The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040122	Klebsiella pneumoniae strain LSH-KPN148 chromosome, complete genome	5444919	450004	483262	5444919	integrase,tRNA,capsid,head,portal,tail,terminase,protease	uncultured_Caudovirales_phage(73.33%)	33	467612:467629	483607:483624
WP_002919147.1|450004_450952_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|450966_451476_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|451604_452729_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|452700_453174_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|453199_453742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|453746_454319_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|454322_455141_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|455137_455395_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|455370_455925_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|461720_461942_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|462235_465346_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|465358_466498_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|466876_467527_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
467612:467629	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|467802_469029_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|469121_470063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|470244_470529_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|470539_471319_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|471770_472040_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|472032_472221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|472213_472528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|472524_472893_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|472889_473255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|473254_475390_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|475732_476068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|476116_476629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|476892_478059_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|478110_478671_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|478672_479914_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|479910_480246_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|480242_480542_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|480541_480985_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|481260_481617_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|481600_483262_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
483607:483624	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP040122	Klebsiella pneumoniae strain LSH-KPN148 chromosome, complete genome	5444919	1220375	1269693	5444919	integrase,lysis,coat,tRNA,capsid,head,plate,portal,transposase,tail,terminase	Salmonella_phage(79.55%)	60	1205994:1206011	1249227:1249244
1205994:1206011	attL	CGGCAAAGAGGCGGGCGA	NA	NA	NA	NA
WP_062955148.1|1220375_1221374_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
WP_004151019.1|1221376_1222006_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1222128_1222371_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1222403_1222913_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1222920_1223121_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1223084_1223423_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1223490_1223724_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1223723_1223951_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1223947_1224799_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1224795_1227180_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004152765.1|1227660_1229145_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151011.1|1229252_1229441_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1229452_1229686_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1229781_1230465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1230451_1231531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1231530_1232532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1233053_1233323_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1233379_1234423_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1234422_1236186_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1236326_1237160_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1237176_1238229_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1238232_1238886_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1238981_1239446_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1239445_1239649_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1239652_1239868_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1239848_1240358_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1240362_1240746_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1240742_1241171_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150997.1|1241266_1241689_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1241681_1242128_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_000019473.1|1242812_1243793_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004150994.1|1244311_1244884_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1244880_1245243_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1245229_1246138_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1246130_1246802_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1246803_1248753_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1248762_1249881_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
1249227:1249244	attR	CGGCAAAGAGGCGGGCGA	NA	NA	NA	NA
WP_004150988.1|1249932_1251006_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1251154_1252327_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1252336_1252852_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1252904_1253204_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1253218_1253338_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150984.1|1253330_1255961_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_004150983.1|1255957_1256443_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1256439_1257534_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1257600_1257819_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1257846_1258224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1258827_1259310_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_004188817.1|1259420_1259897_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1259886_1260177_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1260243_1260585_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1260732_1262394_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1262480_1263359_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1263483_1264074_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1264193_1265480_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1265499_1266291_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1266454_1267819_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1268078_1268327_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1268345_1268894_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1268925_1269693_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP040122	Klebsiella pneumoniae strain LSH-KPN148 chromosome, complete genome	5444919	1366700	1427153	5444919	integrase,tRNA,transposase,holin,tail,terminase	Salmonella_phage(40.0%)	63	1351948:1351963	1411864:1411879
1351948:1351963	attL	CGTGATGATGCCGGCC	NA	NA	NA	NA
WP_004149335.1|1366700_1367975_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913890.1|1368009_1368630_+	YfgM family protein	NA	NA	NA	NA	NA
WP_002913889.1|1368640_1369819_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_002913888.1|1369932_1371411_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_004151982.1|1371528_1372608_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004144303.1|1372657_1372876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151981.1|1372859_1374251_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
WP_004151980.1|1374409_1375876_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1375943_1377521_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_062955102.1|1377712_1378963_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
WP_063002073.1|1378905_1379148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197356.1|1379144_1379738_-	MT-A70 family protein	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
WP_062955103.1|1379734_1380397_-	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
WP_048264082.1|1380393_1380552_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
WP_009485475.1|1380544_1380838_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_062955104.1|1380947_1381196_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
WP_062955105.1|1381244_1382126_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
WP_062955106.1|1382122_1382944_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
WP_004164029.1|1382940_1383240_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004144290.1|1383606_1384188_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004152538.1|1384342_1384576_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1384722_1384932_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1384931_1385699_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|1385695_1386481_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_048328152.1|1386600_1386948_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
WP_062955107.1|1387140_1387551_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
WP_032441402.1|1387534_1387726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441401.1|1387722_1388367_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_072200041.1|1388660_1389128_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
WP_029602865.1|1389127_1389421_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_050491799.1|1389417_1390038_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
WP_032441458.1|1390037_1390241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023339258.1|1390233_1390572_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_032418540.1|1392557_1392815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441400.1|1392892_1393477_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
WP_062955142.1|1393473_1394949_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	6.4e-280
WP_004200550.1|1394992_1395364_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
WP_004141368.1|1396117_1396324_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_032441398.1|1396338_1398021_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
WP_004152446.1|1398017_1398314_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_032441397.1|1398316_1398997_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
WP_004200546.1|1399011_1399998_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_020953461.1|1400051_1400489_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
WP_062955141.1|1400499_1400841_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
WP_004152441.1|1400891_1401215_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_062955139.1|1401214_1401820_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
WP_062955138.1|1401819_1404297_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
WP_004152438.1|1404296_1404761_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_032447858.1|1404760_1405300_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
WP_062955137.1|1405310_1407845_+	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
WP_062955136.1|1407844_1409755_+	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
WP_062955135.1|1409754_1412511_+	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
1411864:1411879	attR	CGTGATGATGCCGGCC	NA	NA	NA	NA
WP_062955133.1|1412987_1413284_-	hypothetical protein	NA	T1SA06	Salmonella_phage	63.9	6.9e-24
WP_062955131.1|1416111_1416375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153233543.1|1416415_1417681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073547080.1|1417662_1418643_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
WP_000608644.1|1419511_1420774_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_077265603.1|1421882_1423199_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
WP_062955010.1|1423285_1423690_+	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
WP_023339240.1|1423676_1423982_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_062955009.1|1423971_1424601_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_062955008.1|1424597_1425098_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
WP_004152009.1|1425284_1427153_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
NZ_CP040122	Klebsiella pneumoniae strain LSH-KPN148 chromosome, complete genome	5444919	1757335	1764241	5444919	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1757335_1758199_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|1758209_1758983_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|1759224_1760118_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1760363_1761725_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1762043_1762766_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_062955084.1|1762762_1764241_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 5
NZ_CP040122	Klebsiella pneumoniae strain LSH-KPN148 chromosome, complete genome	5444919	1806606	1815254	5444919		Enterobacteria_phage(50.0%)	7	NA	NA
WP_062955056.1|1806606_1807671_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	4.4e-105
WP_062956182.1|1807684_1808554_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	3.4e-111
WP_004175260.1|1809496_1810051_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_000704907.1|1810230_1811397_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_016947628.1|1811825_1811945_-	small membrane protein	NA	NA	NA	NA	NA
WP_062955151.1|1812345_1813350_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	4.0e-31
WP_073547076.1|1814189_1815254_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.6e-105
>prophage 6
NZ_CP040122	Klebsiella pneumoniae strain LSH-KPN148 chromosome, complete genome	5444919	1953897	1992363	5444919	integrase,terminase	uncultured_Caudovirales_phage(34.04%)	56	1951978:1951992	1960918:1960932
1951978:1951992	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152144.1|1953897_1954659_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|1954875_1956408_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|1956606_1957155_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|1957351_1958533_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|1958513_1958756_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152149.1|1958934_1959414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|1959410_1959623_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|1959619_1959844_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|1959833_1960544_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|1960549_1961068_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
1960918:1960932	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|1961172_1962000_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|1961996_1962191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|1962187_1962613_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|1962609_1962828_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|1962799_1963054_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|1963046_1963412_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|1963581_1963770_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|1963762_1964077_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|1964247_1964916_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|1965013_1965235_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|1965811_1967470_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|1967471_1968434_+	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|1968430_1968907_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|1968903_1969686_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004146526.1|1970091_1970340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152169.1|1970342_1970873_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|1970869_1971259_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|1971493_1971814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152171.1|1971915_1972668_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152172.1|1972618_1974019_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|1974256_1975708_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|1975763_1976312_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|1976363_1977566_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|1977569_1978064_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|1978075_1979017_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|1979056_1979338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|1979306_1979726_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|1979722_1980229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|1980228_1980615_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|1980709_1981150_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|1981153_1982299_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004199809.1|1982309_1982750_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152564.1|1982753_1983179_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|1983214_1983367_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|1983356_1985360_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|1985359_1985959_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152568.1|1985959_1986262_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152569.1|1986264_1987287_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|1987286_1987628_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|1987677_1987860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|1987902_1988469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|1988522_1989176_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|1989177_1989531_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|1989530_1990727_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|1990723_1991497_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|1991496_1992363_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
>prophage 7
NZ_CP040122	Klebsiella pneumoniae strain LSH-KPN148 chromosome, complete genome	5444919	2221989	2232863	5444919		Escherichia_phage(85.71%)	8	NA	NA
WP_002210516.1|2221989_2222610_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151610.1|2223866_2224769_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|2225029_2225791_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|2225811_2226672_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|2226969_2227230_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|2227316_2228405_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|2228435_2229701_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151613.1|2229755_2232863_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 8
NZ_CP040122	Klebsiella pneumoniae strain LSH-KPN148 chromosome, complete genome	5444919	3089499	3155506	5444919	integrase,holin,transposase	Enterobacteria_phage(31.43%)	65	3118092:3118109	3158526:3158543
WP_000019473.1|3089499_3090480_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_101311855.1|3090703_3091327_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_004141144.1|3091359_3091557_-	protein DsrB	NA	NA	NA	NA	NA
WP_004151458.1|3091681_3091906_+	YodD family protein	NA	NA	NA	NA	NA
WP_024622768.1|3092205_3093885_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	6.9e-20
WP_002911591.1|3094000_3094912_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_016529443.1|3095095_3096007_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_004200342.1|3095981_3096476_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	5.7e-31
WP_062955025.1|3096456_3097890_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	6.8e-101
WP_002911594.1|3097933_3098641_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_004151461.1|3098683_3098965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002911596.1|3099503_3100649_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
WP_002911599.1|3101104_3101902_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_009484428.1|3102487_3103183_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004227147.1|3103561_3104503_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004175385.1|3104581_3105532_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_002911729.1|3105638_3106556_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_004148971.1|3107056_3108691_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_004175384.1|3109282_3109987_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151466.1|3109983_3110961_+	oxidoreductase	NA	NA	NA	NA	NA
WP_020723560.1|3111081_3112014_+	nucleoside recognition family protein	NA	NA	NA	NA	NA
WP_023278836.1|3111924_3113547_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_004141189.1|3113819_3114065_+	signal transduction protein PmrD	NA	NA	NA	NA	NA
WP_004148975.1|3114194_3115649_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_004151469.1|3116014_3117451_-	EmmdR/YeeO family multidrug/toxin efflux MATE transporter	NA	NA	NA	NA	NA
WP_000059623.1|3117880_3119143_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.3	4.8e-74
3118092:3118109	attL	TCCGTAAAATGCTGGCGC	NA	NA	NA	NA
WP_000703040.1|3119336_3120641_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_001286280.1|3120668_3121949_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_001446633.1|3121941_3123744_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.6	2.1e-22
WP_000098391.1|3123730_3125533_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	1.1e-31
WP_000140406.1|3125699_3126659_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_001067855.1|3131623_3132328_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_062955100.1|3132364_3132652_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	95.4	4.4e-36
WP_004218565.1|3132648_3133188_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|3133184_3133484_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_086528966.1|3134268_3135192_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	97.7	6.6e-174
WP_004232548.1|3136300_3136990_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3136989_3137130_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3137126_3137765_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3137757_3138426_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3138422_3138590_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3138570_3139038_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004218530.1|3139558_3140587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3140794_3141040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3141095_3141398_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3141394_3142243_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3142239_3143100_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3143185_3143407_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3143447_3143675_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3143786_3144485_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_019405077.1|3144507_3144627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|3144831_3145812_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_004201109.1|3145972_3147049_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3147130_3147334_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004135674.1|3147762_3147957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3148045_3148330_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3148345_3149191_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|3149187_3149475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|3149476_3150157_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3150153_3150582_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3150578_3151241_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004153574.1|3151448_3152636_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|3152812_3153703_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004140266.1|3153702_3154695_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3154696_3155506_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
3158526:3158543	attR	TCCGTAAAATGCTGGCGC	NA	NA	NA	NA
>prophage 9
NZ_CP040122	Klebsiella pneumoniae strain LSH-KPN148 chromosome, complete genome	5444919	3283180	3374073	5444919	lysis,integrase,tRNA,capsid,head,portal,transposase,tail,terminase	Klebsiella_phage(43.18%)	93	3309983:3309997	3371884:3371898
WP_002901088.1|3283180_3283681_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3283797_3284244_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3284227_3285019_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150777.1|3285120_3286305_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3286336_3287029_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|3287174_3287684_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3287670_3288027_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004150780.1|3288016_3288256_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150781.1|3288556_3289570_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150782.1|3289627_3289729_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_099119317.1|3289728_3289803_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3289920_3290046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3290105_3290369_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3290499_3291138_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3291227_3292142_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150784.1|3292803_3293847_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004150785.1|3294149_3295358_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150787.1|3295431_3297216_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3297222_3298113_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3298233_3299742_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|3300052_3300739_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_153233540.1|3301188_3301377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3301355_3301988_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3302554_3302752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|3302867_3303878_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004150793.1|3303874_3305281_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3305336_3306224_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3306240_3306747_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150794.1|3306773_3307268_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3307358_3307544_-	general stress protein	NA	NA	NA	NA	NA
WP_004140529.1|3308165_3309359_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3309471_3309699_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
3309983:3309997	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
WP_004150797.1|3310135_3310459_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3310451_3310844_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|3310840_3311554_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3311826_3311979_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_023328083.1|3312133_3313630_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
WP_160242246.1|3313698_3326403_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
WP_023328085.1|3326465_3327059_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
WP_047666390.1|3327085_3327508_-	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
WP_047666389.1|3327549_3328260_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
WP_023328087.1|3328261_3329017_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
WP_023328088.1|3329013_3329352_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
WP_023328089.1|3329351_3332687_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
WP_014228914.1|3332919_3333285_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_023328090.1|3333342_3333804_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_023328091.1|3333835_3334237_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
WP_017880258.1|3334233_3334623_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_023328092.1|3334603_3334942_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
WP_020317538.1|3334938_3335256_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_049010370.1|3335236_3335497_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
WP_023328094.1|3335555_3336842_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
WP_014907815.1|3336919_3337840_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_023279520.1|3337876_3339136_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
WP_017898992.1|3339135_3339315_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_021462603.1|3339308_3341030_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
WP_012542168.1|3341029_3341464_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014907818.1|3341712_3342144_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_023297386.1|3342140_3342464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|3342415_3342778_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_032749552.1|3343104_3343329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049115059.1|3343367_3343805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160650.1|3344754_3345105_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_032432826.1|3345101_3345599_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
WP_016160648.1|3345598_3345814_-|lysis	phage S lysis protein	lysis	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_004147999.1|3346731_3346881_+	small membrane protein	NA	NA	NA	NA	NA
WP_004147997.1|3347618_3347822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025861432.1|3348065_3348668_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
WP_062955112.1|3348684_3349716_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
WP_025861428.1|3349915_3350308_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_077255782.1|3350348_3350639_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
WP_025368263.1|3350650_3350884_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
WP_062954975.1|3353290_3354652_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_004152765.1|3355576_3357061_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_109042640.1|3357507_3358554_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_062954989.1|3358901_3359771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062954977.1|3359859_3361251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032443841.1|3361599_3362040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047667474.1|3362053_3362518_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
WP_077265602.1|3362510_3363515_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.0e-31
WP_046622349.1|3363574_3364129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071561166.1|3364131_3364356_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
WP_077257742.1|3364444_3364882_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
WP_040234937.1|3365203_3365518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279538.1|3365908_3366103_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3366145_3366490_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_062954978.1|3366631_3368770_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
WP_012542206.1|3368822_3369068_+	excisionase	NA	NA	NA	NA	NA
WP_032418030.1|3369048_3370176_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	4.4e-119
WP_004150800.1|3370293_3371544_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|3371784_3372435_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3371884:3371898	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
WP_004150802.1|3372451_3372910_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3372966_3374073_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP040122	Klebsiella pneumoniae strain LSH-KPN148 chromosome, complete genome	5444919	3590415	3683366	5444919	lysis,integrase,tRNA,capsid,head,plate,portal,tail,terminase,protease	Salmonella_phage(56.9%)	93	3645941:3645959	3683441:3683459
WP_002898139.1|3590415_3591708_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3591798_3593142_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3593150_3593762_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3593884_3598138_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3598273_3598768_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|3599273_3600269_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|3600383_3602150_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3602150_3603872_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3603916_3604618_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3604971_3605190_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3605310_3607590_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3607620_3607938_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3608263_3608485_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3608561_3610502_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3610498_3611614_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3611760_3613419_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3613838_3614534_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3614649_3615549_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3615692_3617345_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3617355_3618324_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3618535_3618970_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3619121_3620840_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3620878_3621880_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3621890_3623333_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3623420_3624434_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3624430_3625261_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3625292_3626432_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3627309_3627825_+	lipoprotein	NA	NA	NA	NA	NA
WP_032419144.1|3628051_3628780_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3628800_3629532_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3629538_3630255_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3630254_3630923_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3631106_3631838_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3631880_3633353_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3633349_3634066_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3634144_3635272_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3635313_3635802_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3635859_3636705_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3636701_3637655_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3637665_3638799_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3638962_3640075_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3640423_3640903_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3640991_3641894_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3642715_3643003_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3643205_3643469_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3643475_3643859_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3644125_3645811_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3645941:3645959	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3646030_3646249_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3646340_3647441_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3647437_3647923_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3647919_3650547_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3650539_3650659_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3650673_3650973_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3651025_3651541_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3651550_3652723_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3652861_3653938_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3653967_3654171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3654167_3654899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3654902_3657854_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3657855_3658455_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3658447_3659356_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_032441567.1|3659342_3659705_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896177.1|3659701_3660274_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3660368_3661061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3661057_3661504_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3661496_3661928_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|3662023_3662452_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3662448_3662832_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3662836_3663346_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3663326_3663542_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3663545_3663749_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3663748_3664213_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3664308_3664959_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3664962_3666021_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3666037_3666871_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3667013_3668780_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3668779_3669805_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3669866_3671609_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3671884_3672562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3672676_3672910_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3672920_3673109_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3673262_3675677_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3675673_3676531_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3676527_3676755_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3676754_3676988_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3677055_3677397_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3677360_3677561_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3677568_3678078_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3678110_3678332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3678477_3679356_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3679367_3680312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|3680410_3681895_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151720.1|3682313_3683366_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3683441:3683459	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 11
NZ_CP040122	Klebsiella pneumoniae strain LSH-KPN148 chromosome, complete genome	5444919	4336216	4348935	5444919	integrase,transposase	Enterobacteria_phage(63.64%)	14	4336666:4336680	4360788:4360802
WP_004144574.1|4336216_4337320_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4336666:4336680	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4337330_4338584_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4338936_4340127_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4340114_4341065_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4341064_4341490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086528966.1|4341727_4342651_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	97.7	6.6e-174
WP_004152202.1|4343123_4343690_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|4343707_4343953_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_062956184.1|4343949_4344687_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
WP_002889915.1|4345228_4345495_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4345491_4346049_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4346045_4346273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4346269_4346590_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4346601_4348935_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4360788:4360802	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 12
NZ_CP040122	Klebsiella pneumoniae strain LSH-KPN148 chromosome, complete genome	5444919	4817070	4826595	5444919	transposase	Enterobacteria_phage(83.33%)	10	NA	NA
WP_004152207.1|4817070_4819404_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4819418_4819739_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4819735_4819963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153681.1|4819959_4820508_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152204.1|4821331_4822069_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4822065_4822311_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4822328_4822895_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152201.1|4823635_4824715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152200.1|4824715_4825252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|4825614_4826595_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 1
NZ_CP040123	Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence	227415	40167	78615	227415	transposase,integrase	Macacine_betaherpesvirus(22.22%)	33	49664:49681	78675:78692
WP_085955172.1|40167_41374_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178088.1|42414_44412_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_004152070.1|44474_45752_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_080895248.1|46733_48170_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004197688.1|48789_49047_+	hypothetical protein	NA	NA	NA	NA	NA
49664:49681	attL	GGCTTTGTTGAATAAATC	NA	NA	NA	NA
WP_004152067.1|49719_50643_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_071527918.1|50707_51019_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152065.1|51045_51993_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_001515717.1|53136_53877_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152063.1|54593_55604_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	55.9	8.8e-87
WP_000523813.1|56355_57522_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
WP_004152062.1|57521_58493_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
WP_004152715.1|61401_62673_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
WP_004178083.1|62672_63098_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
WP_004152765.1|63503_64988_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152753.1|65221_65452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118478.1|65972_66398_+	antirestriction protein	NA	NA	NA	NA	NA
WP_004152754.1|66634_66889_+	hypothetical protein	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
WP_004118473.1|66923_67241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178072.1|68022_68250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198570.1|68341_68572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178068.1|68623_69979_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_004152645.1|70026_70590_+	methyltransferase	NA	A8HNV9	Thalassomonas_phage	34.1	1.3e-18
WP_004152644.1|71365_71908_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	6.0e-50
WP_004152643.1|71956_72205_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_004178066.1|72274_74311_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.0	9.0e-22
WP_004152641.1|74377_74809_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_004152640.1|74805_75534_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_004152639.1|75530_75857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023280872.1|75912_76287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009310022.1|76487_76997_+|transposase	IS3 family transposase	transposase	A0A2I6AZV8	Macacine_betaherpesvirus	58.7	6.9e-48
WP_116973160.1|76951_77650_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.9	3.8e-49
WP_086528966.1|77691_78615_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	97.7	6.6e-174
78675:78692	attR	GATTTATTCAACAAAGCC	NA	NA	NA	NA
>prophage 2
NZ_CP040123	Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence	227415	82958	145087	227415	transposase	Escherichia_phage(26.92%)	72	NA	NA
WP_013609528.1|82958_84032_-|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
WP_014343509.1|84103_84262_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_023287105.1|84959_85232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023287104.1|85228_85579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019706019.1|86210_86567_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	4.4e-25
WP_019706020.1|86627_86840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343499.1|86850_87075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152720.1|87155_87476_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_004152721.1|87465_87744_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_023287139.1|87744_88158_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032441618.1|88987_89809_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
WP_001568110.1|89856_90171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015065525.1|90203_90689_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_013214017.1|91112_91496_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_013214018.1|91695_92433_+	conjugal transfer protein TrbJ	NA	NA	NA	NA	NA
WP_004144426.1|92583_92754_+	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_004194426.1|92815_93184_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_004144424.1|93197_93503_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_004144423.1|93522_94089_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_013214019.1|94075_94816_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_023287137.1|94815_96240_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_023287136.1|96312_96897_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_004195468.1|97219_97438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013214022.1|97438_97750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197817.1|97816_98221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013214023.1|98603_98996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013214024.1|99067_101707_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_013214025.1|101706_102096_+	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_013214026.1|102095_102731_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_004194979.1|102765_103167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013214027.1|103163_104153_+	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_004193871.1|104165_104804_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_014343489.1|104862_106818_+	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_004152674.1|106849_107104_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_013214029.1|107081_107330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013214030.1|107342_107669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152677.1|107689_108442_+	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_004144400.1|108452_108692_+	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_013214031.1|108663_109221_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_013214032.1|109266_109710_+	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_013214033.1|109699_111067_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_001067855.1|112994_113699_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014343468.1|113738_114212_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
WP_013213985.1|114334_115315_+|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
WP_004199234.1|115590_116472_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_013213989.1|118331_118757_-	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
WP_013213990.1|118867_119146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161490.1|120688_121249_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_160242280.1|121252_124219_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	99.9	0.0e+00
WP_002904004.1|124459_125320_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|125340_126102_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|126363_127266_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_001067855.1|128899_129604_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_042934582.1|130072_130630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|131281_132262_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_015493087.1|132775_133171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493086.1|133167_133779_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_015493085.1|133775_134726_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.6	6.6e-76
WP_040219232.1|134872_135073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652286.1|135126_135759_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
WP_015493083.1|136121_137327_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
WP_016479949.1|137323_138295_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
WP_015493081.1|138430_139702_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
WP_015493080.1|139701_140124_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_015493079.1|140303_140975_-	Gifsy-2 prophage protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
WP_002211749.1|141333_142011_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_015493077.1|142010_142232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493076.1|142242_142662_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_015493075.1|142715_143495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493074.1|143899_144406_+	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
WP_015493073.1|144448_144640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032072906.1|144826_145087_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	4.1e-12
>prophage 3
NZ_CP040123	Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence	227415	151440	209711	227415	transposase,integrase	Escherichia_phage(41.18%)	50	151378:151437	178622:179441
151378:151437	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|151440_152145_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_160242283.1|152035_152551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|152604_153024_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568042.1|153033_153255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|153254_153956_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
WP_001568040.1|154392_154623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214012.1|154685_155357_-	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_004152353.1|155359_156331_-	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152765.1|156579_158064_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001568036.1|158473_158905_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_013214011.1|158904_160176_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
WP_086523286.1|160257_161235_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
WP_011977818.1|161231_162437_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_004118283.1|163547_164414_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_013214010.1|165191_165449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013214009.1|165494_166274_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
WP_011977814.1|166457_167462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977813.1|167491_167695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214008.1|167740_168262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032738650.1|168319_168670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977810.1|168748_169693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|170271_170502_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|170498_170915_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004206609.1|170988_172551_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361404.1|172535_173558_+	helicase UvrD	NA	NA	NA	NA	NA
WP_000427619.1|175091_176096_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|178684_179389_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_009310009.1|179818_180574_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
178622:179441	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
WP_013214044.1|180570_183855_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.6	4.3e-66
WP_001459731.1|183907_184591_-	YecA family protein	NA	NA	NA	NA	NA
WP_023280885.1|184587_185862_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013214042.1|185851_187375_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.7	7.0e-88
WP_004199370.1|188507_189104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152380.1|189270_189864_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_013214040.1|189935_190661_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.3	7.1e-06
WP_043907038.1|190741_196000_-	conjugative transfer relaxase/helicase TraI	NA	A0A1P8DII4	Virus_Rctr197k	33.3	6.8e-05
WP_013214038.1|195999_198312_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_017900859.1|198438_198822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214036.1|199320_200052_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_013214035.1|200302_200905_-	conjugal transfer protein TraS	NA	NA	NA	NA	NA
WP_001067855.1|201945_202650_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000204520.1|203961_204669_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|204665_204902_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|204898_205261_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|205278_206973_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|207024_207447_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|207482_207758_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|207771_208122_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|208193_208628_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427619.1|208706_209711_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP040123	Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence	227415	215072	221249	227415	bacteriocin,transposase	Stx2-converting_phage(50.0%)	7	NA	NA
WP_001067855.1|215072_215777_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_053897648.1|215801_217358_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.1e-83
WP_013213996.1|217762_218314_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	6.2e-18
WP_099459485.1|218543_218801_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_004201219.1|218913_220452_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
WP_000612626.1|220500_220848_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_003031976.1|220844_221249_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
>prophage 1
NZ_CP040124	Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-2, complete sequence	72060	22093	48340	72060	transposase,protease	Escherichia_phage(75.0%)	24	NA	NA
WP_001067855.1|22093_22798_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_131135869.1|24548_25472_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	4.1e-176
WP_013188475.1|25551_26427_-	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_001067855.1|26937_27642_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001398199.1|28952_29354_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|29286_29544_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|29636_30290_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_032495102.1|31228_32086_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001375168.1|32078_32153_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083837.1|32397_32646_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001312851.1|32929_33079_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001736714.1|33383_33614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032083981.1|33777_34377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015059022.1|34762_34963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139328.1|35094_35655_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000205770.1|35709_36456_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	4.2e-09
WP_001067855.1|36700_37405_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000009363.1|37475_39701_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_015059020.1|39751_40489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021559024.1|40691_41423_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_000632668.1|41447_41969_-	conjugal transfer entry exclusion protein TraS	NA	NA	NA	NA	NA
WP_015059018.1|42001_44818_-	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_001067855.1|45820_46525_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|47635_48340_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
