.1|661770_662262_-	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_008879040.1|662463_662595_-	DUF3941 domain-containing protein	NA	NA	NA	NA	NA
WP_160268841.1|662829_663924_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	35.6	3.9e-48
WP_160268843.1|663980_664844_-	DegV family protein	NA	NA	NA	NA	NA
WP_047817895.1|665021_665222_-	DUF3813 domain-containing protein	NA	NA	NA	NA	NA
WP_160268844.1|665592_666399_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_053532436.1|666515_667283_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_047818438.1|667456_668971_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	36.5	2.5e-77
>prophage 5
NZ_CP034952	Geobacillus stearothermophilus strain B5 chromosome, complete genome	3390870	706969	726683	3390870	transposase	Rhodobacter_phage(33.33%)	12	NA	NA
WP_069304400.1|706969_708103_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_160268880.1|708112_708793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160268882.1|708813_710181_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_033011705.1|710715_711261_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_033011707.1|711413_712667_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.3	1.2e-11
WP_064213564.1|712659_713460_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_160268884.1|713668_719320_+	DNRLRE domain-containing protein	NA	NA	NA	NA	NA
WP_011230285.1|719377_720883_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_011230286.1|720879_721632_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	41.4	8.7e-39
WP_011229816.1|723583_724774_+|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	25.2	2.2e-28
WP_160268886.1|724987_725176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062898466.1|725234_726683_+|transposase	IS66-like element ISBst12 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP034952	Geobacillus stearothermophilus strain B5 chromosome, complete genome	3390870	778438	881198	3390870	transposase,coat,bacteriocin,integrase	Bacillus_phage(23.53%)	91	818818:818834	866974:866990
WP_160268928.1|778438_779539_-|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_160268930.1|779796_780951_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_050368378.1|780947_781904_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	32.2	5.5e-38
WP_160268931.1|781900_783184_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.2	1.4e-73
WP_160268933.1|783712_784822_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	48.3	9.0e-85
WP_033010455.1|785252_786368_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_160268934.1|786364_787369_-	phosphotransferase	NA	NA	NA	NA	NA
WP_160268936.1|787524_787827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160268938.1|787877_788357_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_033015674.1|788830_789598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160268939.1|789700_790417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047817949.1|790571_790901_+|coat	spore coat protein regulator protein YlbO	coat	NA	NA	NA	NA
WP_047817950.1|791175_791400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033015681.1|791788_791995_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_160268941.1|792092_792569_+	sporulation protein	NA	NA	NA	NA	NA
WP_049624145.1|792580_793060_+	stage V sporulation protein AC	NA	NA	NA	NA	NA
WP_160268943.1|793059_794073_+	stage V sporulation protein AD	NA	NA	NA	NA	NA
WP_160268944.1|794074_794431_+	stage V sporulation protein AE	NA	NA	NA	NA	NA
WP_011230357.1|794443_794650_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_033015691.1|794662_795523_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_160268946.1|795853_796174_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_015374185.1|796302_796539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230362.1|796618_796744_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_033015693.1|796870_797128_+	sporulation protein	NA	NA	NA	NA	NA
WP_160268948.1|797172_797607_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_033010483.1|797603_798128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160268950.1|798166_798895_-	esterase family protein	NA	NA	NA	NA	NA
WP_160268951.1|799397_800501_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	27.8	2.1e-17
WP_160268953.1|800504_801686_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_011230369.1|801735_801945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160268955.1|802093_802537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013360.1|802782_803481_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_033013361.1|803480_804599_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_160270636.1|804598_805654_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_160268956.1|812719_813583_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_160268958.1|813927_814494_-	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	71.9	1.1e-54
WP_160268960.1|815115_815688_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_064213564.1|816009_816810_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_033011707.1|816802_818056_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.3	1.2e-11
WP_033011705.1|818208_818754_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
818818:818834	attL	GCACATTCTTTCAGAAA	NA	NA	NA	NA
WP_160268961.1|819010_820459_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_160268963.1|820602_820791_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_160268964.1|820933_821836_+	DUF2935 domain-containing protein	NA	NA	NA	NA	NA
WP_160268966.1|821978_822644_-	haloacid dehalogenase type II	NA	NA	NA	NA	NA
WP_160268968.1|822935_823376_-	OsmC family protein	NA	NA	NA	NA	NA
WP_015864904.1|823902_825090_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_160268969.1|825410_826091_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_160268971.1|826329_826533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082816471.1|826823_826907_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_160268972.1|827182_827740_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011230382.1|829124_829925_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_160268974.1|830222_831707_+	type I restriction-modification system subunit M	NA	A0A220A2U4	Liberibacter_phage	41.3	1.9e-109
WP_160268975.1|831696_832866_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_160268977.1|832862_835817_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.6	6.3e-101
WP_094239757.1|835851_836583_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_094239758.1|837804_838185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063166545.1|839212_839413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014195217.1|839528_840971_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_094239761.1|841104_841659_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	39.9	5.8e-32
WP_160268978.1|841842_842118_+	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_160268980.1|842133_844530_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.8	4.8e-123
WP_011230404.1|844551_844755_+	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_160268981.1|844978_845848_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_160268983.1|846154_848062_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	31.9	6.6e-35
WP_160268985.1|848589_850872_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	70.0	5.2e-305
WP_047757707.1|850946_851987_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A127AVZ3	Bacillus_phage	61.7	7.1e-124
WP_013146000.1|852698_853235_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_160268986.1|853364_853718_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_160268988.1|853854_854319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160268990.1|854457_855312_-|bacteriocin	bacteriocin family protein	bacteriocin	NA	NA	NA	NA
WP_033024921.1|855327_855921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160268991.1|856347_857640_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_033015762.1|857679_858663_+	ornithine cyclodeaminase	NA	A0A1V0SL93	Klosneuvirus	26.5	9.7e-14
WP_015374224.1|858915_859830_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_119877564.1|860509_861136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160268993.1|861400_861598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033005157.1|861972_862716_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_020754483.1|862731_863157_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_160268994.1|863273_864443_+	amidohydrolase	NA	NA	NA	NA	NA
WP_160270638.1|864417_865257_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_160268996.1|865253_866381_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_094239770.1|866406_866901_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155836653.1|870367_870823_-	hypothetical protein	NA	NA	NA	NA	NA
866974:866990	attR	GCACATTCTTTCAGAAA	NA	NA	NA	NA
WP_100660194.1|870844_871471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160270640.1|871740_872667_+|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	22.8	5.5e-19
WP_094239775.1|872667_872910_+	hypothetical protein	NA	A0A1S5SBP9	Streptococcus_phage	43.9	1.5e-05
WP_094239776.1|873134_874013_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_033009100.1|876027_877563_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_160268998.1|877562_877904_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_160269000.1|878218_879634_+	amino acid permease	NA	NA	NA	NA	NA
WP_033009094.1|880085_881198_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3UZC2	Geobacillus_virus	64.6	1.6e-145
>prophage 7
NZ_CP034952	Geobacillus stearothermophilus strain B5 chromosome, complete genome	3390870	928413	963809	3390870	tRNA,transposase,protease	Geobacillus_virus(100.0%)	25	NA	NA
WP_062678816.1|928413_929595_+|transposase	IS701-like element ISBsm1 family transposase	transposase	NA	NA	NA	NA
WP_160269044.1|929680_930865_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3V0V2	Geobacillus_virus	41.4	3.1e-75
WP_160269046.1|931029_931785_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_044742505.1|931948_932806_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_160269048.1|933037_935062_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_011230496.1|935168_935435_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_094239807.1|935434_937171_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_110107333.1|937766_939026_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_160269049.1|939106_939658_-|protease	spore protease YyaC	protease	NA	NA	NA	NA
WP_160269052.1|939748_939928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160269053.1|947364_947802_+	DUF4304 domain-containing protein	NA	NA	NA	NA	NA
WP_160269055.1|947895_948252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160269056.1|950032_950245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160269058.1|950632_951049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160269060.1|951064_952240_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_044745498.1|952506_953694_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042894423.1|953799_954147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160269061.1|956514_957021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230510.1|957024_957903_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_160269063.1|957973_958390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160269065.1|958650_958833_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_160269067.1|958833_959952_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_160268612.1|960113_961481_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_033024993.1|962171_962582_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_160269069.1|962696_963809_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP034952	Geobacillus stearothermophilus strain B5 chromosome, complete genome	3390870	1344843	1371637	3390870	transposase	Trichoplusia_ni_ascovirus(33.33%)	18	NA	NA
WP_015374525.1|1344843_1346031_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_160269230.1|1346149_1347556_-	sodium:solute symporter	NA	NA	NA	NA	NA
WP_160269232.1|1347716_1349213_-	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_051049830.1|1349228_1349984_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.3	3.8e-26
WP_015374531.1|1350010_1350871_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_051049844.1|1350927_1351827_-	agmatinase	NA	NA	NA	NA	NA
WP_015374614.1|1352574_1353708_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_041470674.1|1357299_1358916_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160270652.1|1359209_1360676_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015374540.1|1360812_1362168_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_015376014.1|1362599_1363736_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.1	5.1e-35
WP_160269233.1|1364195_1365176_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_160269235.1|1366652_1367933_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_160269237.1|1368155_1368812_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.9	4.0e-40
WP_160269239.1|1368765_1369029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011229672.1|1369025_1369352_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_160269241.1|1369791_1370343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160269242.1|1370461_1371637_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP034952	Geobacillus stearothermophilus strain B5 chromosome, complete genome	3390870	1570901	1623408	3390870	tRNA,transposase	Bacillus_phage(50.0%)	54	NA	NA
WP_033011274.1|1570901_1572263_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_033015279.1|1572567_1572786_+	YozE family protein	NA	NA	NA	NA	NA
WP_044743989.1|1572916_1573561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033015276.1|1573799_1573979_+	YozD family protein	NA	NA	NA	NA	NA
WP_160269375.1|1573997_1574189_-	DUF2515 domain-containing protein	NA	NA	NA	NA	NA
WP_160269377.1|1574139_1574628_-	DUF2515 domain-containing protein	NA	NA	NA	NA	NA
WP_063329436.1|1574785_1575103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050368649.1|1575716_1576121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033009203.1|1576406_1577114_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_033009202.1|1577165_1577981_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_044743985.1|1578163_1578862_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_050368652.1|1579034_1579913_+	cation transporter	NA	NA	NA	NA	NA
WP_044743983.1|1580194_1581151_+	magnesium transporter CorA	NA	NA	NA	NA	NA
WP_080706518.1|1581243_1581333_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_160269379.1|1581543_1582473_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_013145429.1|1582596_1582695_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_095859317.1|1582728_1582860_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_033015249.1|1583002_1583896_+	DUF1028 domain-containing protein	NA	NA	NA	NA	NA
WP_160269380.1|1584070_1585438_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_160269382.1|1585536_1586799_-	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.0	3.4e-19
WP_160269384.1|1586935_1588105_-|tRNA	alanyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_160270665.1|1588517_1589726_+	threonine ammonia-lyase	NA	NA	NA	NA	NA
WP_160270667.1|1589892_1590126_-	cytosolic protein	NA	NA	NA	NA	NA
WP_160269385.1|1590201_1591449_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	36.9	1.4e-62
WP_160269387.1|1591772_1592561_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_160269388.1|1592751_1593000_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_011231100.1|1593907_1594348_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013523690.1|1594350_1594989_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_060787795.1|1594999_1596712_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_011231104.1|1596841_1596991_+	YflJ family protein	NA	NA	NA	NA	NA
WP_015374752.1|1597115_1597310_+	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_014195730.1|1597456_1597663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014195731.1|1597719_1599012_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_014195732.1|1599052_1599319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160269390.1|1599533_1600901_-|transposase	ISLre2-like element ISGsp3 family transposase	transposase	NA	NA	NA	NA
WP_014195733.1|1601136_1602285_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_014195734.1|1602281_1603817_-	spore germination protein	NA	NA	NA	NA	NA
WP_014195735.1|1603813_1604911_-	endospore germination permease	NA	NA	NA	NA	NA
WP_160269391.1|1605170_1605449_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_160269393.1|1605569_1605947_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160269394.1|1605943_1606843_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.0	6.7e-22
WP_160269396.1|1606817_1608524_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_160269398.1|1608593_1608821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160269399.1|1608946_1610572_+	spore germination protein	NA	NA	NA	NA	NA
WP_160269401.1|1610568_1611771_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_160269403.1|1611824_1612928_+	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_160269404.1|1613156_1614602_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_160269406.1|1614611_1615040_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_063330532.1|1615133_1615559_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_160269408.1|1615970_1617707_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	6.9e-39
WP_160269410.1|1617690_1619493_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	1.6e-54
WP_160269412.1|1619711_1620830_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	45.9	8.0e-89
WP_100664564.1|1621024_1621882_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_160269413.1|1622040_1623408_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP034952	Geobacillus stearothermophilus strain B5 chromosome, complete genome	3390870	1769429	1820933	3390870	transposase,protease	Hokovirus(20.0%)	44	NA	NA
WP_160269514.1|1769429_1771796_-|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_160269515.1|1772065_1773367_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.0	1.2e-16
WP_033017013.1|1773529_1774279_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_049626256.1|1774453_1774855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160269517.1|1774998_1776006_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_160269518.1|1776049_1776898_-	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_160269520.1|1776913_1777780_-	permease	NA	NA	NA	NA	NA
WP_160269522.1|1777897_1779766_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_160269524.1|1779792_1780704_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_160269525.1|1780700_1781453_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_160269527.1|1781633_1783463_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_160269529.1|1783657_1784254_-	DUF5317 domain-containing protein	NA	NA	NA	NA	NA
WP_160269531.1|1784662_1784944_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_160269533.1|1784964_1785387_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_021321482.1|1785560_1785770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094238748.1|1785883_1786027_-	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_160269534.1|1786044_1788036_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_050367315.1|1788036_1788258_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_160270676.1|1788825_1789902_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_160268882.1|1790106_1791474_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_033017188.1|1791813_1792998_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3V0V2	Geobacillus_virus	41.4	1.8e-75
WP_160269536.1|1794130_1795057_-	endonuclease I	NA	NA	NA	NA	NA
WP_160269538.1|1795120_1796626_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_160269539.1|1796797_1797646_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_160269541.1|1797706_1798291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033017045.1|1798644_1798950_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015374949.1|1799130_1799346_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_160269542.1|1799668_1800871_-	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_160269544.1|1801069_1803217_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	22.3	7.5e-19
WP_160269546.1|1803228_1803531_-	nitrite reductase small subunit NirD	NA	NA	NA	NA	NA
WP_160269548.1|1803752_1806179_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_025950747.1|1806496_1806901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160269550.1|1806919_1807321_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_020755827.1|1808795_1809830_-	nitropropane dioxygenase	NA	NA	NA	NA	NA
WP_094238764.1|1810125_1810428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160269552.1|1810543_1812043_-	xylulokinase	NA	NA	NA	NA	NA
WP_160269553.1|1812056_1813394_-	xylose isomerase	NA	NA	NA	NA	NA
WP_160269555.1|1813654_1814701_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_160269557.1|1814717_1815713_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_160269559.1|1815797_1816973_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_094238770.1|1816975_1818490_-	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	1.0e-17
WP_160269561.1|1818600_1819695_-	D-xylose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_160270678.1|1820060_1820627_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	45.3	1.7e-34
WP_160269562.1|1820633_1820933_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP034952	Geobacillus stearothermophilus strain B5 chromosome, complete genome	3390870	1935883	2029707	3390870	transposase,protease,integrase	Geobacillus_virus(14.29%)	71	1939161:1939176	2038746:2038764
WP_160269437.1|1935883_1937062_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3V0V2	Geobacillus_virus	38.9	3.9e-70
WP_160269655.1|1938652_1939765_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3UZC2	Geobacillus_virus	65.4	5.4e-146
1939161:1939176	attL	TCGATCGTTTCGCCTG	NA	NA	NA	NA
WP_160269656.1|1939974_1941138_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
1939161:1939176	attL	TCGATCGTTTCGCCTG	NA	NA	NA	NA
WP_013524054.1|1941380_1941794_-	DUF1445 domain-containing protein	NA	NA	NA	NA	NA
WP_160269658.1|1941765_1944213_-	DEAD/DEAH box helicase family protein	NA	Q5YA94	Bacillus_phage	25.9	1.4e-32
WP_160269659.1|1944205_1944532_-	nucleoside triphosphate pyrophosphohydrolase	NA	A0A2I7SAA6	Vibrio_phage	41.3	3.5e-05
WP_160269661.1|1944497_1944719_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_160269663.1|1944901_1946233_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	34.3	1.6e-35
WP_160269665.1|1946249_1946954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160269666.1|1946955_1948716_-	DUF1998 domain-containing protein	NA	NA	NA	NA	NA
WP_160269668.1|1948712_1952033_-	DNA helicase	NA	NA	NA	NA	NA
WP_160269670.1|1952043_1954434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160269096.1|1955980_1957261_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_060788216.1|1958826_1960221_-	ethanolamine permease	NA	NA	NA	NA	NA
WP_160269672.1|1960246_1961086_-	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_044742387.1|1961110_1962472_-	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_062898466.1|1962822_1964271_-|transposase	IS66-like element ISBst12 family transposase	transposase	NA	NA	NA	NA
1962845:1962860	attR	TCGATCGTTTCGCCTG	NA	NA	NA	NA
WP_060788220.1|1965911_1967435_-	amidase	NA	NA	NA	NA	NA
1962845:1962860	attR	TCGATCGTTTCGCCTG	NA	NA	NA	NA
WP_160270686.1|1967409_1967508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015375203.1|1968107_1968638_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_160270688.1|1968652_1969132_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.3	1.3e-08
WP_160269674.1|1969651_1970696_-|transposase	IS630-like element ISBs2 family transposase	transposase	S5VXX4	Leptospira_phage	27.5	1.2e-27
WP_160269676.1|1971152_1972580_+	8-oxoguanine deaminase	NA	NA	NA	NA	NA
WP_129447589.1|1972607_1973381_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	28.5	2.5e-09
WP_015375176.1|1973381_1974242_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015375177.1|1974451_1975483_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_160269677.1|1975819_1976425_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_150825557.1|1976446_1977538_-	XdhC family protein	NA	NA	NA	NA	NA
WP_015375189.1|1978653_1980018_-	allantoinase	NA	NA	NA	NA	NA
WP_033011705.1|1981105_1981651_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_033011707.1|1981803_1983057_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.3	1.2e-11
WP_064213564.1|1983049_1983850_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_160269679.1|1985180_1986419_-	allantoate amidohydrolase	NA	NA	NA	NA	NA
WP_160269680.1|1986605_1987280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160270627.1|1987454_1988828_-|transposase	IS1380-like element ISGsp2 family transposase	transposase	NA	NA	NA	NA
WP_160270689.1|1988928_1989906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160269682.1|1990089_1990233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160269684.1|1990524_1991958_+	allantoin permease	NA	NA	NA	NA	NA
WP_160269686.1|1992242_1993628_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_160269687.1|1994103_1995273_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	27.3	2.1e-23
WP_160269689.1|1996092_1996425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033017215.1|1996521_1997493_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_055358101.1|1997596_1998751_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_160268882.1|1999537_2000905_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_047758169.1|2001309_2002389_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_060788208.1|2002529_2003534_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	32.6	5.0e-34
WP_160269691.1|2003957_2004854_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_160269692.1|2005058_2005496_+	GNAT family N-acetyltransferase	NA	Q9AZG4	Lactococcus_phage	28.0	8.1e-05
WP_160269694.1|2005596_2006892_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_160269696.1|2007026_2007482_-	dehydratase	NA	NA	NA	NA	NA
WP_160269697.1|2007729_2008557_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_160269699.1|2008570_2009878_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_160269701.1|2010051_2011368_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_160269702.1|2011799_2012204_-	cytosolic protein	NA	NA	NA	NA	NA
WP_160270691.1|2012217_2013147_-	glutaminase A	NA	NA	NA	NA	NA
WP_160269704.1|2013307_2013883_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_049624783.1|2014018_2014480_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_160269706.1|2015002_2016175_-	8-amino-7-oxononanoate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	28.1	3.0e-38
WP_160269708.1|2016381_2016564_+	small acid-soluble spore protein H	NA	NA	NA	NA	NA
WP_049624781.1|2016546_2016750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160269709.1|2016842_2017211_-	glyoxalase	NA	NA	NA	NA	NA
WP_015375226.1|2017207_2017990_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_160269711.1|2018014_2018662_-	SdpI family protein	NA	NA	NA	NA	NA
WP_015375228.1|2018648_2018933_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_160269712.1|2019265_2020813_-	methylmalonyl-CoA decarboxylase	NA	NA	NA	NA	NA
WP_160270693.1|2020872_2021061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160269714.1|2021479_2021995_-	DoxX family protein	NA	NA	NA	NA	NA
WP_160269715.1|2022864_2024301_-	sodium/proline symporter	NA	NA	NA	NA	NA
WP_055358876.1|2024646_2025888_+	aminopeptidase	NA	NA	NA	NA	NA
WP_160269717.1|2026108_2028889_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_160269719.1|2029101_2029707_+|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	57.5	1.9e-52
2038746:2038764	attR	CACGCGCGACACGGTCGCC	NA	NA	NA	NA
>prophage 13
NZ_CP034952	Geobacillus stearothermophilus strain B5 chromosome, complete genome	3390870	2086331	2097267	3390870		Pandoravirus(25.0%)	13	NA	NA
WP_063330384.1|2086331_2087351_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	43.7	1.6e-67
WP_094238880.1|2087344_2088871_-	anthranilate synthase component I	NA	A0A0B5J984	Pandoravirus	40.4	2.8e-36
WP_033010070.1|2089101_2089482_-	chorismate mutase	NA	NA	NA	NA	NA
WP_160269744.1|2089363_2090578_-	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	32.5	9.1e-22
WP_033014001.1|2090580_2091747_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	36.5	1.2e-42
WP_049624819.1|2091846_2092617_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_033013999.1|2092689_2093139_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	46.2	5.4e-28
WP_033009740.1|2093237_2094200_-	Heptaprenyl diphosphate synthase component 2	NA	A0A1V0SE37	Indivirus	23.1	7.2e-06
WP_033009739.1|2094215_2094920_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_094238882.1|2094924_2095755_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_033013997.1|2096057_2096282_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_033013996.1|2096295_2096862_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	55.6	1.5e-48
WP_008879623.1|2096994_2097267_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	78.9	3.5e-30
>prophage 14
NZ_CP034952	Geobacillus stearothermophilus strain B5 chromosome, complete genome	3390870	2151689	2161793	3390870		Staphylococcus_phage(50.0%)	12	NA	NA
WP_160269774.1|2151689_2152835_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	34.4	1.0e-22
WP_160270703.1|2153259_2154516_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	44.1	4.5e-40
WP_160269776.1|2154700_2154826_+	DUF2935 domain-containing protein	NA	NA	NA	NA	NA
WP_160269778.1|2154925_2155330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033008290.1|2155376_2155991_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.7	3.5e-14
WP_160269780.1|2156317_2157079_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.9	9.4e-09
WP_160269782.1|2157322_2157835_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_033008266.1|2157886_2158237_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_033008265.1|2158348_2158813_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.1	5.2e-42
WP_094238909.1|2158832_2160026_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.3	7.4e-117
WP_033008263.1|2160048_2160693_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.6	5.7e-39
WP_160269783.1|2160695_2161793_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.6	3.0e-56
>prophage 15
NZ_CP034952	Geobacillus stearothermophilus strain B5 chromosome, complete genome	3390870	2670438	2794295	3390870	tRNA,protease,holin,transposase	Staphylococcus_phage(34.62%)	101	NA	NA
WP_160270067.1|2670438_2672856_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	74.6	0.0e+00
WP_094239112.1|2673216_2674416_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	46.7	1.0e-94
WP_033009817.1|2674531_2674696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033009819.1|2674828_2675092_-	YtzC family protein	NA	NA	NA	NA	NA
WP_044744757.1|2675548_2676136_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	47.3	3.8e-42
WP_160270068.1|2676193_2677276_-	tetraprenyl-beta-curcumene synthase family protein	NA	NA	NA	NA	NA
WP_160270070.1|2677495_2678038_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_160270071.1|2678106_2679318_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	75.4	1.6e-164
WP_160270073.1|2680030_2681617_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	64.0	1.4e-195
WP_160270075.1|2682708_2683989_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_160270076.1|2684254_2684464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160270078.1|2684460_2684868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160270079.1|2685133_2686381_+	MFS transporter	NA	NA	NA	NA	NA
WP_060788431.1|2686653_2687616_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033009830.1|2687849_2688092_-	DUF2584 domain-containing protein	NA	NA	NA	NA	NA
WP_049626452.1|2688160_2688949_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	36.9	7.4e-33
WP_160270081.1|2689241_2690249_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_160270082.1|2690264_2691056_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.0	7.2e-36
WP_094239124.1|2691039_2691849_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_094239125.1|2691964_2692432_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	39.0	2.7e-22
WP_094239126.1|2692490_2692823_-	hydrolase	NA	NA	NA	NA	NA
WP_094239127.1|2692881_2693277_-|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	48.7	8.3e-25
WP_011232333.1|2693429_2693870_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	67.8	9.5e-54
WP_011232335.1|2694204_2694681_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_160270084.1|2694942_2695188_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	60.0	8.5e-20
WP_160270086.1|2696105_2697092_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_160270087.1|2697764_2698244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033009850.1|2698260_2698551_-	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_080729586.1|2698730_2698892_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_033014606.1|2698958_2699159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150825924.1|2699190_2700672_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	33.1	4.8e-65
WP_033009854.1|2700861_2701680_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_160270089.1|2701680_2702568_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	E0YQD5	Mycobacterium_phage	32.3	1.0e-06
WP_160270091.1|2702488_2704237_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_160270093.1|2704229_2705603_-	isochorismate synthase	NA	S4VNU7	Pandoravirus	31.2	3.2e-15
WP_160270094.1|2705778_2706708_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_033011746.1|2706892_2707702_+	yteA family sporulation protein	NA	NA	NA	NA	NA
WP_160270096.1|2709170_2711570_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	45.0	1.6e-09
WP_160270097.1|2711556_2713014_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_160270099.1|2713010_2714042_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_160270100.1|2714041_2715205_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_160270102.1|2715086_2717129_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_033016377.1|2717305_2718256_+	cation transporter	NA	NA	NA	NA	NA
WP_160270104.1|2718298_2720047_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	44.9	6.4e-61
WP_033016374.1|2720397_2721024_+	LysE family translocator	NA	NA	NA	NA	NA
WP_033016373.1|2721060_2721288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160270105.1|2721372_2722005_-	LysE family translocator	NA	NA	NA	NA	NA
WP_160270107.1|2724986_2725448_+	hypothetical protein	NA	A0A1S5SAB0	Streptococcus_phage	36.1	1.0e-13
WP_160270108.1|2725942_2726497_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_160270110.1|2726890_2728129_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_160270111.1|2728376_2729510_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_160270113.1|2729563_2729950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160270115.1|2730061_2730268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094239293.1|2730896_2732264_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_160270117.1|2732425_2733517_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_160269580.1|2733604_2735053_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_160270119.1|2736368_2737724_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	26.2	1.4e-15
WP_160269580.1|2737945_2739394_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_160270120.1|2739574_2740684_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_160270122.1|2741308_2742109_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_033017076.1|2742101_2743355_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.6	6.3e-10
WP_160270123.1|2743495_2744053_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_160270125.1|2744619_2745039_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_160270127.1|2745116_2745578_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_033010740.1|2753539_2754361_+	protein-glutamine gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_094239146.1|2754331_2755240_-	DMT family transporter	NA	NA	NA	NA	NA
WP_160270128.1|2755300_2755978_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	34.5	1.0e-14
WP_033010732.1|2756182_2757091_+	nuclease	NA	O64020	Bacillus_phage	44.3	1.2e-15
WP_033016279.1|2757214_2757466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160270130.1|2757522_2758023_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_160270132.1|2758043_2758322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160270134.1|2758598_2761781_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.1	1.8e-69
WP_033016280.1|2761992_2762181_-	H-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_050367737.1|2762293_2763289_+	potassium channel family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	44.4	6.8e-07
WP_033010726.1|2763285_2763690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033016353.1|2763935_2765285_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_160270136.1|2765949_2767113_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_033010722.1|2767268_2767502_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_033010720.1|2767564_2767924_-	general stress protein 13	NA	NA	NA	NA	NA
WP_160270137.1|2768272_2769445_-	aminotransferase	NA	NA	NA	NA	NA
WP_160270139.1|2769441_2769942_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_033010717.1|2769992_2770256_-	DUF1871 family protein	NA	NA	NA	NA	NA
WP_160270141.1|2770339_2771554_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_033010716.1|2771799_2772324_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_160270143.1|2772380_2772596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160270144.1|2772665_2773286_-	3'-5' exonuclease KapD	NA	NA	NA	NA	NA
WP_033016293.1|2773453_2773822_-	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
WP_033010711.1|2773799_2774081_-	Na(+)/H(+) antiporter subunit F1	NA	NA	NA	NA	NA
WP_160270146.1|2774077_2774554_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_160270148.1|2774560_2776033_-	Na+/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_033010707.1|2776025_2776367_-	Na(+)/H(+) antiporter subunit C	NA	NA	NA	NA	NA
WP_100659985.1|2776367_2776784_-	Na(+)/H(+) antiporter subunit B	NA	NA	NA	NA	NA
WP_160270149.1|2776776_2779173_-	Na+/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_025039422.1|2781223_2782024_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_033845209.1|2782016_2783267_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	27.1	7.4e-11
WP_025038985.1|2783957_2785463_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_021322668.1|2785459_2786212_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	43.2	1.2e-40
WP_128721765.1|2787360_2788668_+	MFS transporter	NA	NA	NA	NA	NA
WP_021322671.1|2788664_2789252_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_119877844.1|2789338_2789572_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	45.5	4.6e-15
WP_160270151.1|2793416_2794295_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP034952	Geobacillus stearothermophilus strain B5 chromosome, complete genome	3390870	2869614	2926342	3390870	transposase,holin	Streptococcus_phage(28.57%)	51	NA	NA
WP_015864904.1|2869614_2870802_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_160270627.1|2871064_2872438_-|transposase	IS1380-like element ISGsp2 family transposase	transposase	NA	NA	NA	NA
WP_047817673.1|2872579_2873827_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	36.9	1.4e-62
WP_013144268.1|2875379_2875847_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	64.6	3.1e-47
WP_160270207.1|2875928_2878205_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.0	7.0e-92
WP_160270733.1|2878227_2878968_-	carboxylesterase	NA	NA	NA	NA	NA
WP_094239185.1|2879042_2879279_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_044743778.1|2879464_2879764_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_096226191.1|2880403_2880619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160270209.1|2880719_2882216_-	carboxylesterase/lipase family protein	NA	A0A0M4JT58	Mollivirus	29.3	6.6e-38
WP_063329589.1|2884106_2885399_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	72.9	8.4e-175
WP_094239189.1|2885427_2886963_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_160270210.1|2886955_2887717_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_160270212.1|2887778_2888963_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_033012085.1|2889084_2890092_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_100659546.1|2890134_2891154_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_033006443.1|2891276_2891522_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_160270214.1|2891551_2892859_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_015375785.1|2893384_2893549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160270216.1|2894203_2894794_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	53.8	1.8e-52
WP_015375787.1|2894920_2895178_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_033012071.1|2895192_2896155_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.6	6.1e-53
WP_094239193.1|2896292_2897246_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	1.2e-64
WP_160270218.1|2897242_2898139_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.5	3.0e-06
WP_080729669.1|2898157_2898643_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_160268882.1|2898850_2900218_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_160270219.1|2900648_2901605_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	56.4	7.3e-91
WP_160270221.1|2901680_2903150_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_160270223.1|2903134_2903281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061580755.1|2903428_2904076_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_160270225.1|2904072_2904831_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_160270226.1|2904827_2905562_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_160270228.1|2905561_2906203_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_160270230.1|2906428_2907016_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_160270232.1|2907019_2908294_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_160270234.1|2908430_2909054_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_050367794.1|2909229_2910405_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_160270236.1|2910472_2910622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094239994.1|2912429_2912927_-	acyltransferase	NA	NA	NA	NA	NA
WP_015375800.1|2912947_2913592_-	pyrophosphatase PpaX	NA	M1HHJ7	Acanthocystis_turfacea_Chlorella_virus	22.8	2.6e-07
WP_033012050.1|2913588_2914527_-	membrane protein	NA	NA	NA	NA	NA
WP_160270237.1|2914756_2915569_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_160270239.1|2915649_2916585_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_023633682.1|2916815_2917178_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_160270240.1|2917280_2917607_-	DUF4870 domain-containing protein	NA	A0A2H4JDX0	uncultured_Caudovirales_phage	32.1	2.7e-05
WP_160270734.1|2917735_2920594_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	58.0	0.0e+00
WP_160270242.1|2920610_2922587_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_033012047.1|2922762_2922984_-	CsbA family protein	NA	NA	NA	NA	NA
WP_160270244.1|2922998_2924171_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_160270245.1|2924391_2924934_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160270247.1|2925232_2926342_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	47.0	1.3e-83
>prophage 17
NZ_CP034952	Geobacillus stearothermophilus strain B5 chromosome, complete genome	3390870	2946359	2970541	3390870	transposase,protease,integrase	Enterococcus_phage(25.0%)	19	2950365:2950424	2970646:2971682
WP_160268882.1|2946359_2947727_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_160270270.1|2947890_2948745_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_160270272.1|2948928_2950038_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	48.6	9.0e-85
2950365:2950424	attL	AGTAAATTTTCATGTCCTTGCTACCATCTGAATACAATTTACAGAAAAGGTCCATGGGCA	NA	NA	NA	NA
WP_063210726.1|2950596_2951136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160270274.1|2951132_2951405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160270275.1|2951474_2952920_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_155836653.1|2953139_2953595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160270277.1|2957058_2957199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160269580.1|2957267_2958716_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_008881770.1|2958990_2959998_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_060476008.1|2960235_2961150_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	24.8	2.6e-13
WP_011231214.1|2961533_2962412_+|transposase	IS982-like element ISGsp1 family transposase	transposase	NA	NA	NA	NA
WP_160270279.1|2963008_2963530_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_160269060.1|2963615_2964791_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_062898466.1|2965245_2966694_-|transposase	IS66-like element ISBst12 family transposase	transposase	NA	NA	NA	NA
WP_160270281.1|2966752_2966926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160270282.1|2966922_2968080_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	40.1	6.0e-31
WP_160270284.1|2968103_2968991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160270285.1|2969350_2970541_-|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	24.4	1.7e-28
2970646:2971682	attR	AGTAAATTTTCATGTCCTTGCTACCATCTGAATACAATTTACAGAAAAGGTCCATGGGCAACGTTTTGCCCTCCACTCGGGCATGAAAATCACCACTCACCAACGTGGGATTTTCACGGAAAATGTTTCGTATATCGTTTGTTTCATCGTTATTTTCTGACTCATCTACCCATTAGCCGCCAAATAAGATATAATAAAAAATGACAAATATTGTATAAAGGAGAGTTTGTAAATGGGAATGGAGAATTTAGAAGAATTTTTGAAAAGAAAAAAGAAAGACGCCGAACAGAATAAAATCGATTGGGAACAGAGAAAACAGCAGTGGCTGGCGGAAATTGCAGAGTTTTATAATCAAGTTAAAGCATTTCTTGCACCCCTTCAAGAAAAAGGGCTGCTGTCTTTGAATTGGGAAGAAGTAAAAAAATATGAAGAATACCTTGGCGAATATACAACAAACAAATTATACGTAAACTTTCCTGATCAAAAAGTAGTCATAGAGCCAATTGGAAAAAATATTATAGGCGCTATGGGGAGGATAGATATGATTGGTAAAAATGGAAATATTACCTTTTTGTTAGTAGACAAAGAAGCAGAATCCCCAAAAATTATCGTTCATTTCAACGATGAACTGGCAAAAGGTTTAGAAAAAATTCGTGAAACGAAAAATCCCGAATATGTTTGGAAAATCGCAACTCCTCCCCCAAACATAAAATTTATTGACTTGAACAAAGATTCCTTTTCTGATGCTTTGTTAAAGGTCGTTGCTAAGTGAAGAAACGTATCACATTTTCGGGGGAGAATAGAAACCTTGAAGATATTGTGAGTTTTTATAATTTATGTAAAAGCGCGCTTTTAAAATACAAAGAAAATATCAAAAAAGGGTTGGAAATACCCGAAGAATTCATCGGCTTTACACCAGAAGAATTAGATCAGCATTTTAAAGACAAAATCGAAGAACTGGAAAATCTAATATGTTTAGACTTACTAGCAGCCGTGGAGGCAAAACTAAGAATGGACTATTTAACAAGAGTATATAA	NA	NA	NA	NA
>prophage 18
NZ_CP034952	Geobacillus stearothermophilus strain B5 chromosome, complete genome	3390870	2999265	3032009	3390870	transposase,protease	Pithovirus(25.0%)	20	NA	NA
WP_160270308.1|2999265_3001488_-|protease	trypsin-like serine protease	protease	W5SAB9	Pithovirus	27.3	2.6e-06
WP_160270310.1|3001770_3002454_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	28.1	7.4e-05
WP_094239240.1|3002471_3002840_+	DUF2304 domain-containing protein	NA	NA	NA	NA	NA
WP_094239241.1|3002826_3003195_+	EamA family transporter	NA	NA	NA	NA	NA
WP_094239242.1|3003218_3004475_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_160270311.1|3004497_3005709_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_160270313.1|3006148_3006817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160270315.1|3006831_3008037_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_160270316.1|3008172_3013917_-	amylopullulanase	NA	NA	NA	NA	NA
WP_160270318.1|3014326_3015985_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_160270319.1|3016160_3017102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160270321.1|3017583_3017928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050368442.1|3017953_3018364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160270322.1|3018557_3019088_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014195312.1|3019087_3019615_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	29.1	5.5e-08
WP_160270324.1|3020678_3021236_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_035180281.1|3022238_3022991_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	41.4	2.1e-37
WP_160270326.1|3022962_3024492_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_160270327.1|3027069_3030216_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_062898466.1|3030560_3032009_+|transposase	IS66-like element ISBst12 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP034952	Geobacillus stearothermophilus strain B5 chromosome, complete genome	3390870	3135755	3196228	3390870	transposase	Bacillus_virus(10.0%)	52	NA	NA
WP_013524772.1|3135755_3136649_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_160270408.1|3136849_3137782_-	DMT family transporter	NA	NA	NA	NA	NA
WP_160270410.1|3138051_3138525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160270411.1|3138567_3138771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160270413.1|3139012_3139510_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_160270415.1|3139681_3140620_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_013524778.1|3140767_3141226_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_160270416.1|3141239_3141848_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_157074369.1|3141828_3142077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160270418.1|3142218_3142608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160270420.1|3142620_3143541_-	ADP-ribosyl-[dinitrogen reductase] hydrolase	NA	G3M9X5	Bacillus_virus	50.2	3.0e-78
WP_160270421.1|3143638_3144385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035018403.1|3145421_3145694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160270423.1|3146192_3146531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063329480.1|3148137_3148392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160270425.1|3148864_3149047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160270426.1|3149119_3150886_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_063193417.1|3151140_3151593_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011888351.1|3151942_3152200_-	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_160270428.1|3152168_3152321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160269580.1|3153020_3154469_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_160270430.1|3154522_3155095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050367927.1|3155101_3155560_-	hypothetical protein	NA	Q24LG0	Clostridium_phage	33.1	5.1e-10
WP_050367928.1|3155566_3156178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160270431.1|3157157_3158684_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_160270433.1|3158840_3159149_+	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	43.5	3.1e-11
WP_160270435.1|3159237_3159474_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_160270437.1|3159756_3160857_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_066249340.1|3161047_3162097_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_160270438.1|3162113_3163529_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_015864904.1|3163713_3164901_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_160270746.1|3165035_3165683_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_160270451.1|3165861_3168261_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_160270453.1|3168447_3169743_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_160270455.1|3169778_3170264_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_160270457.1|3170349_3171387_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_160270458.1|3171823_3172777_-	sugar kinase	NA	NA	NA	NA	NA
WP_160270460.1|3172841_3173846_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015865166.1|3174699_3175920_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	33.2	1.1e-54
WP_160270748.1|3177308_3177776_-	VanZ family protein	NA	NA	NA	NA	NA
WP_160270750.1|3180095_3182426_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_160270462.1|3182994_3183456_-	VanZ family protein	NA	NA	NA	NA	NA
WP_160270464.1|3183843_3184815_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	41.1	2.7e-61
WP_160270465.1|3184829_3186572_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	51.9	5.6e-174
WP_160270467.1|3186750_3187839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160270469.1|3187896_3189285_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	28.8	5.5e-39
WP_160270470.1|3189341_3190667_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	44.0	2.8e-93
WP_160270751.1|3190686_3191922_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_160270753.1|3191921_3192365_-	colanic acid biosynthesis acetyltransferase WcaF	NA	NA	NA	NA	NA
WP_160270472.1|3192470_3193547_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_160270473.1|3194705_3195644_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.0	3.2e-14
WP_122983787.1|3195715_3196228_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.3	8.3e-09
>prophage 20
NZ_CP034952	Geobacillus stearothermophilus strain B5 chromosome, complete genome	3390870	3360662	3370534	3390870		uncultured_Mediterranean_phage(16.67%)	8	NA	NA
WP_160270764.1|3360662_3361880_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.4	1.0e-17
WP_160270587.1|3361981_3362776_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	36.5	1.5e-44
WP_095860160.1|3362782_3363568_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_160270588.1|3363554_3364883_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_160270589.1|3364875_3366705_-	cell wall metabolism sensor histidine kinase WalK	NA	A0A1V0SGX0	Hokovirus	27.0	9.5e-23
WP_160270590.1|3366711_3367425_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.3	2.6e-45
WP_033008881.1|3367730_3369017_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	36.1	1.7e-71
WP_033016901.1|3369169_3370534_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.8	4.2e-124
