The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	0	12153	4829265	tail,portal,terminase	Escherichia_phage(71.43%)	7	NA	NA
WP_160268018.1|0_2283_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.4	0.0e+00
WP_000038161.1|4575_5610_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_001333118.1|5609_5879_-|terminase	terminase	terminase	A0A0F7LCM8	Escherichia_phage	100.0	9.6e-41
WP_025693440.1|7608_8088_+|tail	phage tail protein	tail	M1TAU1	Escherichia_phage	98.7	3.3e-84
WP_025693441.1|8087_9251_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	2.4e-205
WP_000468308.1|9332_9551_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292822.1|9870_12153_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 2
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	16251	17340	4829265		Streptococcus_phage(100.0%)	1	NA	NA
WP_085452643.1|16251_17340_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	5.4e-82
>prophage 3
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	22426	26968	4829265		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|22426_22711_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_077491374.1|22918_25183_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|25219_26968_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 4
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	41673	52641	4829265	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|41673_42222_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_077492850.1|42248_42896_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_077492851.1|43117_44308_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_077492852.1|44492_45581_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.5	3.7e-99
WP_000117881.1|46181_47582_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001297200.1|47750_48953_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193841.1|49218_51831_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001090506.1|51873_52641_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 5
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	68558	70466	4829265		Tupanvirus(100.0%)	1	NA	NA
WP_000053089.1|68558_70466_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.4e-53
>prophage 6
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	83076	85131	4829265		Bacillus_phage(100.0%)	1	NA	NA
WP_000420536.1|83076_85131_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 7
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	89364	90024	4829265	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|89364_90024_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 8
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	110066	122381	4829265		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|110066_110279_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|110289_110478_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|110452_110683_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|110672_110846_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_085452645.1|110894_111968_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_077492722.1|112039_114784_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_001264933.1|114866_115895_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|115867_116560_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|116689_117862_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_077491981.1|117861_120408_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.4	5.3e-72
WP_000209868.1|120404_121004_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|121155_121461_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420621.1|121460_122381_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 9
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	126680	128955	4829265		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|126680_126854_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001301229.1|127111_128440_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	1.3e-234
WP_001028095.1|128460_128955_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 10
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	143592	144657	4829265		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258765.1|143592_144657_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 11
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	151476	154038	4829265	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_000409883.1|151476_152835_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
WP_085947771.1|152875_154038_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 12
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	157552	158386	4829265		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|157552_158386_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 13
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	162521	163055	4829265		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|162521_163055_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 14
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	172363	173284	4829265		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|172363_173284_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 15
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	177946	178192	4829265		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|177946_178192_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 16
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	194075	195017	4829265		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001721266.1|194075_195017_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 17
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	207374	208556	4829265		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|207374_208109_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|208319_208556_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 18
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	211828	213471	4829265		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|211828_212470_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267956.1|212466_213471_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	31.8	6.4e-05
>prophage 19
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	225794	226052	4829265		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|225794_226052_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 20
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	233341	237082	4829265		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033694.1|233341_234043_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
WP_001251348.1|234042_235287_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|235315_236227_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952737.1|236242_237082_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.7e-23
>prophage 21
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	240339	242317	4829265		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|240339_241197_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|241180_242317_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
>prophage 22
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	247338	248709	4829265		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423742.1|247338_248709_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
>prophage 23
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	251845	255577	4829265		Enterobacteria_phage(66.67%)	5	NA	NA
WP_077492725.1|251845_253096_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	1.9e-22
WP_077492726.1|253198_253522_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	66.4	6.1e-42
WP_032082692.1|254057_254168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|254220_254625_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332320.1|254845_255577_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	6.0e-53
>prophage 24
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	262650	263739	4829265		Escherichia_phage(100.0%)	1	NA	NA
WP_071524883.1|262650_263739_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	41.9	8.3e-75
>prophage 25
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	272272	273960	4829265		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|272272_272692_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457616.1|272691_273960_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 26
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	281623	282968	4829265	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_085955967.1|281623_282968_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.3	3.5e-75
>prophage 27
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	302052	304804	4829265		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|302052_303732_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|303856_304804_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 28
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	307940	314742	4829265		Pseudomonas_phage(33.33%)	9	NA	NA
WP_000804726.1|307940_309023_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456454.1|309022_309856_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200373.1|309852_310245_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|310248_311058_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|311093_311948_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000170951.1|312094_312202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170963.1|312629_312737_-	small toxic polypeptide LdrB	NA	NA	NA	NA	NA
WP_001295620.1|313141_314242_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146444.1|314511_314742_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 29
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	325874	336594	4829265		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|325874_327413_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|327409_328120_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|328119_328797_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|330231_331074_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001362540.1|331123_331582_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001295622.1|331694_332600_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|332691_333705_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|333906_334815_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|334958_335372_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068077.1|335976_336594_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 30
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	345004	347019	4829265		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|345004_346018_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|346014_347019_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 31
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	358677	361635	4829265		Acinetobacter_phage(100.0%)	2	NA	NA
WP_001344826.1|358677_360036_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|360039_361635_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
>prophage 32
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	368606	373898	4829265	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559286.1|368606_369365_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_000422045.1|369584_370634_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|370669_370921_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|371300_373898_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 33
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	378822	379413	4829265		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|378822_379413_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 34
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	387227	392884	4829265		Lactococcus_phage(50.0%)	5	NA	NA
WP_000484966.1|387227_389162_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.6	6.9e-32
WP_001301103.1|389229_390357_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|390500_391289_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000565727.1|391656_392010_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|392077_392884_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 35
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	421069	422152	4829265		Planktothrix_phage(100.0%)	1	NA	NA
WP_160268024.1|421069_422152_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	2.1e-22
>prophage 36
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	438771	439287	4829265		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|438771_439287_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 37
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	445613	453844	4829265	integrase,tRNA	Escherichia_phage(62.5%)	9	446439:446453	464045:464059
WP_077492686.1|445613_446846_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	5.2e-17
446439:446453	attL	CAGAAAAAAGCGCGC	NA	NA	NA	NA
WP_000387388.1|447100_448084_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_077492676.1|448561_449935_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.9e-52
WP_001157407.1|450063_450999_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|451050_452286_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|452287_452503_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|452581_452791_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|452783_452978_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|453034_453844_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
464045:464059	attR	GCGCGCTTTTTTCTG	NA	NA	NA	NA
>prophage 38
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	458868	461770	4829265		Salmonella_phage(50.0%)	5	NA	NA
WP_000836768.1|458868_459102_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|459170_459284_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001157925.1|459623_459797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295593.1|460061_460496_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837924.1|460636_461770_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 39
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	466730	467720	4829265		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|466730_467720_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 40
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	505963	509866	4829265		Klosneuvirus(100.0%)	1	NA	NA
WP_124326231.1|505963_509866_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 41
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	513805	570293	4829265	tail,portal,transposase,capsid,terminase	Escherichia_phage(17.65%)	57	NA	NA
WP_160268025.1|513805_514336_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	4.1e-19
WP_000731833.1|514580_514754_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001320773.1|514825_514975_-	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_088538165.1|515074_516444_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	2.2e-112
WP_077492173.1|516819_518460_+	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_000414564.1|518498_519422_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077492171.1|519638_520982_+	VOC family protein	NA	NA	NA	NA	NA
WP_000375956.1|521206_522862_+	glucan biosynthesis protein	NA	NA	NA	NA	NA
WP_001296778.1|523001_523226_+	YdcH family protein	NA	NA	NA	NA	NA
WP_001491065.1|523288_523828_+	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_077492028.1|523819_524800_-	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_085452653.1|524923_525916_+	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_000586720.1|525912_526506_+	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001261013.1|526808_527477_+	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_096317856.1|528007_529216_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.0e-206
WP_072169390.1|529255_530470_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429150.1|530522_531059_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_124326327.1|531131_533093_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.6	1.6e-23
WP_000494244.1|533184_533415_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|533636_533813_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_000849924.1|534251_534557_-	hypothetical protein	NA	C4MZ33	Escherichia_phage	60.9	6.0e-23
WP_105906995.1|534853_535411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012478345.1|535815_536790_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_039003037.1|536879_537602_-	PAP2 family protein	NA	NA	NA	NA	NA
WP_049589868.1|537673_539299_-	phosphoethanolamine--lipid A transferase MCR-1.1	NA	NA	NA	NA	NA
WP_012478345.1|539494_540469_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_000898985.1|540873_541815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021515494.1|541928_542108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021515495.1|543528_543978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000657813.1|544098_544431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063078207.1|544520_545351_+	Rha family transcriptional regulator	NA	A0A2I7R140	Vibrio_phage	34.1	1.4e-10
WP_000208371.1|545515_545743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105906979.1|545778_546384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105906980.1|546471_548376_+|terminase	terminase	terminase	A0A2H4J898	uncultured_Caudovirales_phage	27.9	3.5e-44
WP_105906981.1|548448_548946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105906982.1|548955_550479_+|portal	phage portal protein	portal	D6PFS3	uncultured_phage	28.7	9.0e-27
WP_105906983.1|550522_552595_+|capsid	major capsid protein	capsid	Q6R4V3	Vibrio_virus	23.1	2.8e-23
WP_049142986.1|552786_553077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000881569.1|553060_553483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105906984.1|553492_554326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105906985.1|554399_558104_+|tail	phage tail protein	tail	A0A0F6TII8	Escherichia_coli_O157_typing_phage	46.8	1.2e-03
WP_104717657.1|558142_558439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061360330.1|558441_558747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105906969.1|558746_559049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032318729.1|559102_559576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096319063.1|559658_559967_+	cytochrome	NA	NA	NA	NA	NA
WP_077875271.1|559996_560347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105906968.1|560350_562780_+	hypothetical protein	NA	A0A0M3LS69	Mannheimia_phage	34.0	4.8e-22
WP_065203463.1|562830_563391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352482.1|563474_564044_+	DUF2163 domain-containing protein	NA	NA	NA	NA	NA
WP_032216530.1|564075_564510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105906967.1|564509_568286_+	hypothetical protein	NA	Q9EYE7	Enterobacteria_phage	52.7	2.1e-48
WP_021515509.1|568391_568670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001406248.1|568688_568859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033560199.1|569250_569544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097085.1|569582_569930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949339.1|569939_570293_+	DUF882 domain-containing protein	NA	A0A2K9VAY0	Citrobacter_phage	62.6	5.0e-37
>prophage 42
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	574314	574701	4829265		Escherichia_phage(100.0%)	1	NA	NA
WP_024228071.1|574314_574701_-	hypothetical protein	NA	C4MZ15	Escherichia_phage	45.9	1.9e-10
>prophage 43
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	577749	578763	4829265		Mycoplasma_phage(100.0%)	1	NA	NA
WP_077491391.1|577749_578763_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	6.0e-27
>prophage 44
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	583086	589422	4829265	transposase	Bacillus_phage(50.0%)	6	NA	NA
WP_085955967.1|583086_584432_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.3	3.5e-75
WP_001459713.1|584457_584688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075331259.1|584684_585203_-	L-methionine sulfoximine/L-methionine sulfone acetyltransferase	NA	NA	NA	NA	NA
WP_077491672.1|585383_586421_+	NADPH-dependent curcumin/dihydrocurcumin reductase	NA	NA	NA	NA	NA
WP_053883758.1|586618_587284_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077491674.1|587319_589422_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.9	6.2e-135
>prophage 45
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	602685	604230	4829265		Escherichia_phage(100.0%)	1	NA	NA
WP_000702542.1|602685_604230_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	4.9e-20
>prophage 46
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	611114	611405	4829265		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|611114_611405_-	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 47
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	617595	617880	4829265		Escherichia_phage(100.0%)	1	NA	NA
WP_000781370.1|617595_617880_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 48
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	622309	624215	4829265		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285555.1|622309_623236_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	1.2e-13
WP_000193546.1|623228_624215_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
>prophage 49
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	628531	632732	4829265	transposase	Klosneuvirus(50.0%)	2	NA	NA
WP_024179168.1|628531_630931_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_012478345.1|631757_632732_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
>prophage 50
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	638684	645620	4829265		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_160268026.1|638684_641480_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	1.5e-19
WP_000832435.1|641524_643897_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_160268027.1|643934_645620_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.5	1.0e-10
>prophage 51
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	659341	660289	4829265		Vibrio_phage(100.0%)	1	NA	NA
WP_047928715.1|659341_660289_+	hypothetical protein	NA	A0A2I7RVA4	Vibrio_phage	33.9	5.3e-17
>prophage 52
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	671211	672747	4829265		Staphylococcus_phage(100.0%)	1	NA	NA
WP_085452659.1|671211_672747_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	23.6	2.1e-15
>prophage 53
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	680629	682048	4829265		Bacillus_phage(100.0%)	1	NA	NA
WP_000558044.1|680629_682048_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 54
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	689792	691922	4829265		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|689792_690176_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|690207_690426_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012618.1|690482_691922_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.1e-29
>prophage 55
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	699427	710657	4829265		Bacillus_phage(16.67%)	11	NA	NA
WP_000592826.1|699427_700318_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
WP_000671731.1|700572_700965_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024561.1|701240_701759_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_077491829.1|701803_703849_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SID3	Klosneuvirus	22.5	2.5e-32
WP_000636571.1|703985_704732_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|704820_705507_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214712.1|705684_705888_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_077491831.1|705923_707384_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	1.1e-42
WP_000255061.1|707516_708851_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001295394.1|708910_710125_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|710330_710657_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
>prophage 56
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	715535	720100	4829265		Escherichia_phage(100.0%)	4	NA	NA
WP_001340362.1|715535_717959_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|717969_718587_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|718588_719443_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_085452660.1|719485_720100_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	6.6e-29
>prophage 57
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	737861	739163	4829265		Bacillus_phage(100.0%)	1	NA	NA
WP_000732487.1|737861_739163_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	7.2e-17
>prophage 58
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	749239	751051	4829265		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945881.1|749239_751051_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.8	0.0e+00
>prophage 59
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	770927	772202	4829265	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_077491370.1|770927_772202_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	3.9e-84
>prophage 60
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	779113	780612	4829265		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|779113_779635_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250656.1|779715_780612_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 61
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	789415	798207	4829265		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|789415_790231_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|790358_790940_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|791085_792255_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|792420_792510_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|792808_793834_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|793830_794763_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032173857.1|794875_796087_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_077491352.1|796377_797526_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	5.5e-85
WP_000493947.1|797565_798207_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 62
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	805309	805978	4829265		Escherichia_phage(100.0%)	1	NA	NA
WP_001349911.1|805309_805978_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 63
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	814267	819351	4829265		environmental_halophage(33.33%)	5	NA	NA
WP_000144564.1|814267_815488_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	5.8e-93
WP_000908012.1|815484_816756_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_124326163.1|816730_817477_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.5	3.9e-07
WP_000089364.1|817486_818974_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|818982_819351_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 64
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	837944	857538	4829265	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_124061925.1|837944_839645_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	29.0	3.6e-32
WP_000069410.1|839701_842080_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	1.2e-171
WP_000368046.1|842412_843246_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082229.1|843402_844449_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|844580_844772_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175708.1|844775_846212_-	YdiU family protein	NA	NA	NA	NA	NA
WP_016242177.1|846274_846988_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209795.1|847234_847699_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_000029466.1|847776_848526_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154178.1|848525_849077_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956529.1|849139_850120_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|850220_850520_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_085452664.1|850524_852912_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_085452665.1|852926_853910_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|854193_854238_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|854360_854717_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|854769_854967_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|855063_855606_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144199.1|855609_857538_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.6e-129
>prophage 65
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	868834	871096	4829265		Tupanvirus(100.0%)	1	NA	NA
WP_085452666.1|868834_871096_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 66
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	877425	878253	4829265		Bacillus_virus(100.0%)	1	NA	NA
WP_000175026.1|877425_878253_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.7e-72
>prophage 67
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	885729	886950	4829265		Klosneuvirus(100.0%)	1	NA	NA
WP_077491779.1|885729_886950_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.2e-27
>prophage 68
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	893714	894368	4829265		Bacillus_phage(100.0%)	1	NA	NA
WP_001300558.1|893714_894368_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	5.1e-11
>prophage 69
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	899965	901927	4829265		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|899965_901927_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 70
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	906853	910939	4829265		Tupanvirus(50.0%)	4	NA	NA
WP_001135066.1|906853_907495_+	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
WP_077491443.1|907587_908946_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|909063_909822_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723723.1|909958_910939_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	7.9e-08
>prophage 71
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	919749	920604	4829265		Indivirus(100.0%)	1	NA	NA
WP_001186371.1|919749_920604_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	2.5e-10
>prophage 72
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	923922	928499	4829265		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|923922_925206_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616417.1|925352_926828_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_077491447.1|927008_928499_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	4.9e-09
>prophage 73
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	943028	951911	4829265	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|943028_944714_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|944918_945500_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220981.1|945539_946235_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|946292_948203_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|948334_948679_+	RidA family protein	NA	NA	NA	NA	NA
WP_001407564.1|949853_950177_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|950296_950476_-	YoaH family protein	NA	NA	NA	NA	NA
WP_160268031.1|950549_951911_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.6e-41
>prophage 74
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	955773	957330	4829265		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|955773_957330_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 75
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	962969	963179	4829265		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|962969_963179_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 76
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	968509	970558	4829265		Moraxella_phage(100.0%)	1	NA	NA
WP_160268033.1|968509_970558_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.8e-86
>prophage 77
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	978054	982524	4829265		Escherichia_phage(33.33%)	7	NA	NA
WP_000812732.1|978054_978711_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	8.0e-57
WP_000976472.1|979106_979448_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879295.1|979460_980333_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|980336_980711_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|980849_981080_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|981181_981838_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|981861_982524_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 78
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	990580	992056	4829265		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|990580_992056_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 79
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	996054	1003117	4829265		Bacillus_virus(50.0%)	8	NA	NA
WP_001184045.1|996054_997377_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001300644.1|997392_998325_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|998403_999159_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|999155_999941_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|1000087_1001098_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580327.1|1001106_1001718_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001024904.1|1001991_1002594_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|1002595_1003117_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 80
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1007135	1009186	4829265		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639274.1|1007135_1007954_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|1008006_1008402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|1008442_1009186_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 81
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1015802	1017536	4829265	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025322.1|1015802_1017536_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 82
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1022788	1028432	4829265		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|1022788_1023178_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|1023192_1024242_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204342.1|1024244_1025105_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483223.1|1025123_1026725_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
WP_001297437.1|1026770_1028432_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 83
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1038518	1040033	4829265		Cedratvirus(100.0%)	1	NA	NA
WP_001187819.1|1038518_1040033_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 84
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1052023	1052776	4829265		Bacillus_virus(100.0%)	1	NA	NA
WP_001272992.1|1052023_1052776_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 85
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1064546	1066366	4829265	transposase	uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000334585.1|1064546_1065218_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.3e-81
WP_071593097.1|1065202_1066366_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	3.2e-197
>prophage 86
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1083558	1095940	4829265		Bacillus_phage(28.57%)	12	NA	NA
WP_077249978.1|1083558_1085253_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.7e-18
WP_000009307.1|1085423_1085606_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|1085684_1086602_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|1086774_1087695_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786008.1|1087683_1088154_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	4.4e-33
WP_001157239.1|1088134_1089553_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000365561.1|1089619_1090315_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_012601575.1|1090354_1090720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032256236.1|1091285_1092359_+	porin	NA	Q1MVN1	Enterobacteria_phage	51.3	5.3e-98
WP_088568504.1|1092951_1093803_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826755.1|1093910_1095269_-	heavy metal sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.2	5.1e-05
WP_001339045.1|1095268_1095940_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 87
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1099484	1100015	4829265		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|1099484_1100015_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 88
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1107627	1108997	4829265	transposase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_160268035.1|1107627_1108997_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	2.2e-112
>prophage 89
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1129039	1130253	4829265	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_088172348.1|1129039_1130253_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.0	5.1e-166
>prophage 90
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1150456	1152615	4829265		Yersinia_phage(33.33%)	4	NA	NA
WP_001234530.1|1150456_1151278_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000860076.1|1151359_1151839_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001186773.1|1151854_1152331_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|1152393_1152615_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 91
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1156956	1158123	4829265		Stx2-converting_phage(100.0%)	1	NA	NA
WP_160268036.1|1156956_1158123_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.2	2.1e-225
>prophage 92
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1165767	1166667	4829265		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|1165767_1166667_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 93
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1172839	1180787	4829265		Acanthocystis_turfacea_Chlorella_virus(40.0%)	8	NA	NA
WP_124326238.1|1172839_1174006_-	UDP-glucose 6-dehydrogenase	NA	M1IB49	Acanthocystis_turfacea_Chlorella_virus	53.7	1.5e-114
WP_124326239.1|1174259_1175666_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	8.0e-38
WP_160268038.1|1175784_1176162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160268039.1|1176218_1176548_-	glycosyltransferase	NA	A0A075B8F6	Enterobacteria_phage	37.2	1.5e-11
WP_124326244.1|1176608_1177715_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_124326245.1|1177708_1178851_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_124326246.1|1178850_1179747_-	NAD-dependent epimerase/dehydratase family protein	NA	E5EQW4	Bathycoccus_sp._RCC1105_virus	26.0	6.1e-15
WP_124326247.1|1179746_1180787_-	GDP-mannose 4,6-dehydratase	NA	M1HGM9	Acanthocystis_turfacea_Chlorella_virus	54.4	5.3e-103
>prophage 94
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1186021	1198519	4829265		Bacillus_phage(28.57%)	9	NA	NA
WP_124326250.1|1186021_1187248_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.8	7.5e-16
WP_124326251.1|1187247_1188042_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_160268040.1|1188043_1189420_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.1	2.9e-32
WP_047662985.1|1189439_1190855_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	33.4	1.0e-61
WP_128424569.1|1191249_1192140_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.5	6.6e-46
WP_160268125.1|1193472_1195056_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.1	1.2e-34
WP_001252331.1|1195329_1197183_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|1197204_1197786_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|1197877_1198519_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 95
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1203236	1204589	4829265		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_124326254.1|1203236_1204589_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	1.4e-07
>prophage 96
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1218360	1229290	4829265	tail,terminase,portal,tRNA	Escherichia_phage(63.64%)	12	NA	NA
WP_000675150.1|1218360_1219764_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137877.1|1219760_1220483_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|1220673_1221006_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|1221152_1222514_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_000468308.1|1222787_1223006_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_160268041.1|1223087_1224251_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	7.7e-204
WP_000978896.1|1224250_1224730_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	100.0	6.6e-85
WP_160268042.1|1224744_1227192_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.5	0.0e+00
WP_000785970.1|1227184_1227304_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_062878036.1|1227336_1227612_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.8e-40
WP_001333118.1|1227986_1228256_+|terminase	terminase	terminase	A0A0F7LCM8	Escherichia_phage	100.0	9.6e-41
WP_000038161.1|1228255_1229290_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
>prophage 97
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1234060	1239531	4829265	integrase	Enterobacteria_phage(44.44%)	10	1229823:1229837	1238266:1238280
1229823:1229837	attL	TTATTATATTTAAAC	NA	NA	NA	NA
WP_000027664.1|1234060_1234336_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_053285579.1|1234332_1234557_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	97.3	1.1e-34
WP_001515551.1|1234556_1234859_-	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	99.0	1.3e-46
WP_000557703.1|1234858_1235083_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|1235146_1235647_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000043869.1|1235824_1236100_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|1236214_1236514_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_160268043.1|1236629_1237643_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	98.8	1.4e-193
WP_001318299.1|1237908_1238226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807356.1|1238631_1239531_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
1238266:1238280	attR	GTTTAAATATAATAA	NA	NA	NA	NA
>prophage 98
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1248751	1252308	4829265		Serratia_phage(50.0%)	4	NA	NA
WP_000846222.1|1248751_1249756_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	6.4e-13
WP_000011997.1|1249752_1250718_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|1250691_1251438_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077491867.1|1251489_1252308_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	8.6e-24
>prophage 99
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1262935	1264969	4829265	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001300883.1|1262935_1264969_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	2.3e-54
>prophage 100
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1276601	1286042	4829265		Enterobacteria_phage(85.71%)	10	NA	NA
WP_077491859.1|1276601_1277738_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.1e-161
WP_088568418.1|1277734_1279735_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001295429.1|1279859_1280321_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|1280360_1280831_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|1280877_1281597_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1281593_1283279_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|1283500_1284232_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|1284291_1284399_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1284379_1285111_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569357.1|1285115_1286042_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 101
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1306445	1307966	4829265		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_077492702.1|1306445_1307966_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 102
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1311660	1315446	4829265		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|1311660_1312329_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_124326257.1|1312586_1313423_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489247.1|1313454_1315446_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 103
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1319516	1320374	4829265		Catovirus(100.0%)	1	NA	NA
WP_000873880.1|1319516_1320374_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
>prophage 104
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1334871	1339172	4829265		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001400663.1|1334871_1336338_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	1.7e-43
WP_000198828.1|1336455_1337442_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_047645230.1|1337480_1338194_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_072731124.1|1338605_1339172_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 105
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1344926	1352574	4829265		Vibrio_phage(50.0%)	7	NA	NA
WP_072731125.1|1344926_1346516_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.9	4.2e-19
WP_000202798.1|1346519_1346864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213361.1|1347196_1348387_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|1348414_1349110_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578061.1|1349258_1351019_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	2.4e-100
WP_000494183.1|1351143_1351428_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050793.1|1351566_1352574_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	4.1e-84
>prophage 106
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1364448	1365066	4829265		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|1364448_1365066_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 107
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1375779	1379865	4829265		Tupanvirus(33.33%)	4	NA	NA
WP_000885006.1|1375779_1376430_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000710372.1|1376429_1377494_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	2.4e-18
WP_000406085.1|1377567_1378623_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865600.1|1378734_1379865_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.2	1.1e-117
>prophage 108
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1384142	1388985	4829265		Hokovirus(50.0%)	2	NA	NA
WP_000876011.1|1384142_1386992_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001295210.1|1387158_1388985_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.9	4.4e-20
>prophage 109
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1403907	1406535	4829265		Bacillus_virus(100.0%)	1	NA	NA
WP_001281254.1|1403907_1406535_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
>prophage 110
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1411979	1418126	4829265		Pseudomonas_phage(50.0%)	5	NA	NA
WP_001075164.1|1411979_1414265_+	ribonucleoside-diphosphate reductase 1 subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
WP_000332037.1|1414498_1415629_+	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_000135040.1|1415628_1415883_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|1415936_1416587_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779102.1|1417049_1418126_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.0e-08
>prophage 111
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1424018	1428529	4829265	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_000140569.1|1424018_1424918_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
WP_000150333.1|1424930_1425116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992954.1|1425156_1425960_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001295288.1|1425977_1427267_-	MFS transporter	NA	NA	NA	NA	NA
WP_001319848.1|1427323_1428529_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
>prophage 112
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1432133	1437137	4829265		Tupanvirus(50.0%)	4	NA	NA
WP_000879112.1|1432133_1432736_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
WP_001295286.1|1433043_1434183_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.5e-29
WP_000461657.1|1434186_1435155_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_000860273.1|1435154_1437137_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 113
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1471544	1474772	4829265		Salmonella_phage(50.0%)	3	NA	NA
WP_000813860.1|1471544_1472144_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|1472202_1474035_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203392.1|1474121_1474772_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
>prophage 114
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1485332	1564575	4829265	tail,protease,plate,holin,lysis,integrase,transposase,tRNA,head,capsid,terminase	Enterobacteria_phage(55.38%)	103	1526034:1526050	1568250:1568266
WP_160268049.1|1485332_1486223_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	43.9	2.6e-66
WP_001293625.1|1486419_1487193_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000569958.1|1487200_1487917_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000965518.1|1487913_1488600_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000737621.1|1488689_1489472_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
WP_000748271.1|1489692_1490475_-	lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT	NA	NA	NA	NA	NA
WP_000825700.1|1490740_1491310_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000334221.1|1491404_1492922_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
WP_000262113.1|1492958_1493447_-	colicin V production protein	NA	NA	NA	NA	NA
WP_000146992.1|1493705_1494368_-	cell division protein DedD	NA	NA	NA	NA	NA
WP_000584546.1|1494357_1495626_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000118404.1|1495695_1496610_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_000364335.1|1496765_1497425_-	DedA family protein	NA	NA	NA	NA	NA
WP_001283585.1|1497507_1498320_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289167.1|1498319_1499333_-	USG-1 protein	NA	NA	NA	NA	NA
WP_000699121.1|1499398_1500535_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615834.1|1500633_1501629_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_160268050.1|1501625_1502804_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|1503068_1504289_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683789.1|1504447_1506454_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|1506574_1506853_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089250.1|1506886_1507435_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|1507434_1508244_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043792.1|1508243_1509068_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|1509071_1510157_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001459941.1|1510191_1511124_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730816.1|1511289_1511841_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001400721.1|1511966_1512791_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_077491350.1|1512792_1513344_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000809301.1|1513340_1513820_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000789849.1|1513816_1514323_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001281607.1|1514339_1515092_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_077491348.1|1515111_1517757_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033319.1|1517838_1518402_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|1519085_1519571_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426161.1|1519773_1521918_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531952.1|1521917_1523228_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|1523408_1523693_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001400735.1|1524064_1525405_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
1526034:1526050	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000776768.1|1527010_1527766_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368140.1|1528059_1528992_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_124326265.1|1529303_1530461_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	2.4e-221
WP_124326348.1|1530523_1530958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160268051.1|1530962_1531856_-	hypothetical protein	NA	U5P0I1	Shigella_phage	89.6	1.1e-32
WP_124326343.1|1531859_1532444_-	YmfQ family protein	NA	O22003	Shigella_phage	99.5	5.4e-113
WP_097759875.1|1532434_1533493_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	99.1	1.6e-200
WP_122985549.1|1533479_1533905_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	2.3e-81
WP_160268052.1|1533904_1534453_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	2.5e-96
WP_001752125.1|1534452_1535532_-	phage late control D family protein	NA	Q8SBG7	Shigella_phage	99.4	6.9e-207
WP_072643294.1|1535528_1536857_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.4	6.1e-245
WP_032281336.1|1536983_1537436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160268053.1|1537452_1539243_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	90.2	1.8e-268
WP_000661054.1|1539384_1539654_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_160268054.1|1539653_1540010_-|tail	phage tail protein	tail	U5P076	Shigella_phage	99.2	2.0e-62
WP_160268055.1|1540009_1541506_-|tail	phage tail protein	tail	U5P0H3	Shigella_phage	98.6	4.8e-275
WP_000497757.1|1541489_1541660_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_000779292.1|1541668_1542229_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_160268056.1|1542225_1542732_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	7.8e-84
WP_160268057.1|1542706_1543117_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.1	2.3e-70
WP_000927719.1|1543113_1543437_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|1543439_1543640_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_160268126.1|1543689_1545315_-|capsid	phage major capsid protein	capsid	A0A1C9IIA1	Salmonella_phage	99.3	3.5e-271
WP_000929173.1|1545548_1546043_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.3e-88
WP_001514791.1|1546168_1546519_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	1.8e-63
WP_106426705.1|1546761_1547010_-	hypothetical protein	NA	G8C7W4	Escherichia_phage	83.8	2.6e-08
WP_001016386.1|1547006_1547525_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	100.0	3.2e-93
WP_094396110.1|1547729_1548167_-|lysis	lysis protein	lysis	K7P7F7	Enterobacteria_phage	98.6	1.0e-71
WP_000229392.1|1548163_1548640_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_001570152.1|1548623_1548947_-|holin	phage holin, lambda family	holin	K7PH31	Enterobacteria_phage	99.1	1.1e-51
WP_001235459.1|1549381_1550005_-	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_000994515.1|1550001_1550190_-	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_106486964.1|1550186_1550549_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	99.2	1.3e-61
WP_000002257.1|1550545_1550836_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	99.0	6.5e-51
WP_001003984.1|1550835_1551558_-	DNA-binding protein	NA	K7P7L0	Enterobacteria_phage	99.6	7.1e-131
WP_024233462.1|1551550_1551721_-	protein ninF	NA	K7P6X0	Enterobacteria_phage	98.2	1.2e-25
WP_016063117.1|1551717_1551900_-	NinE family protein	NA	K7PH28	Enterobacteria_phage	100.0	7.4e-29
WP_160268058.1|1551896_1552307_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.8e-70
WP_000818842.1|1552314_1552521_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	97.1	1.8e-26
WP_000145948.1|1552593_1552884_-	hypothetical protein	NA	K7PH23	Enterobacteria_phage	100.0	2.5e-50
WP_001515063.1|1552880_1553774_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	100.0	2.4e-165
WP_016063146.1|1553776_1554622_-	replication protein	NA	K7PGT1	Enterobacteria_phage	100.0	2.0e-140
WP_032247584.1|1554654_1554951_-	hypothetical protein	NA	A0A1U9AJB5	Stx1_converting_phage	99.0	8.9e-48
WP_000437876.1|1555089_1555290_-	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	100.0	3.3e-30
WP_001274760.1|1555390_1556104_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	100.0	1.8e-131
WP_024191667.1|1556208_1556307_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_016063366.1|1556467_1556722_+	type II toxin-antitoxin system HicA family toxin	NA	K7PH44	Enterobacterial_phage	100.0	7.4e-43
WP_016063365.1|1556714_1557173_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	100.0	1.7e-82
WP_016063364.1|1557172_1557598_+	hypothetical protein	NA	A4KWV6	Enterobacteria_phage	100.0	2.4e-78
WP_000198446.1|1558093_1558477_+	hypothetical protein	NA	A4KWV5	Enterobacteria_phage	100.0	3.9e-64
WP_000213971.1|1558605_1558785_+	Restriction inhibitor protein ral	NA	M1FQU1	Enterobacteria_phage	100.0	6.6e-30
WP_160268059.1|1558981_1559950_+	cell envelope biogenesis protein TolA	NA	K7P7J7	Enterobacteria_phage	99.7	7.7e-56
WP_000638547.1|1559973_1560105_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|1560089_1560242_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_160268060.1|1560496_1561204_+	recombinase	NA	K7PKU3	Enterobacteria_phage	99.1	2.2e-137
WP_057077872.1|1561204_1561711_+	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	99.4	3.4e-79
WP_160268061.1|1561724_1562018_+	DUF2856 family protein	NA	Q687G7	Enterobacteria_phage	96.9	3.0e-48
WP_099098287.1|1562028_1562319_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	96.9	5.3e-45
WP_001214442.1|1562315_1562483_+	DUF2737 family protein	NA	K7PJY9	Enterobacterial_phage	98.2	6.6e-24
WP_160268062.1|1562479_1563049_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	95.7	1.3e-50
WP_160268127.1|1563048_1563327_+	DUF4752 family protein	NA	K7P6P7	Enterobacteria_phage	98.9	1.9e-47
WP_122988949.1|1563484_1563784_+	hypothetical protein	NA	Q9G076	Enterobacteria_phage	97.0	1.9e-50
WP_128424542.1|1563819_1563987_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	96.4	1.1e-26
WP_001163428.1|1564374_1564575_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
1568250:1568266	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 115
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1572438	1580015	4829265		Bacillus_phage(50.0%)	4	NA	NA
WP_001326970.1|1572438_1576032_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
WP_077492228.1|1576087_1577233_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|1577306_1578251_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283501.1|1578320_1580015_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 116
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1583709	1584630	4829265		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|1583709_1584630_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 117
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1588447	1589182	4829265		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|1588447_1589182_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 118
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1614876	1630234	4829265		Streptococcus_phage(33.33%)	15	NA	NA
WP_000443661.1|1614876_1616892_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.7e-150
WP_001300494.1|1616962_1617949_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|1618178_1618940_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|1619124_1620096_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|1620479_1620737_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623140.1|1620781_1622509_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	1.3e-16
WP_000522247.1|1622549_1623059_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096674.1|1623101_1623953_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719963.1|1624057_1624426_+	YfeK family protein	NA	NA	NA	NA	NA
WP_000105477.1|1624428_1625340_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.6	1.7e-57
WP_000021036.1|1625473_1626571_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852686.1|1626560_1627436_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458405.1|1627435_1628269_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290225.1|1628268_1629285_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517442.1|1629442_1630234_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.5e-17
>prophage 119
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1633712	1638796	4829265		Mycobacterium_phage(33.33%)	6	NA	NA
WP_072662978.1|1633712_1635017_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|1635074_1635974_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_077492370.1|1636069_1636645_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_077492368.1|1636851_1637301_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000405996.1|1637287_1637713_-	acetyltransferase YpeA	NA	NA	NA	NA	NA
WP_000102886.1|1637926_1638796_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 120
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1657333	1658284	4829265		Cyanophage(100.0%)	1	NA	NA
WP_001003711.1|1657333_1658284_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 121
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1675573	1676287	4829265		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1675573_1676287_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 122
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1697531	1701533	4829265		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|1697531_1698821_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|1698906_1699533_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|1699857_1700895_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028614.1|1700894_1701533_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 123
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1707967	1714262	4829265		Escherichia_phage(60.0%)	6	NA	NA
WP_001344399.1|1707967_1708141_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669402.1|1708454_1708970_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_000755173.1|1708985_1709525_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_000138282.1|1709617_1711195_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|1711263_1712730_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937920.1|1712891_1714262_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	5.2e-42
>prophage 124
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1723091	1723523	4829265		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|1723091_1723523_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 125
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1733733	1740071	4829265		Mycoplasma_phage(20.0%)	8	NA	NA
WP_077492689.1|1733733_1735017_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
WP_000523616.1|1735075_1735276_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124474.1|1735287_1735623_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|1735624_1737475_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|1737491_1738007_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|1738102_1738426_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|1738442_1738829_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_085452699.1|1738856_1740071_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.1	3.0e-33
>prophage 126
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1755207	1756719	4829265		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493470.1|1755207_1756719_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.0	2.4e-11
>prophage 127
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1762611	1862045	4829265	tail,holin,plate,portal,integrase,tRNA,head,capsid,terminase	Enterobacteria_phage(62.3%)	106	1761641:1761657	1864859:1864875
1761641:1761657	attL	ATCAACCTGGCGCTGGC	NA	NA	NA	NA
WP_000919159.1|1762611_1763865_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883122.1|1764192_1765383_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|1765427_1765766_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001295369.1|1765826_1767161_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215861.1|1767150_1767864_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001297612.1|1768028_1769456_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_085452703.1|1770031_1773919_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	3.5e-131
WP_000734212.1|1774176_1775733_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001298403.1|1775729_1776266_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190655.1|1776290_1776926_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001013779.1|1777134_1777983_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001196283.1|1778038_1778299_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
WP_000128776.1|1778492_1778573_-	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_053900796.1|1778993_1779374_-	holo-[acyl-carrier-protein] synthase	NA	NA	NA	NA	NA
WP_001295365.1|1779373_1780105_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399393.1|1780116_1780845_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000020749.1|1780856_1781762_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068343.1|1781758_1782439_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002541.1|1782710_1783685_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|1783700_1785500_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000589070.1|1785697_1786177_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812053.1|1786173_1787130_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168459.1|1787129_1787780_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_001295364.1|1787812_1788388_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001303621.1|1788384_1788540_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001094491.1|1788795_1790418_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001295363.1|1790402_1791140_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
WP_000219193.1|1791271_1792606_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001351830.1|1792814_1793696_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_074579435.1|1793798_1794386_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|1794441_1794825_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|1795129_1795819_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|1795866_1796904_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1797110_1797530_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001300438.1|1797598_1798297_+	DTW domain-containing protein YfiP	NA	NA	NA	NA	NA
WP_160268066.1|1798328_1800989_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|1801102_1802458_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001295360.1|1802503_1802827_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|1802823_1804122_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|1809977_1812551_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040169.1|1812680_1813412_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079100.1|1813408_1814389_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|1814523_1815261_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|1815531_1815873_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000215756.1|1816023_1816830_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	53.2	1.5e-65
WP_072032588.1|1816826_1817033_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001519189.1|1817163_1817460_-	zinc-ribbon domain and TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	67.2	9.0e-16
WP_000078916.1|1817595_1817736_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488105.1|1817926_1818187_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_032419529.1|1818229_1819339_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	3.1e-194
WP_000005367.1|1819496_1820681_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	4.7e-225
WP_000290450.1|1820680_1821193_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_001603086.1|1821247_1821613_+|tail	phage tail protein E	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.9e-55
WP_000763327.1|1821648_1821777_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_063112817.1|1821763_1824571_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	93.3	0.0e+00
WP_000979945.1|1824583_1825072_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_001165544.1|1825098_1825698_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	2.6e-86
WP_097467737.1|1825769_1826237_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	64.8	1.7e-48
WP_046077172.1|1826247_1826676_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	54.9	2.9e-39
WP_029399354.1|1826686_1827163_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	58.2	1.2e-46
WP_001057723.1|1827169_1827781_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	80.0	2.5e-84
WP_064774522.1|1827780_1828221_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.6	5.8e-35
WP_160268067.1|1828249_1829854_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	57.6	3.0e-145
WP_000071724.1|1829850_1830459_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_032419537.1|1830451_1831348_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	3.9e-155
WP_032419536.1|1831351_1831702_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	9.2e-60
WP_001271944.1|1831698_1832280_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	5.0e-103
WP_160268068.1|1832276_1832912_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	2.4e-114
WP_000920593.1|1832904_1833372_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
WP_000780572.1|1833509_1833917_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_032419535.1|1833913_1834306_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	2.9e-70
WP_000104350.1|1834302_1834626_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|1834628_1834829_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063082.1|1834828_1835323_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000632329.1|1835425_1836226_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	90.6	7.3e-129
WP_032419534.1|1836271_1837324_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	92.3	3.6e-184
WP_000180564.1|1837347_1838184_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.2	7.2e-119
WP_032419533.1|1838338_1840090_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_000087811.1|1840089_1841136_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	3.3e-206
WP_000970615.1|1841640_1843845_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_000248600.1|1843841_1844924_-	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	8.4e-19
WP_024242821.1|1845302_1845614_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	3.2e-48
WP_001673486.1|1845618_1846578_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.1e-179
WP_063112838.1|1846654_1849495_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	87.7	0.0e+00
WP_000564227.1|1849491_1849881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124829034.1|1849877_1850495_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	38.3	2.7e-06
WP_032419531.1|1850506_1850806_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.8	9.6e-42
WP_000153674.1|1850802_1851048_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_024232567.1|1851044_1851248_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000021661.1|1851334_1851448_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	1.6e-10
WP_000514277.1|1851444_1851687_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_024232568.1|1851698_1851986_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	1.0e-32
WP_024232569.1|1851996_1852338_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	5.1e-55
WP_001001394.1|1852356_1852683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032152547.1|1852778_1853081_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
WP_024232571.1|1853147_1854137_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	53.5	3.4e-99
WP_010723158.1|1854304_1854352_+	phe operon leader peptide	NA	NA	NA	NA	NA
WP_000200120.1|1854450_1855611_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|1855653_1856775_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168037.1|1856785_1857856_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976004.1|1858065_1858431_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|1858580_1859099_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_000969032.1|1859088_1860315_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589847.1|1860330_1860813_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|1860888_1861236_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|1861277_1862045_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
1864859:1864875	attR	ATCAACCTGGCGCTGGC	NA	NA	NA	NA
>prophage 128
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1871489	1882588	4829265	integrase,transposase	Staphylococcus_phage(40.0%)	7	1863847:1863861	1878353:1878367
1863847:1863861	attL	CAGTTTGGCTTCTTT	NA	NA	NA	NA
WP_000162574.1|1871489_1871972_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001062342.1|1872715_1873945_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	86.6	4.6e-207
WP_000135615.1|1874227_1875784_+	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	30.0	3.2e-19
WP_000936465.1|1875773_1876670_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_000614783.1|1876666_1877563_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_085947771.1|1878668_1879830_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
1878353:1878367	attR	AAAGAAGCCAAACTG	NA	NA	NA	NA
WP_012478345.1|1881613_1882588_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
>prophage 129
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1888386	1892438	4829265		Klosneuvirus(50.0%)	4	NA	NA
WP_000097662.1|1888386_1889667_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.4e-33
WP_001301367.1|1889904_1891305_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|1891325_1891988_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|1891988_1892438_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 130
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1896374	1901669	4829265		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|1896374_1896620_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|1896616_1897027_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246527.1|1896999_1899144_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
WP_000777969.1|1899153_1900113_+	ribonucleoside-diphosphate reductase 2 subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000985494.1|1900466_1901669_+	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 131
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1914719	1920105	4829265	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|1914719_1914905_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047184.1|1915139_1917770_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_077491684.1|1917897_1918398_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|1918466_1919528_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|1919607_1920105_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 132
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1925572	1926538	4829265		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287420.1|1925572_1926538_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 133
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1934013	1935027	4829265		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000989159.1|1934013_1935027_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.0e-26
>prophage 134
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1952852	1966035	4829265		Escherichia_phage(40.0%)	12	NA	NA
WP_001272907.1|1952852_1955414_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	2.3e-30
WP_001141339.1|1955519_1956176_+	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	45.3	5.6e-50
WP_001295181.1|1956226_1956994_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_077492752.1|1957189_1958098_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.9e-118
WP_000590403.1|1958094_1959357_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|1959353_1959992_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|1959996_1960773_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_077492754.1|1960861_1962226_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|1962319_1963312_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|1963374_1964514_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|1964653_1965280_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|1965273_1966035_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 135
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1969147	1971180	4829265		Tupanvirus(50.0%)	2	NA	NA
WP_001173676.1|1969147_1969753_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	3.2e-28
WP_001090386.1|1969752_1971180_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.1	1.1e-29
>prophage 136
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1977799	1978774	4829265	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_012478345.1|1977799_1978774_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
>prophage 137
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1984723	1986093	4829265	transposase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_088538165.1|1984723_1986093_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	2.2e-112
>prophage 138
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	1998251	1999037	4829265		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|1998251_1999037_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 139
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2004731	2009651	4829265		Vibrio_phage(33.33%)	5	NA	NA
WP_001199973.1|2004731_2005403_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001288228.1|2005541_2005682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001720463.1|2005695_2006568_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|2006627_2007926_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|2008013_2009651_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 140
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2013683	2017798	4829265		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_077492052.1|2013683_2014985_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	3.9e-39
WP_160268069.1|2015041_2017798_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.8	2.9e-55
>prophage 141
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2025333	2026182	4829265		Vibrio_phage(100.0%)	1	NA	NA
WP_000100421.1|2025333_2026182_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	1.0e-40
>prophage 142
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2031040	2031796	4829265		Bacillus_phage(100.0%)	1	NA	NA
WP_001439176.1|2031040_2031796_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	8.5e-10
>prophage 143
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2038563	2040063	4829265		Bacillus_virus(100.0%)	1	NA	NA
WP_124326281.1|2038563_2040063_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.8	3.9e-14
>prophage 144
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2048285	2063833	4829265	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_001300698.1|2048285_2049491_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.0e-73
WP_000184261.1|2049490_2049934_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001425990.1|2049984_2050791_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	6.5e-16
WP_000678646.1|2051029_2052127_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|2052705_2053959_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|2054190_2055522_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_077492859.1|2055583_2057410_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.5	7.8e-25
WP_001285993.1|2057409_2060952_-	RecBCD enzyme subunit RecB	NA	A7KV33	Bacillus_phage	20.9	1.5e-08
WP_001138201.1|2060944_2063833_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
>prophage 145
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2069310	2076083	4829265		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816241.1|2069310_2070105_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.5	2.9e-117
WP_000204658.1|2070111_2070987_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957914.1|2071137_2073384_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|2073396_2073927_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082201.1|2074611_2075301_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|2075369_2076083_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 146
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2085715	2088210	4829265		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|2085715_2087134_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|2087448_2088210_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 147
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2113805	2122848	4829265	integrase,transposase	Enterobacteria_phage(75.0%)	6	2111120:2111136	2118849:2118865
2111120:2111136	attL	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
WP_088172348.1|2113805_2115019_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.0	5.1e-166
WP_000023583.1|2115131_2115632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920422.1|2117115_2118714_-|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	28.4	2.3e-12
WP_000023114.1|2118955_2120176_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2118849:2118865	attR	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
WP_000179445.1|2120270_2120984_-	hypothetical protein	NA	I7I023	Enterobacteria_phage	60.5	4.8e-63
WP_000890067.1|2121018_2122848_-	hypothetical protein	NA	I7HJD8	Enterobacteria_phage	29.7	2.3e-32
>prophage 148
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2131136	2131892	4829265		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|2131136_2131892_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 149
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2156355	2171747	4829265	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|2156355_2157756_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001299798.1|2157773_2159090_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|2159125_2160493_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838422.1|2160528_2161017_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_160268071.1|2161016_2162936_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|2163371_2164820_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001010156.1|2164821_2164947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|2164943_2165015_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192818.1|2165069_2165618_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|2165660_2167178_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|2167187_2168286_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813198.1|2168376_2170110_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.9e-60
WP_000715210.1|2170115_2170826_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|2170850_2171747_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 150
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2175671	2181045	4829265		Pandoravirus(50.0%)	3	NA	NA
WP_001338826.1|2175671_2177105_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	2.0e-31
WP_000951962.1|2177161_2177905_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000195062.1|2178171_2181045_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.2e-263
>prophage 151
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2189180	2190413	4829265		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|2189180_2190413_-	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 152
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2218709	2219864	4829265		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|2218709_2219864_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 153
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2242654	2243920	4829265	integrase	Enterobacteria_phage(100.0%)	1	2233005:2233019	2248556:2248570
2233005:2233019	attL	TCTTTTTCCTGCTTT	NA	NA	NA	NA
WP_021559466.1|2242654_2243920_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	9.3e-78
WP_021559466.1|2242654_2243920_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	9.3e-78
2248556:2248570	attR	TCTTTTTCCTGCTTT	NA	NA	NA	NA
>prophage 154
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2259638	2260912	4829265	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_118940499.1|2259638_2260912_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
>prophage 155
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2266356	2267865	4829265	integrase	Escherichia_phage(50.0%)	2	2257640:2257653	2275417:2275430
2257640:2257653	attL	GGCAGAAACACTGC	NA	NA	NA	NA
WP_113446698.1|2266356_2267166_+	chaperonin	NA	A0A0F7L9X0	Escherichia_phage	94.4	6.0e-155
WP_001752951.1|2267262_2267865_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	30.0	7.0e-07
2275417:2275430	attR	GGCAGAAACACTGC	NA	NA	NA	NA
>prophage 156
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2274628	2276806	4829265		Yersinia_phage(33.33%)	4	NA	NA
WP_106464784.1|2274628_2275447_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.5	2.5e-47
WP_106464783.1|2275538_2276024_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	5.3e-13
WP_001186771.1|2276039_2276516_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692346.1|2276584_2276806_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 157
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2301859	2303032	4829265		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524970.1|2301859_2303032_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	5.5e-40
>prophage 158
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2325232	2326117	4829265		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|2325232_2326117_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 159
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2332193	2341544	4829265		Staphylococcus_phage(33.33%)	7	NA	NA
WP_000013149.1|2332193_2333021_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691619.1|2333220_2334147_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|2334197_2334455_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095154.1|2334497_2336717_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059388.1|2336827_2338240_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965722.1|2338314_2339052_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|2339285_2341544_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
>prophage 160
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2344854	2345247	4829265		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|2344854_2345247_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 161
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2349074	2360037	4829265		Bacillus_virus(20.0%)	12	NA	NA
WP_000195296.1|2349074_2350967_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|2350995_2351577_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|2351576_2352404_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|2352428_2352851_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917138.1|2352851_2353481_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	4.1e-18
WP_000735278.1|2353685_2355167_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|2355314_2355986_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|2355991_2357152_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000188362.1|2357189_2358005_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|2358120_2358894_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|2358951_2359122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|2359383_2360037_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 162
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2369554	2370988	4829265		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|2369554_2370988_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 163
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2376125	2377364	4829265	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708487.1|2376125_2377364_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 164
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2383764	2399960	4829265	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_085452720.1|2383764_2384778_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	1.4e-108
WP_001144069.1|2385015_2385231_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|2385341_2387087_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437375.1|2387281_2389123_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|2389201_2389708_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_077491879.1|2389961_2390726_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018003.1|2391013_2391637_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077491877.1|2391790_2393311_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000627220.1|2393617_2395108_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-33
WP_000450594.1|2395149_2395482_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_053900567.1|2395700_2396684_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_077491415.1|2396867_2399960_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.3	9.1e-159
>prophage 165
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2412814	2413780	4829265		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|2412814_2413780_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 166
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2434358	2436653	4829265		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|2434358_2436653_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 167
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2444746	2445892	4829265		Streptococcus_phage(100.0%)	1	NA	NA
WP_001424370.1|2444746_2445892_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 168
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2468903	2476697	4829265		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809262.1|2468903_2469764_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
WP_077492465.1|2469828_2471865_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246830.1|2471822_2472218_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|2472237_2472828_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|2472837_2473413_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147624.1|2473526_2474567_-	permease	NA	NA	NA	NA	NA
WP_001301320.1|2474639_2475275_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|2475402_2475921_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449030.1|2475900_2476344_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189314.1|2476394_2476697_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 169
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2482399	2484289	4829265		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|2482399_2484289_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 170
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2489770	2496409	4829265		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|2489770_2492443_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|2492467_2493955_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|2493982_2494435_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_077491468.1|2495065_2496409_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.1	3.1e-63
>prophage 171
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2500491	2503364	4829265	protease	Pandoravirus(50.0%)	2	NA	NA
WP_160268076.1|2500491_2501340_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.7	2.6e-23
WP_001107467.1|2501429_2503364_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 172
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2510138	2511617	4829265		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|2510138_2511110_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|2511338_2511617_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 173
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2515685	2530479	4829265		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|2515685_2516495_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922901.1|2516704_2517682_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|2517695_2518682_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_077492783.1|2518702_2519269_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.1e-54
WP_000030537.1|2519265_2519841_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|2519809_2520367_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|2520373_2521099_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809057.1|2521146_2522580_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|2522602_2522890_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|2523007_2523499_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|2523544_2524399_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|2524395_2524668_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620410.1|2524880_2525513_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047093.1|2525509_2526238_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001300411.1|2526234_2526888_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|2527117_2529454_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299745.1|2529549_2530479_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 174
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2537724	2621079	4829265	tail,protease,holin,portal,integrase,transposase,tRNA,head,capsid,terminase	uncultured_Caudovirales_phage(43.48%)	81	2590390:2590407	2603423:2603440
WP_077492695.1|2537724_2538030_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000979881.1|2538105_2538570_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_124326270.1|2538566_2539442_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_001300570.1|2539438_2540128_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108459.1|2540175_2541666_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
WP_000224714.1|2541774_2542668_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000523845.1|2542789_2543581_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000467018.1|2543960_2545328_+	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_000366129.1|2545370_2545868_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
WP_000257293.1|2545873_2546512_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|2546906_2547299_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000847559.1|2547314_2547743_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_077492697.1|2547961_2549089_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_001295270.1|2549282_2549681_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_001295271.1|2549834_2551202_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497724.1|2551291_2552359_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295272.1|2552420_2553359_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_001257846.1|2553793_2554264_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000695690.1|2554628_2554892_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_001029013.1|2554947_2555220_-	barnase inhibitor	NA	NA	NA	NA	NA
WP_000510962.1|2555311_2557279_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_000854033.1|2557284_2558217_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_000051841.1|2558224_2558428_-	AaeX family protein	NA	NA	NA	NA	NA
WP_000440317.1|2558610_2559540_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_000055909.1|2559673_2561119_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_077491997.1|2561548_2565349_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_000123197.1|2565416_2566886_-	ribonuclease G	NA	NA	NA	NA	NA
WP_077491995.1|2566875_2567469_-	nucleoside triphosphate pyrophosphatase YhdE	NA	NA	NA	NA	NA
WP_000179409.1|2567477_2567966_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000802516.1|2567965_2569069_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|2569134_2570178_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_001241469.1|2570482_2572423_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_001148481.1|2572574_2573549_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000354622.1|2575229_2575700_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_000884639.1|2575710_2577060_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_000381173.1|2577168_2577411_+	YhdT family protein	NA	NA	NA	NA	NA
WP_001175728.1|2577400_2578852_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_160268077.1|2578863_2579745_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_001219652.1|2580073_2581039_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|2581064_2581361_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_001549737.1|2581515_2581707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085075977.1|2581709_2583371_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_047732336.1|2583354_2583711_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	94.9	1.4e-58
WP_112978729.1|2583984_2584428_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	92.5	1.5e-78
WP_023304515.1|2584427_2584721_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	82.5	3.2e-42
WP_001549741.1|2584713_2585052_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	47.7	1.5e-22
WP_160268128.1|2585048_2586230_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.9	8.9e-224
WP_085075981.1|2586285_2586846_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	97.8	2.2e-100
WP_112891118.1|2586897_2588064_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	97.7	8.6e-211
WP_019077815.1|2588297_2588561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160268078.1|2588962_2591404_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	38.5	9.1e-138
2590390:2590407	attL	CGGCTTCCCCCTGAATCT	NA	NA	NA	NA
WP_032236944.1|2591396_2591738_-	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	50.9	6.5e-26
WP_160268079.1|2591747_2592374_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	35.2	6.5e-24
WP_160268080.1|2592370_2592634_-|holin	nicotinic acetylcholine receptor subunit beta	holin	NA	NA	NA	NA
WP_160268081.1|2592630_2592945_-	ubiquinol-cytochrome C reductase	NA	NA	NA	NA	NA
WP_063116021.1|2592941_2593121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160268082.1|2593113_2593884_-	ash family protein	NA	NA	NA	NA	NA
WP_146826412.1|2593880_2594054_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_160268083.1|2594046_2594763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112978734.1|2594783_2595068_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_112978735.1|2595162_2595981_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	28.6	6.1e-22
WP_112978736.1|2596073_2597300_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	63.6	2.3e-153
WP_001258917.1|2597570_2598455_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.5	6.4e-25
WP_001295275.1|2598538_2598718_+	DUF2556 domain-containing protein	NA	NA	NA	NA	NA
WP_001129518.1|2598720_2599383_-	multidrug efflux transporter transcriptional repressor AcrS	NA	NA	NA	NA	NA
WP_000160334.1|2599780_2600938_+	multidrug efflux RND transporter periplasmic adaptor subunit AcrE	NA	NA	NA	NA	NA
WP_001273221.1|2600949_2604054_+	multidrug efflux RND transporter permease subunit AcrF	NA	NA	NA	NA	NA
2603423:2603440	attR	AGATTCAGGGGGAAGCCG	NA	NA	NA	NA
WP_000825639.1|2604306_2604528_+	membrane protein	NA	NA	NA	NA	NA
WP_077491994.1|2604958_2605984_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
WP_000019655.1|2606051_2607233_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001301413.1|2607242_2608346_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078349.1|2608353_2609112_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
WP_001286216.1|2615153_2615708_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_001070563.1|2615683_2615941_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_000451243.1|2615937_2616756_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001301412.1|2616760_2617333_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_001129722.1|2617337_2617880_-	ssDNA-binding protein, function unknown	NA	NA	NA	NA	NA
WP_000460680.1|2617908_2618382_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_000228551.1|2618353_2619478_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000114984.1|2619607_2620117_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004473.1|2620131_2621079_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 175
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2642294	2644247	4829265		Vibrio_phage(100.0%)	1	NA	NA
WP_085452725.1|2642294_2644247_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.6	2.0e-31
>prophage 176
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2653077	2661636	4829265		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_001402584.1|2653077_2655771_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	8.7e-41
WP_000031783.1|2656062_2657247_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|2657317_2659432_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|2659528_2659999_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|2660095_2660470_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001753123.1|2660595_2660883_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_001753124.1|2660890_2661250_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	6.2e-11
WP_001209689.1|2661249_2661636_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	3.3e-18
>prophage 177
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2667221	2676762	4829265		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|2667221_2669135_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_001753125.1|2669134_2670157_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|2670150_2670369_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|2670422_2671292_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148910.1|2671346_2671751_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|2672052_2672685_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|2672735_2674826_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_077492861.1|2674892_2676113_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_085452727.1|2676198_2676762_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.3	6.0e-61
>prophage 178
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2701010	2701847	4829265		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|2701010_2701847_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 179
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2718751	2722518	4829265		Bacillus_phage(66.67%)	3	NA	NA
WP_001265681.1|2718751_2720374_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_001253696.1|2720449_2721802_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|2721798_2722518_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 180
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2729081	2729960	4829265		Sodalis_phage(100.0%)	1	NA	NA
WP_000039063.1|2729081_2729960_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 181
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2735929	2738323	4829265		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081903.1|2735929_2738323_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 182
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2742701	2743928	4829265		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105503.1|2742701_2743928_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	59.5	1.3e-132
>prophage 183
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2752836	2755284	4829265		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|2752836_2755284_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 184
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2775294	2777105	4829265		Enterococcus_phage(50.0%)	2	NA	NA
WP_124326267.1|2775294_2776038_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	2.2e-10
WP_000907792.1|2776034_2777105_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 185
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2780646	2782129	4829265		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416900.1|2780646_2781360_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|2781361_2782129_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 186
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2787862	2790681	4829265		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|2787862_2788717_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|2788961_2790020_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617726.1|2790012_2790681_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	3.8e-14
>prophage 187
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2793687	2797819	4829265		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|2793687_2794314_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_077491530.1|2794387_2796586_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	3.2e-118
WP_000130621.1|2796687_2796933_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001103663.1|2797153_2797819_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	54.8	3.1e-56
>prophage 188
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2805712	2811364	4829265		Bacillus_virus(50.0%)	3	NA	NA
WP_000173665.1|2805712_2806519_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
WP_001190062.1|2806524_2806926_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_127790586.1|2807128_2811364_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.9	2.1e-25
>prophage 189
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2814739	2817475	4829265		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149156.1|2814739_2817475_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
>prophage 190
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2831078	2833121	4829265		Indivirus(100.0%)	1	NA	NA
WP_001298719.1|2831078_2833121_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 191
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2836466	2838601	4829265		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008957.1|2836466_2836820_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_077492218.1|2836873_2838163_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.3	1.7e-172
WP_000065769.1|2838175_2838601_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
>prophage 192
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2841994	2842642	4829265		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|2841994_2842642_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 193
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2889560	2891545	4829265		Bacillus_virus(50.0%)	2	NA	NA
WP_000107012.1|2889560_2890565_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196486.1|2890561_2891545_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 194
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2901757	2904091	4829265		Escherichia_phage(100.0%)	1	NA	NA
WP_000013960.1|2901757_2904091_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.8	3.1e-71
>prophage 195
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2907745	2909745	4829265	transposase	Morganella_phage(50.0%)	3	NA	NA
WP_000014594.1|2907745_2907958_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_001135732.1|2908144_2908297_-	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_160268091.1|2908376_2909745_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	2.2e-112
>prophage 196
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2913583	2914579	4829265		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_077491568.1|2913583_2914579_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	7.0e-12
>prophage 197
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2919897	2921439	4829265		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146479.1|2919897_2921439_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 198
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2945713	2954109	4829265	tRNA	Tupanvirus(50.0%)	4	NA	NA
WP_000582468.1|2945713_2947558_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.7	5.6e-15
WP_000206275.1|2947554_2948946_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|2949043_2949652_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_160268092.1|2949879_2954109_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	45.8	1.7e-22
>prophage 199
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2970133	2979688	4829265		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|2970133_2970385_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|2970526_2970958_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116565.1|2971202_2972747_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|2972756_2974040_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483856.1|2974043_2975003_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982093.1|2974989_2976024_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000645982.1|2976262_2977288_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_160268095.1|2977297_2978494_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	8.4e-36
WP_000587766.1|2978707_2979688_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.2e-35
>prophage 200
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	2994853	2999416	4829265		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171873.1|2994853_2995333_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
WP_001114529.1|2995371_2996181_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|2996278_2996446_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|2996466_2996703_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001298959.1|2996919_2997588_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050139.1|2997759_2998980_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001298007.1|2998960_2999416_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
>prophage 201
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3002789	3009540	4829265		Morganella_phage(25.0%)	6	NA	NA
WP_001336364.1|3002789_3003614_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	78.0	2.5e-95
WP_000924289.1|3003905_3004523_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_077491809.1|3004519_3006202_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	1.1e-22
WP_001295237.1|3006459_3007083_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|3007137_3007413_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|3007431_3009540_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 202
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3013973	3015365	4829265		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|3013973_3015365_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 203
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3027467	3028802	4829265		Moraxella_phage(100.0%)	1	NA	NA
WP_001403836.1|3027467_3028802_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	1.1e-65
>prophage 204
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3036108	3045129	4829265		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_000168475.1|3036108_3037797_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
WP_001300753.1|3037902_3038001_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_001054909.1|3038565_3038655_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|3038934_3040119_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148061.1|3040126_3040624_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|3040620_3040983_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|3040972_3041320_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511289.1|3041427_3041877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828527.1|3041923_3043417_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.6	2.3e-30
WP_001087145.1|3043413_3045129_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 205
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3051481	3052435	4829265		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|3051481_3051910_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|3052021_3052435_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 206
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3056862	3058011	4829265		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|3056862_3058011_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 207
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3062717	3070086	4829265		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|3062717_3065132_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|3065160_3066234_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|3066233_3067334_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|3067338_3068742_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|3069038_3069119_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|3069348_3069489_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|3069505_3069865_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|3069828_3070086_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 208
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3080284	3081622	4829265		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|3080284_3081622_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 209
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3092611	3100218	4829265		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|3092611_3093385_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251978.1|3093567_3094458_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|3094457_3095417_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|3095502_3096543_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334099.1|3096856_3098686_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000933736.1|3098847_3100218_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 210
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3112172	3113165	4829265		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845104.1|3112172_3113165_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 211
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3116333	3122186	4829265		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|3116333_3118202_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_085452748.1|3118368_3118788_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_085452746.1|3118795_3120301_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|3120305_3121271_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|3121295_3122186_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 212
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3135578	3137225	4829265		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012619.1|3135578_3137225_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	1.1e-67
>prophage 213
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3145698	3151110	4829265		Bacillus_phage(33.33%)	4	NA	NA
WP_001238884.1|3145698_3147720_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	4.9e-113
WP_001299253.1|3147766_3149251_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|3149384_3150650_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|3150780_3151110_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 214
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3155152	3161296	4829265		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866670.1|3155152_3156283_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
WP_000006621.1|3156279_3157542_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_021574853.1|3157541_3158609_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	3.9e-101
WP_000676056.1|3158627_3159509_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145168.1|3159486_3160161_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612044.1|3160165_3161296_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 215
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3169370	3171026	4829265		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395844.1|3169370_3171026_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 216
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3181324	3185183	4829265		Bacillus_phage(100.0%)	3	NA	NA
WP_000130686.1|3181324_3182221_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	1.1e-24
WP_001213584.1|3182220_3182937_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383406.1|3183020_3185183_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 217
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3190899	3192729	4829265		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|3190899_3192729_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 218
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3219305	3222592	4829265		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_077491766.1|3219305_3220946_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
WP_001295260.1|3221024_3221294_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|3221297_3221813_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|3221815_3222592_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 219
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3231473	3232088	4829265		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|3231473_3232088_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 220
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3245776	3248563	4829265		uncultured_virus(100.0%)	1	NA	NA
WP_000250007.1|3245776_3248563_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	2.2e-71
>prophage 221
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3252638	3255109	4829265		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|3252638_3254048_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|3254059_3255109_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 222
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3271213	3273993	4829265		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718901.1|3271213_3272110_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_000621647.1|3272277_3273174_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|3273207_3273993_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 223
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3281310	3284361	4829265		Escherichia_phage(100.0%)	1	NA	NA
WP_010723259.1|3281310_3284361_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 224
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3301143	3306004	4829265		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001297064.1|3301143_3301764_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166063.1|3302023_3303007_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_032255224.1|3303155_3303830_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|3303935_3305309_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|3305305_3306004_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 225
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3317578	3322081	4829265		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|3317578_3318424_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3318848_3319094_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|3319178_3319664_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|3319756_3320683_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_085452754.1|3320749_3322081_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 226
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3339379	3346626	4829265		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424840.1|3339379_3340042_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001174077.1|3340053_3342555_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_160268099.1|3342863_3343943_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|3343957_3344278_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_004025950.1|3344328_3346626_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 227
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3363726	3365565	4829265		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591383.1|3363726_3365565_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	30.2	3.5e-09
>prophage 228
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3373903	3376956	4829265		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|3373903_3374854_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|3375771_3376956_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 229
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3381072	3389401	4829265		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|3381072_3385101_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|3385177_3389401_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 230
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3398618	3400382	4829265		Klosneuvirus(50.0%)	3	NA	NA
WP_077492234.1|3398618_3399290_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.2	6.8e-19
WP_000940106.1|3399332_3399923_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|3400109_3400382_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 231
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3405744	3407334	4829265		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187559.1|3405744_3407334_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 232
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3422888	3426572	4829265		Dickeya_phage(100.0%)	1	NA	NA
WP_000095995.1|3422888_3426572_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 233
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3445857	3446973	4829265		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|3445857_3446973_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 234
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3456188	3456797	4829265		Lactococcus_phage(100.0%)	1	NA	NA
WP_040073667.1|3456188_3456797_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 235
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3463418	3465966	4829265		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|3463418_3464834_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147328.1|3464886_3465966_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 236
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3470153	3473766	4829265		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|3470153_3472976_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|3473229_3473766_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 237
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3477583	3478933	4829265		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|3477583_3478933_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 238
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3484519	3486478	4829265		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|3484519_3486478_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 239
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3496100	3498248	4829265		Escherichia_phage(100.0%)	1	NA	NA
WP_077492074.1|3496100_3498248_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.7	4.5e-32
>prophage 240
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3503493	3509868	4829265		Tetraselmis_virus(50.0%)	5	NA	NA
WP_077492078.1|3503493_3505485_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	1.2e-148
WP_077492080.1|3505757_3506687_-	allose kinase	NA	NA	NA	NA	NA
WP_001311314.1|3506670_3507366_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000507106.1|3507376_3508357_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_000235257.1|3508335_3509868_-	D-allose import ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	4.4e-13
>prophage 241
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3516102	3517652	4829265		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_077492634.1|3516102_3516783_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	2.1e-07
WP_077492636.1|3516893_3517652_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.4e-15
>prophage 242
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3523240	3524029	4829265		Pithovirus(100.0%)	1	NA	NA
WP_077492642.1|3523240_3524029_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.3	5.5e-12
>prophage 243
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3528966	3530469	4829265		Burkholderia_virus(100.0%)	1	NA	NA
WP_001298520.1|3528966_3530469_+	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 244
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3551665	3554877	4829265	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295074.1|3551665_3553183_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856841.1|3553419_3554877_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	8.9e-48
>prophage 245
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3563405	3565576	4829265		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692300.1|3563405_3563627_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
WP_001186171.1|3563689_3564166_-	RadC family protein	NA	NA	NA	NA	NA
WP_000206670.1|3564180_3564666_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	1.2e-12
WP_001175163.1|3564757_3565576_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.1	1.9e-47
>prophage 246
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3595981	3597247	4829265	integrase	Enterobacteria_phage(100.0%)	1	3585433:3585447	3607098:3607112
3585433:3585447	attL	ATCTTCAACGCGTGC	NA	NA	NA	NA
WP_001218862.1|3595981_3597247_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.7e-77
WP_001218862.1|3595981_3597247_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.7e-77
3607098:3607112	attR	GCACGCGTTGAAGAT	NA	NA	NA	NA
>prophage 247
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3605581	3607565	4829265		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|3605581_3605875_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3605918_3607565_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 248
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3612070	3612604	4829265		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|3612070_3612604_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 249
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3617524	3618502	4829265		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|3617524_3618502_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 250
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3625929	3626475	4829265		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|3625929_3626475_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 251
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3630511	3643535	4829265	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
WP_000990333.1|3630511_3631849_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_085452760.1|3631858_3633706_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|3633698_3634649_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3634734_3635043_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|3635118_3636399_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|3636484_3637744_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3637746_3638751_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3638825_3639023_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3639126_3640425_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177644.1|3640629_3641055_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076332.1|3641093_3643535_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
>prophage 252
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3690185	3696672	4829265		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_000055070.1|3690185_3690716_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_077492816.1|3691025_3691982_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_088568440.1|3692121_3693624_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001367906.1|3693637_3694660_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000853753.1|3695673_3696672_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 253
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3700987	3703749	4829265		Cronobacter_phage(50.0%)	2	NA	NA
WP_001106238.1|3700987_3701452_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000187778.1|3701610_3703749_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 254
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3707387	3713484	4829265		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|3707387_3708335_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|3708519_3708573_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471889.1|3708713_3711410_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|3711615_3712002_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3712074_3712536_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|3712548_3713484_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 255
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3721763	3731968	4829265	tRNA	Klosneuvirus(25.0%)	7	NA	NA
WP_000416392.1|3721763_3724619_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_001188289.1|3724618_3725101_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3725195_3726707_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|3726973_3728074_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|3728073_3729156_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_077492337.1|3729316_3730819_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	3.6e-84
WP_077492339.1|3730948_3731968_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	7.1e-44
>prophage 256
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3738305	3743276	4829265	transposase	Acinetobacter_phage(33.33%)	4	NA	NA
WP_085947771.1|3738305_3739467_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_095086384.1|3739495_3739723_-	type I restriction endonuclease subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	8.1e-09
WP_024225535.1|3740029_3740863_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_047624341.1|3741221_3743276_+	McrB family protein	NA	K4I1H4	Acidithiobacillus_phage	31.0	1.4e-27
>prophage 257
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3746312	3747293	4829265		Escherichia_phage(100.0%)	1	NA	NA
WP_077492521.1|3746312_3747293_-	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	55.4	5.5e-102
>prophage 258
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3750655	3752332	4829265		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|3750655_3751258_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|3751735_3752332_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 259
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3761458	3762919	4829265		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208195.1|3761458_3762919_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 260
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3769486	3770041	4829265		Clostridioides_phage(100.0%)	1	NA	NA
WP_077492206.1|3769486_3770041_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.0	7.8e-37
>prophage 261
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3777542	3779848	4829265	transposase	Sodalis_phage(50.0%)	2	NA	NA
WP_001406770.1|3777542_3778499_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	1.7e-60
WP_085947771.1|3778686_3779848_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 262
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3785341	3793217	4829265	transposase	Enterobacteria_phage(50.0%)	2	NA	NA
WP_088172348.1|3785341_3786555_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.0	5.1e-166
WP_085452768.1|3786872_3793217_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.0	5.1e-47
>prophage 263
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3819521	3824888	4829265		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919544.1|3819521_3821186_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_160268107.1|3821234_3822596_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091573.1|3822812_3823727_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106021.1|3823865_3824888_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.7	2.7e-11
>prophage 264
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3828115	3829395	4829265		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|3828115_3828853_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|3828855_3829395_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 265
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3837324	3840200	4829265		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|3837324_3838914_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|3839306_3839912_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3840038_3840200_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 266
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3846239	3847562	4829265		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|3846239_3847562_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 267
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3854282	3859637	4829265		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093810.1|3854282_3855515_+	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|3855821_3857489_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409451.1|3857699_3859637_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 268
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3862979	3865093	4829265		Bacillus_phage(50.0%)	2	NA	NA
WP_001188664.1|3862979_3863669_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
WP_001219614.1|3863668_3865093_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
>prophage 269
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3876860	3888350	4829265	transposase	Cyanophage(16.67%)	11	NA	NA
WP_000130185.1|3876860_3877814_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001295414.1|3877928_3878516_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528539.1|3878550_3879117_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102383.1|3879265_3879979_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843568.1|3880004_3880409_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|3880785_3882702_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118446.1|3882790_3883921_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_001300563.1|3884183_3885296_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001181672.1|3885373_3885583_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_012478345.1|3885777_3886752_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_085452772.1|3887183_3888350_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.5	4.6e-87
>prophage 270
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3895381	3898198	4829265	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286865.1|3895381_3898198_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 271
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3902641	3903790	4829265		Halovirus(100.0%)	1	NA	NA
WP_001351917.1|3902641_3903790_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.3e-49
>prophage 272
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3909384	3915045	4829265		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000351353.1|3909384_3910938_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	1.6e-34
WP_000349924.1|3911011_3912229_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|3912357_3913500_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|3913530_3915045_-	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 273
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3922925	3924325	4829265		Bacillus_phage(50.0%)	2	NA	NA
WP_000624375.1|3922925_3923405_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257192.1|3923482_3924325_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 274
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3932069	3937492	4829265		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|3932069_3934976_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035670.1|3935140_3937492_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
>prophage 275
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3943940	3944639	4829265		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916325.1|3943940_3944639_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 276
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3957341	3959066	4829265		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425661.1|3957341_3959066_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 277
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3985155	3986199	4829265		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|3985155_3986199_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 278
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3990444	3990996	4829265		Sphingobium_phage(100.0%)	1	NA	NA
WP_077491379.1|3990444_3990996_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 279
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	3999623	4001048	4829265		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|3999623_4001048_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 280
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4008698	4015321	4829265		Mamastrovirus(33.33%)	5	NA	NA
WP_001189647.1|4008698_4010249_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001306211.1|4010450_4012841_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|4013046_4013583_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|4013623_4014286_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|4014394_4015321_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 281
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4018583	4019486	4829265	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000339954.1|4018583_4019486_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.2	7.4e-61
>prophage 282
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4029344	4036150	4829265	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174643.1|4029344_4030763_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_085452778.1|4030801_4031728_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|4031764_4032220_-	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
WP_000396036.1|4032397_4033102_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294693.1|4033116_4033647_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001300640.1|4033720_4036150_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.9	7.9e-41
>prophage 283
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4041393	4042191	4829265		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|4041393_4042191_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 284
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4048225	4048570	4829265		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|4048225_4048570_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 285
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4052499	4053924	4829265	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_085452780.1|4052499_4053924_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	5.5e-26
>prophage 286
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4066521	4134936	4829265	protease,plate,tRNA,transposase	Flavobacterium_phage(10.0%)	60	NA	NA
WP_001295562.1|4066521_4067280_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922446.1|4067292_4068150_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001295561.1|4068161_4069514_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|4069543_4071976_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|4072097_4072583_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|4072586_4073612_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4073716_4074172_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|4074175_4074964_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139654.1|4074963_4076112_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|4076108_4076705_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|4076741_4080224_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055746.1|4080236_4081196_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020950.1|4081294_4083436_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|4083492_4083882_+	VOC family protein	NA	NA	NA	NA	NA
WP_085452781.1|4083946_4085245_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|4085293_4085554_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|4085540_4085741_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|4085906_4086452_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635543.1|4086448_4086871_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_077491944.1|4086884_4087595_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_077491942.1|4087794_4088619_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|4088671_4090390_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|4090500_4091208_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|4091204_4091609_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|4091726_4092542_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|4092581_4093235_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|4093227_4094259_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_077492397.1|4094446_4095019_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997050.1|4100862_4101666_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	1.4e-39
WP_000648577.1|4101662_4102577_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|4102817_4103618_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000016012.1|4103621_4104245_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000644685.1|4104292_4105651_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_077492736.1|4105722_4106478_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|4106511_4107234_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|4107230_4107698_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|4107762_4108494_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|4109029_4109815_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|4109951_4110431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|4110440_4111355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|4111398_4111881_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_077492735.1|4112711_4113992_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|4114016_4115099_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_077492734.1|4115062_4116913_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|4116916_4117330_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056989.1|4117336_4118812_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|4118862_4119087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037397.1|4119121_4119622_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001101841.1|4124221_4124440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420818.1|4125043_4126180_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_160268112.1|4126220_4126991_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|4127144_4127618_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973083.1|4127660_4130105_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000284050.1|4130344_4130923_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333379.1|4131128_4131896_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|4131866_4132607_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615979.1|4132762_4133041_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|4133043_4133304_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001353765.1|4133489_4134263_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000006261.1|4134438_4134936_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
>prophage 287
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4144990	4149799	4829265		Streptococcus_phage(50.0%)	4	NA	NA
WP_053901249.1|4144990_4146046_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	3.1e-119
WP_001285288.1|4146333_4147437_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|4147448_4148702_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001310565.1|4149217_4149799_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	88.1	2.7e-96
>prophage 288
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4158592	4159702	4829265		Planktothrix_phage(100.0%)	1	NA	NA
WP_016243364.1|4158592_4159702_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.0	3.3e-26
>prophage 289
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4168875	4169946	4829265		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000837747.1|4168875_4169946_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.2	5.1e-69
>prophage 290
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4177322	4188823	4829265	integrase,transposase	Acinetobacter_phage(50.0%)	14	4179224:4179236	4182196:4182208
WP_000692307.1|4177322_4177544_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_016243360.1|4177706_4178081_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854695.1|4178127_4178505_+	toxin	NA	NA	NA	NA	NA
WP_000761710.1|4178501_4178990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839228.1|4179001_4179199_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
4179224:4179236	attL	ACTGACGCCAGCC	NA	NA	NA	NA
WP_001280536.1|4179283_4180132_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000144689.1|4180224_4181544_-|integrase	site-specific integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	23.4	1.5e-17
WP_001111356.1|4181881_4182292_-	hypothetical protein	NA	NA	NA	NA	NA
4182196:4182208	attR	ACTGACGCCAGCC	NA	NA	NA	NA
WP_077491620.1|4182270_4183227_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_124326293.1|4183236_4185435_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	5.1e-39
WP_000643332.1|4185431_4186388_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_001543517.1|4186384_4187074_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_159189442.1|4187491_4187647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|4187660_4188823_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 291
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4205004	4206330	4829265		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001046307.1|4205004_4206330_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
>prophage 292
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4211905	4217825	4829265	holin	Catovirus(50.0%)	4	NA	NA
WP_077491948.1|4211905_4213576_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	3.6e-61
WP_000089084.1|4213589_4215062_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001301261.1|4215075_4215663_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|4215791_4217825_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 293
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4226587	4227487	4829265		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952503.1|4226587_4227487_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 294
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4232027	4236307	4829265		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_124326228.1|4232027_4235102_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	99.6	0.0e+00
WP_001752175.1|4235224_4236307_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	99.4	8.3e-192
>prophage 295
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4241717	4243678	4829265		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044314.1|4241717_4242668_+	acetaldehyde dehydrogenase (acetylating)	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013499.1|4242664_4243678_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 296
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4247057	4248167	4829265		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|4247057_4248167_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 297
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4253464	4254232	4829265		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939399.1|4253464_4254232_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-25
>prophage 298
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4261196	4262354	4829265		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830738.1|4261196_4262354_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 299
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4269769	4270885	4829265		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|4269769_4270885_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 300
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4275174	4285144	4829265		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|4275174_4276086_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219309.1|4276210_4277119_+	fructokinase	NA	NA	NA	NA	NA
WP_001326926.1|4277259_4278444_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_038988620.1|4278569_4281713_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221319.1|4281709_4282912_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|4283101_4283791_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893580.1|4283848_4285144_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	2.9e-26
>prophage 301
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4292096	4301076	4829265	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|4292096_4293224_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|4293246_4293579_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|4293606_4295454_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|4295464_4296436_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|4296563_4296911_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|4297087_4297972_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001301329.1|4298270_4298810_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|4298960_4299410_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150456.1|4299413_4300517_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	1.7e-54
WP_001021161.1|4300605_4301076_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 302
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4324907	4329954	4829265	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|4324907_4325531_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|4325656_4326931_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|4327118_4329473_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_160268116.1|4329681_4329954_+	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	60.7	8.5e-21
>prophage 303
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4333082	4333778	4829265		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|4333082_4333778_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 304
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4337101	4340648	4829265		Bacillus_phage(100.0%)	2	NA	NA
WP_001235579.1|4337101_4338874_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	3.4e-49
WP_075700091.1|4338866_4340648_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
>prophage 305
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4349484	4352634	4829265		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|4349484_4352634_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 306
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4359642	4368204	4829265		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|4359642_4360194_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_160268118.1|4360322_4362254_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|4362306_4362636_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|4362635_4363241_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|4363350_4365225_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|4365405_4366050_+	adenylate kinase	NA	NA	NA	NA	NA
WP_077491502.1|4366285_4367248_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801813.1|4367244_4368204_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	3.8e-15
>prophage 307
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4376448	4379711	4829265		Escherichia_phage(50.0%)	2	NA	NA
WP_001338329.1|4376448_4376790_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	2.5e-41
WP_000083955.1|4377206_4379711_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
>prophage 308
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4384250	4384928	4829265		Bacillus_virus(100.0%)	1	NA	NA
WP_001157540.1|4384250_4384928_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
>prophage 309
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4388064	4466384	4829265	tail,protease,integrase,tRNA,transposase	Enterobacteria_phage(18.75%)	62	4433037:4433083	4444636:4444682
WP_001110573.1|4388064_4388751_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561866.1|4388747_4391162_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_160268119.1|4391592_4395873_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|4395912_4396281_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|4396971_4397232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|4398463_4399558_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|4399626_4400553_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|4400782_4401265_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|4401342_4402158_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|4402247_4404029_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|4404041_4404818_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|4404917_4405796_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|4405964_4407419_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|4407478_4408840_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|4408896_4410198_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_085452618.1|4410219_4411365_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
WP_000540943.1|4411592_4412378_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001468137.1|4412388_4413624_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703918.1|4413645_4414695_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580830.1|4415011_4416679_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495365.1|4416688_4417948_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001306952.1|4417958_4418774_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855378.1|4418770_4419664_+	carbamate kinase	NA	NA	NA	NA	NA
WP_021577110.1|4419802_4420870_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|4420866_4421376_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212253.1|4421493_4422216_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|4422218_4422713_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|4422886_4424272_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143558.1|4424307_4424829_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190292.1|4424936_4425149_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|4425150_4426017_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|4426487_4427030_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_077491460.1|4427249_4427942_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001358768.1|4427972_4430582_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|4430560_4431601_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_077491458.1|4431611_4432127_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805422.1|4432129_4432762_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
4433037:4433083	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001299447.1|4433096_4434260_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_085452741.1|4434369_4435122_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	92.9	3.0e-92
WP_016245257.1|4435313_4435802_+	GIY-YIG nuclease family protein	NA	K7P7S3	Enterobacteria_phage	99.4	1.6e-86
WP_000079508.1|4436480_4436891_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001309326.1|4436948_4437182_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_001704483.1|4440092_4440677_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	5.0e-103
WP_122985473.1|4440731_4441400_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004030176.1|4443258_4444212_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001160804.1|4446132_4446594_-	DcrB-related protein	NA	NA	NA	NA	NA
4444636:4444682	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_112902313.1|4446621_4448523_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.9	3.5e-28
WP_000253838.1|4449259_4450708_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000770953.1|4450697_4451381_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000074231.1|4451537_4452911_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709870.1|4453068_4453401_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717157.1|4453416_4454640_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_085452621.1|4454651_4457795_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.0	6.4e-59
WP_000786320.1|4457896_4459273_+	aromatic amino acid transporter AroP	NA	NA	NA	NA	NA
WP_001153148.1|4459340_4460588_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000351475.1|4460695_4461349_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_077492015.1|4461442_4461811_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_077492017.1|4461875_4462124_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_001130654.1|4462189_4463308_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_088538165.1|4463575_4464944_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	2.2e-112
WP_000956455.1|4465042_4465195_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001300563.1|4465271_4466384_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
>prophage 310
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4471363	4477406	4829265		Tupanvirus(50.0%)	3	NA	NA
WP_085452622.1|4471363_4475245_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
WP_000096692.1|4475460_4476594_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|4476590_4477406_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 311
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4491952	4493775	4829265		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502936.1|4491952_4492582_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	3.8e-56
WP_160268120.1|4492554_4493775_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	6.1e-58
>prophage 312
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4496958	4499073	4829265		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|4496958_4498524_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278509.1|4498644_4499073_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 313
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4514497	4515144	4829265		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|4514497_4514707_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|4514760_4515144_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 314
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4519958	4522398	4829265		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|4519958_4521170_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_077491853.1|4521309_4522398_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 315
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4529408	4531991	4829265	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001297565.1|4529408_4531991_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 316
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4538931	4542464	4829265		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367875.1|4538931_4540602_-	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.6	4.0e-76
WP_001207520.1|4540685_4541621_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|4541738_4542464_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 317
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4548347	4549427	4829265		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|4548347_4549427_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 318
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4553522	4555187	4829265		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337081.1|4553522_4555187_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	7.9e-85
>prophage 319
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4559953	4563832	4829265	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023104.1|4559953_4561900_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|4562167_4563832_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 320
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4568112	4568877	4829265		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773301.1|4568112_4568877_-	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 321
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4577224	4587427	4829265	transposase	Bacillus_phage(25.0%)	8	NA	NA
WP_032237698.1|4577224_4577902_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	3.4e-26
WP_001310640.1|4577898_4580583_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_001300431.1|4580575_4581148_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001752279.1|4581156_4583205_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
WP_000741131.1|4583227_4584901_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|4584900_4584990_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424924.1|4585302_4585509_+	YbfA family protein	NA	NA	NA	NA	NA
WP_088538165.1|4586057_4587427_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	2.2e-112
>prophage 322
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4597897	4600947	4829265		Hokovirus(50.0%)	2	NA	NA
WP_077492375.1|4597897_4599316_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.2	2.0e-60
WP_001032689.1|4599465_4600947_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 323
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4604325	4605117	4829265		Kaumoebavirus(100.0%)	1	NA	NA
WP_001113989.1|4604325_4605117_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.5	7.5e-09
>prophage 324
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4641249	4644769	4829265		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|4641249_4641969_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951292.1|4641965_4642907_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|4643020_4643401_-	periplasmic protein	NA	NA	NA	NA	NA
WP_001109196.1|4643716_4644769_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 325
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4649122	4655696	4829265		Tupanvirus(33.33%)	7	NA	NA
WP_001265438.1|4649122_4650139_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
WP_000096875.1|4650399_4651872_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	27.9	3.6e-12
WP_001147439.1|4651939_4652728_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|4652856_4653006_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_000101984.1|4653172_4653946_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|4653945_4654635_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891692.1|4654637_4655696_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
>prophage 326
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4666051	4667341	4829265		Klosneuvirus(100.0%)	1	NA	NA
WP_001300379.1|4666051_4667341_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	7.7e-19
>prophage 327
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4673822	4674731	4829265		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|4673822_4674731_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 328
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4685328	4700140	4829265		Anomala_cuprea_entomopoxvirus(14.29%)	13	NA	NA
WP_000996107.1|4685328_4687065_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000743444.1|4687057_4688053_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|4688055_4688727_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007101.1|4688955_4690320_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145126.1|4690551_4691034_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
WP_001340191.1|4691153_4693304_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_000386551.1|4693331_4694294_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443530.1|4694434_4695520_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|4695748_4696009_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146343.1|4696273_4696540_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000990177.1|4696613_4697291_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_085452637.1|4697332_4699615_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_032279019.1|4699879_4700140_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 329
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4703824	4709049	4829265		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569083.1|4703824_4704547_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
WP_001159065.1|4704543_4705203_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|4705341_4706088_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|4706491_4706995_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|4707293_4708181_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|4708415_4708481_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|4708533_4709049_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 330
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4714046	4722387	4829265		Tupanvirus(33.33%)	6	NA	NA
WP_000961458.1|4714046_4715639_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000168797.1|4715878_4717144_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114272.1|4717295_4718111_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_077492832.1|4718256_4720689_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
WP_001295295.1|4720694_4721594_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_077492833.1|4721724_4722387_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.5	2.2e-25
>prophage 331
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4725602	4727474	4829265		Planktothrix_phage(100.0%)	1	NA	NA
WP_001301279.1|4725602_4727474_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 332
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4738809	4740012	4829265		Stx2-converting_phage(100.0%)	1	NA	NA
WP_077492841.1|4738809_4740012_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
>prophage 333
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4746950	4818513	4829265	tail,protease,integrase,tRNA	Salmonella_phage(35.14%)	69	4743561:4743576	4822225:4822240
4743561:4743576	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_001710106.1|4746950_4747418_-	SocA family protein	NA	A0A0N9SGM1	Paenibacillus_phage	36.8	1.9e-20
WP_032193092.1|4747583_4748603_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.1	1.4e-103
WP_001513672.1|4748791_4748983_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001047320.1|4748998_4749568_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.9e-39
WP_001247707.1|4749693_4749915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001710109.1|4749947_4750457_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956192.1|4750464_4750761_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000996717.1|4750878_4751220_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244228.1|4751287_4751521_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000752613.1|4751520_4751748_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001710110.1|4751744_4752602_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	1.4e-157
WP_124326175.1|4752598_4755013_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.3	0.0e+00
WP_001154434.1|4755165_4755354_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_024242286.1|4755365_4755599_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.8e-35
WP_024235280.1|4755922_4757596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001530927.1|4758491_4758953_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.2	7.4e-41
WP_124326176.1|4758952_4760452_+|tail	phage tail protein	tail	E5G6Q1	Salmonella_phage	77.6	5.8e-119
WP_000980413.1|4760448_4760934_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_104769354.1|4760930_4762031_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	87.2	3.4e-177
WP_044722442.1|4762121_4762340_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	67.6	1.7e-19
WP_001024876.1|4762575_4764261_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|4764530_4764908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195225.1|4764937_4765195_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	3.0e-23
WP_001201560.1|4765354_4765642_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001757244.1|4765625_4765925_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_085452640.1|4765928_4766348_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_000684321.1|4766408_4767311_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|4767398_4767875_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126073.1|4768225_4769338_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|4769432_4770566_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001093854.1|4770575_4771529_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061665.1|4771525_4772371_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|4772430_4772919_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149766.1|4772959_4774087_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.9	1.2e-28
WP_001295905.1|4774115_4774847_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|4775138_4775807_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|4775806_4776523_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|4776529_4777261_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|4777278_4778007_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_044863778.1|4778224_4778740_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|4778865_4779189_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255168.1|4779185_4780016_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001338420.1|4780012_4781026_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136560.1|4781124_4782555_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566372.1|4782565_4783567_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_104769297.1|4783603_4785322_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	4.0e-31
WP_000178677.1|4785454_4786423_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458809.1|4786434_4788087_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|4788230_4789130_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|4789624_4790320_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599806.1|4790744_4792403_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001355621.1|4792399_4793356_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746460.1|4793506_4794622_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188180.1|4794618_4796565_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|4796637_4796862_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4797184_4797505_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934040.1|4797535_4799812_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	2.5e-166
WP_001040187.1|4800671_4800890_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241677.1|4801174_4801879_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202201.1|4801920_4803642_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
WP_001043621.1|4803642_4805409_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_000537418.1|4805531_4806497_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|4807041_4807536_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_073544309.1|4807670_4811699_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|4811853_4812465_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|4812475_4813819_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|4813909_4815202_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850306.1|4815440_4817885_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|4817895_4818513_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
4822225:4822240	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 334
NZ_CP041628	Escherichia coli strain PE15 chromosome, complete genome	4829265	4824821	4829004	4829265	integrase	Escherichia_phage(62.5%)	8	4819021:4819032	4826771:4826782
4819021:4819032	attL	GTTGTTGAGTCT	NA	NA	NA	NA
WP_000067977.1|4824821_4825619_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023391.1|4825650_4826646_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000072552.1|4826739_4827051_-	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
4826771:4826782	attR	GTTGTTGAGTCT	NA	NA	NA	NA
WP_000022051.1|4827155_4827512_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_000217677.1|4827689_4828190_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000557703.1|4828253_4828478_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277957.1|4828477_4828780_+	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	99.0	2.2e-46
WP_001113270.1|4828779_4829004_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
>prophage 1
NZ_CP041630	Escherichia coli strain PE15 plasmid pPE15-92K, complete sequence	92595	0	92277	92595	tail,portal,transposase,terminase,head,integrase,holin	Escherichia_phage(60.44%)	92	973:991	92436:92454
WP_001076427.1|0_861_+	replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
973:991	attL	TTTCCCTCCAGCACACATC	NA	NA	NA	NA
WP_000817632.1|1260_2466_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	100.0	2.0e-226
WP_094307770.1|2462_3428_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	99.1	3.7e-167
WP_000067710.1|3693_5400_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	100.0	0.0e+00
WP_079918237.1|5460_7050_+	hypothetical protein	NA	A0A077SLN8	Escherichia_phage	99.8	1.3e-305
WP_000041761.1|7059_7875_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	9.8e-113
WP_001345489.1|8261_8492_+	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	98.7	3.0e-35
WP_053273039.1|8503_9013_+	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	98.8	1.1e-90
WP_001352007.1|9129_9285_-	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	90.2	4.0e-15
WP_001369095.1|9466_9712_-	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
WP_001379176.1|9762_10608_-	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	100.0	5.9e-153
WP_001187871.1|10637_11438_-	protein kilA	NA	Q1MVK4	Enterobacteria_phage	99.6	5.4e-148
WP_000743162.1|11601_12645_-	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	94.8	3.6e-176
WP_000245708.1|12641_12863_-	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	98.6	2.8e-38
WP_000039791.1|13482_13995_+	hypothetical protein	NA	A0A077SK39	Escherichia_phage	100.0	4.5e-55
WP_001033469.1|13998_14538_+	hypothetical protein	NA	A0A077SL46	Escherichia_phage	100.0	1.8e-46
WP_000188920.1|14618_15185_+	hypothetical protein	NA	A0A077SK12	Escherichia_phage	99.5	6.6e-100
WP_000523980.1|15195_15807_+	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_000926346.1|15821_16703_+	hypothetical protein	NA	Q71TC9	Escherichia_phage	99.7	6.3e-174
WP_113400431.1|16784_20207_+	transglycosylase SLT domain-containing protein	NA	A0A077SK38	Escherichia_phage	99.1	0.0e+00
WP_000002800.1|20206_20563_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_000047923.1|20559_21993_+	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	100.0	3.7e-272
WP_001189832.1|21992_22829_+	hypothetical protein	NA	A0A1B0V7F2	Salmonella_phage	100.0	1.4e-154
WP_001286325.1|22907_23342_+	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	99.3	7.4e-75
WP_160268129.1|23353_25330_+|tail	phage tail protein	tail	A0A1B0V7G4	Salmonella_phage	62.0	1.1e-128
WP_042004947.1|25340_25799_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.2	9.3e-44
WP_000367945.1|25798_26410_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	78.6	3.6e-83
WP_071852594.1|26415_26895_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	54.4	3.2e-39
WP_001408993.1|27917_28391_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	49.1	3.4e-33
WP_001408991.1|28431_28890_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.6	6.0e-43
WP_042004948.1|28918_29329_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	70.4	1.9e-48
WP_001165547.1|29418_29991_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.0	4.4e-83
WP_000145199.1|30426_30690_+	hypothetical protein	NA	Q71TD9	Escherichia_phage	67.1	1.1e-22
WP_000887652.1|30764_31094_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000580776.1|31090_31534_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_001345482.1|31520_32123_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_160268130.1|32124_34044_+	hypothetical protein	NA	A0A077SLK4	Escherichia_phage	95.6	0.0e+00
WP_033553840.1|34040_34406_+	hypothetical protein	NA	A0A1B0V846	Salmonella_phage	95.8	1.1e-44
WP_113400425.1|34418_37406_+	hypothetical protein	NA	Q1MVM9	Enterobacteria_phage	99.2	0.0e+00
WP_001165940.1|37395_37701_+	hypothetical protein	NA	Q1MVN0	Enterobacteria_phage	100.0	1.2e-52
WP_000724558.1|38440_39553_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	96.0	4.6e-198
WP_000068862.1|39786_40275_-	single-stranded DNA-binding protein	NA	Q1MVN2	Enterobacteria_phage	98.8	2.5e-87
WP_024175649.1|40444_41002_+	lysozyme	NA	Q71TF3	Escherichia_phage	98.9	6.1e-106
WP_094320631.1|41381_42596_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	93.0	3.0e-214
WP_024220494.1|42629_43649_-|head	head processing protein	head	Q71TR6	Escherichia_phage	96.7	2.2e-178
WP_094307822.1|43641_45351_-|portal	phage portal protein	portal	Q1MVN6	Enterobacteria_phage	99.6	0.0e+00
WP_160268131.1|45426_52194_+	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.4	0.0e+00
WP_000224043.1|52227_52668_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_000747846.1|52664_52913_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_064669538.1|52954_54259_-	hypothetical protein	NA	Q38324	Lactococcus_phage	30.4	3.4e-06
WP_074403646.1|54315_54957_-	maturation control protein	NA	A0A077SK30	Escherichia_phage	98.6	5.3e-114
WP_000848367.1|55146_55707_-	Ref family protein	NA	Q71TG3	Escherichia_phage	96.2	1.8e-97
WP_024245510.1|55953_56265_-	hypothetical protein	NA	Q5XLQ4	Enterobacteria_phage	93.2	6.3e-44
WP_160268132.1|56315_57347_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077SLE7	Escherichia_phage	99.1	7.1e-193
WP_000542336.1|57354_57576_-	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
WP_032305379.1|58180_58390_+	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	98.6	1.4e-31
WP_029401409.1|58500_59352_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	2.3e-157
WP_000124150.1|59376_60861_-|terminase	terminase	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
WP_000219618.1|60860_62054_-	hypothetical protein	NA	A0A077SL59	Escherichia_phage	99.7	4.7e-180
WP_001326849.1|62139_62592_-	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_000648833.1|62680_63724_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	99.7	1.1e-206
WP_001436571.1|63751_63931_-	hypothetical protein	NA	A0A077SLR6	Escherichia_phage	100.0	7.1e-24
WP_001216030.1|63935_64316_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	99.2	1.9e-63
WP_001190712.1|64315_64537_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_061327181.1|64719_66276_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	1.1e-104
WP_096106392.1|66272_67433_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_096106393.1|67554_70671_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	1.7e-27
WP_000021766.1|70935_71442_-	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	100.0	4.8e-94
WP_000107689.1|71514_72777_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	100.0	5.4e-235
WP_100620331.1|73078_73780_-	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	99.6	9.2e-144
WP_001354545.1|73776_74454_-	calcineurin phosphoesterase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
WP_000484110.1|74450_75077_-	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
WP_000096174.1|75578_75734_-	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_100620333.1|75800_76379_-	norphogenetic protein	NA	Q71T85	Escherichia_phage	99.5	3.3e-107
WP_000840931.1|76381_76627_-	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000235786.1|76773_77151_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_086525281.1|77160_78378_+|tail	phage tail protein	tail	A0A077SL53	Escherichia_phage	99.5	1.0e-222
WP_000896801.1|78381_79110_+	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_000602716.1|79096_79882_+	hypothetical protein	NA	A0A1B0V7N6	Salmonella_phage	99.2	1.4e-143
WP_059332151.1|79883_80900_+	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	99.7	1.3e-191
WP_000535205.1|80892_81525_+	hypothetical protein	NA	A0A1B0V872	Salmonella_phage	100.0	6.9e-90
WP_001198652.1|81571_82570_-	hypothetical protein	NA	Q71TK3	Escherichia_phage	99.4	2.1e-194
WP_160268133.1|82569_83934_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	99.8	1.1e-252
WP_000234831.1|84406_84571_-	DUF3927 domain-containing protein	NA	Q71T96	Escherichia_phage	100.0	7.6e-17
WP_000900640.1|84570_84996_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	100.0	1.8e-70
WP_086722066.1|86553_88818_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	68.2	0.0e+00
WP_015974264.1|88814_89720_-	recombination-associated protein RdgC	NA	Q71TA1	Escherichia_phage	100.0	1.2e-159
WP_001177860.1|89712_89997_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
WP_001311689.1|90271_90451_+	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	100.0	3.1e-27
WP_001569402.1|90459_91248_+	hypothetical protein	NA	Q71TL4	Escherichia_phage	100.0	1.0e-119
WP_000007765.1|91287_91710_+	hypothetical protein	NA	Q71TL5	Escherichia_phage	100.0	5.0e-60
WP_086722065.1|91887_92277_+	hypothetical protein	NA	Q71TL7	Escherichia_phage	99.2	2.4e-69
92436:92454	attR	GATGTGTGCTGGAGGGAAA	NA	NA	NA	NA
>prophage 1
NZ_CP041629	Escherichia coli strain PE15 plasmid pPE15-IncF, complete sequence	98476	1249	56905	98476	integrase,transposase	Escherichia_phage(36.84%)	55	NA	NA
WP_063072983.1|1249_2173_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.3e-174
WP_033548869.1|2339_2756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039462.1|3340_3676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001515192.1|3684_3876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807690.1|5003_5759_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_000079938.1|7096_7366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101968911.1|7383_8073_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.4	2.2e-89
WP_000888203.1|8174_8654_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000347934.1|8723_11876_-	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_002914189.1|11899_13075_-	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
WP_001067858.1|13394_14099_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_063102497.1|14292_14679_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_000084745.1|15775_16168_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_001452736.1|17922_18234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063107378.1|18269_18548_-	IncN plasmid KikA protein	NA	NA	NA	NA	NA
WP_001067858.1|18606_19311_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_057102336.1|21749_22460_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.4	2.1e-95
WP_001175593.1|22560_22884_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058650130.1|22989_24123_+	permease	NA	NA	NA	NA	NA
WP_000521603.1|24415_25033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818556.1|25224_26781_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000194575.1|27043_27634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343085.1|27633_27891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000350638.1|28244_30383_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044768.1|30544_30961_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261287.1|30957_31188_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_061602529.1|31483_31756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|31802_32507_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000429836.1|32553_32988_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|33059_33410_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|33423_33699_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|33734_34157_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|34208_35903_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|35920_36283_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|36279_36516_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|36512_37220_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|37258_38563_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|38609_39314_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|39503_40319_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|40469_41174_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032492336.1|41623_42853_+	macrolide efflux MFS transporter Mef(B)	NA	A0A1B0RXG2	Streptococcus_phage	39.0	2.1e-74
WP_000612791.1|42998_43862_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|43899_44145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|44613_45405_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_000800531.1|46584_46917_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_001206316.1|47086_47878_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|47970_49230_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206356.1|49491_50283_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|50288_50579_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|50690_51188_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|51332_52346_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|52548_52899_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001161490.1|53074_53635_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|53638_56605_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_000844627.1|56662_56905_+|transposase	transposase	transposase	NA	NA	NA	NA
