The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045127	Acinetobacter indicus strain XG03 chromosome, complete genome	2988937	7014	40387	2988937	transposase,tRNA	Clostridium_botulinum_C_phage(28.57%)	23	NA	NA
WP_160255392.1|7014_7614_+|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	56.5	3.2e-60
WP_016659756.1|7617_9000_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_104492403.1|9089_11027_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	4.0e-64
WP_160255393.1|11259_12267_+	RND transporter	NA	NA	NA	NA	NA
WP_104473704.1|12524_13535_+	RND transporter	NA	NA	NA	NA	NA
WP_171293387.1|13881_14850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005181144.1|14972_15308_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.5	1.2e-24
WP_005181147.1|15381_16509_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_005181149.1|16572_17805_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_160255394.1|18370_19012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016659757.1|19011_19611_+|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	56.5	1.2e-59
WP_016659756.1|19614_20997_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_016658670.1|27603_28953_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_104484368.1|29323_30490_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_005181039.1|30992_31535_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005181033.1|31673_32156_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_005181030.1|32148_32688_-	signal peptidase II	NA	NA	NA	NA	NA
WP_104498366.1|32680_35527_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	26.3	1.9e-78
WP_075167935.1|35588_36593_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_162182856.1|36888_37458_+	5'-nucleosidase	NA	NA	NA	NA	NA
WP_005181018.1|37501_38155_-	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_016659040.1|38618_39776_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A7P9	Microcystis_virus	36.9	2.7e-55
WP_075167936.1|39772_40387_-|transposase	IS607 family transposase	transposase	A0A1S5RGS9	Helicobacter_phage	63.2	2.7e-62
>prophage 2
NZ_CP045127	Acinetobacter indicus strain XG03 chromosome, complete genome	2988937	148809	326500	2988937	transposase,tRNA,integrase,protease	Escherichia_phage(15.38%)	151	212703:212762	249429:250749
WP_160255409.1|148809_150114_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005180795.1|150329_151796_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.8	1.5e-90
WP_005180793.1|151922_153260_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_005180791.1|153271_153928_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_075175133.1|153928_155629_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	32.0	1.8e-68
WP_160255410.1|155680_156418_-	putative porin	NA	NA	NA	NA	NA
WP_160255409.1|156568_157873_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_104473262.1|157991_158768_-	putative porin	NA	NA	NA	NA	NA
WP_104470758.1|159282_160377_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	3.3e-07
WP_075167292.1|160544_160844_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_104483885.1|160889_161969_+	alkene reductase	NA	NA	NA	NA	NA
WP_160255411.1|162076_163357_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_005180773.1|163552_164263_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_005180767.1|164248_165220_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_104489267.1|165563_167507_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.3	2.1e-89
WP_104473265.1|167642_168821_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_104489842.1|169050_169782_-	FMN reductase	NA	NA	NA	NA	NA
WP_005180757.1|170157_170808_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_104473267.1|170872_171640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104483890.1|172045_175534_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L0Z8	Tupanvirus	26.7	2.9e-12
WP_005180745.1|175718_176051_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_075167300.1|176052_177768_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_104498145.1|177810_178716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005180740.1|178719_179244_-	DUF697 domain-containing protein	NA	NA	NA	NA	NA
WP_104490121.1|179343_180024_+	ion channel	NA	NA	NA	NA	NA
WP_104483892.1|180126_181167_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	83.5	6.8e-175
WP_104470768.1|181400_183368_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	29.2	9.9e-26
WP_104483893.1|183433_184321_-	porin Omp33-36	NA	NA	NA	NA	NA
WP_104483894.1|185543_187250_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_104483895.1|187348_190180_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.3	0.0e+00
WP_104470283.1|190429_191107_-	thiaminase II	NA	NA	NA	NA	NA
WP_005180731.1|191374_192457_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	52.6	1.1e-90
WP_104470282.1|192609_193974_+	MFS transporter	NA	NA	NA	NA	NA
WP_045795510.1|194025_194592_+	single-stranded DNA-binding protein	NA	M4SRQ0	Psychrobacter_phage	65.0	1.8e-36
WP_016658414.1|194834_195398_+	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
WP_160255412.1|195598_196474_+	pirin family protein	NA	NA	NA	NA	NA
WP_160255413.1|196907_198206_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_075167307.1|198209_199034_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005180651.1|199392_199620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171294843.1|200367_200817_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.0	2.1e-32
WP_160255414.1|200889_202281_+|transposase	transposase	transposase	A0A2I7RKG5	Vibrio_phage	22.7	1.0e-08
WP_160255415.1|202594_202768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160255416.1|202804_204024_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.9	5.3e-78
WP_160255417.1|205223_206243_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	46.1	1.4e-79
WP_160232339.1|206242_207016_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	57.0	2.4e-76
WP_104516284.1|207432_209265_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_032028744.1|209785_210994_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	49.2	2.1e-50
WP_160255418.1|211056_211452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160255419.1|211521_212716_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.1	2.2e-76
212703:212762	attL	GAGACTGTAAATTAAATTGTGTAATTGCCTGAATTTGCTATGTTCATATTCACAACGGAG	NA	NA	NA	NA
WP_032028744.1|212774_213983_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	49.2	2.1e-50
WP_075175708.1|214266_215229_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_160255420.1|215719_216868_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_160255421.1|217065_218284_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.2	2.4e-78
WP_075167314.1|218566_219793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075167315.1|219910_220168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005267625.1|220171_220345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058951593.1|220344_220575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075167317.1|220820_221111_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_075167318.1|221208_222102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075167319.1|222107_223385_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	38.0	1.6e-64
WP_104490119.1|223803_225684_+	potassium transporter Kup	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	31.3	1.9e-74
WP_160255422.1|225773_226421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016658418.1|226685_227768_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	38.0	1.2e-25
WP_005180612.1|227838_228084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160255423.1|228191_228866_-	aquaporin Z	NA	NA	NA	NA	NA
WP_160255424.1|228982_229999_-	AraC family transcriptional regulator ligand-binding domain-containing protein	NA	NA	NA	NA	NA
WP_104473277.1|230109_230742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075167325.1|231165_231924_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_104513221.1|232037_232988_+	homoserine kinase	NA	NA	NA	NA	NA
WP_104509776.1|233005_233632_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_045795233.1|233664_234057_+	membrane protein	NA	NA	NA	NA	NA
WP_005180595.1|234090_235026_-	DMT family transporter	NA	NA	NA	NA	NA
WP_075167328.1|235113_235845_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_104483781.1|236020_236689_-	3'-5' exonuclease domain-containing protein 2	NA	NA	NA	NA	NA
WP_160255425.1|236764_237253_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_104491710.1|237404_238022_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_005180581.1|238021_238615_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_016658426.1|238711_239089_+	acetyl-CoA sensor PanZ family protein	NA	NA	NA	NA	NA
WP_160255426.1|239833_240343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075174955.1|240425_241943_-	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_075167846.1|242150_243611_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	27.2	1.7e-14
WP_005180561.1|243871_244636_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.7	2.2e-29
WP_005180559.1|244971_247323_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_160255427.1|247409_249389_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_032028744.1|249500_250709_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	49.2	2.1e-50
WP_104483908.1|250751_251063_-	hypothetical protein	NA	NA	NA	NA	NA
249429:250749	attR	GAGACTGTAAATTAAATTGTGTAATTGCCTGAATTTGCTATGTTCATATTCACAACGGAGTCAGGCAACATGATGAACGAACAAAAACTAAAAGACCTTGCAGCAGAATTTGCTAAAGGAATCAAAACAGAAGACGATCTCAATCAATTCACCCGATTGTTGACTAAACTCACTGTTGAAACGGCTCTCAATGCCGAACTTACCGAACATCTCGGACATGAAAAGAATGCTCGTAAGAACGGTTCAAATGCTCGTAACGGTTATTCCAGTAAGACCGTGCTGAGCGATGATGGTGAGATTGAGATCACCACACCACGAGATCGTGATGGCACATTTGAGCCACAGCTAATTAAAAAGAATCAGACTCGTATCACGCAAATGGATAGCCAAATTCTATCCCTTTATGCCAAAGGCATGACTACCCGTGAAATCGTGGCTACTTTCAAAGAAATGTACGATGCTGATGTATCGCCAACGCTTATTTCCAAGGTGACTGATGCTGTTAAGGAGCAAGTCGCTGAATGGCAAAACCGTCCGCTGGATGCACTCTATCCCATCGTCTATATGGACTGTATTGTAGTTAAAGTCCGTCATAATGGCAGTGTTATCAACAAGGCTGTATTCCTTGCCTTAGGCATTAATCTTGATGGACAGAAAGAACTGCTCGGCATGTGGATGGCTGAGAATGAAGGTGCAAAGTTCTGGCTGAATGTCCTGACTGAGCTTAAAAACCGAGGGTTGCAGGATATTCTGATCGCCTGTGTGGATGGACTAAAAGGCTTTCCTGATGCCATTAACAGCGTATACCCGCAAACCCATATCCAGCTGTGCATTATCCATATGCTGCGTAACAGCTTGAAATACGTATCATGGAAAGATTACAAGGCCGTCACTCAGGATTTAAAAGCCGTTTATCAGTCACCTACTGAAGAGGCAGCCTTGATGGCCTTGGATCAATTCGCCCAAACATGGGATGACAAGTACCCACAGATCAGCAAAAGCTGGCGTACACACTGGGAGAATCTAAATACCTTCTTTGCTTATCCAGCCGAGATACGCAAAGCCATCTATACCACCAATGCGATCGAATCATTAAACAGCGTAATACGTCAGGCGATCAAAAAGCGTAAAGTCTTTCCAACGGATGATTCTGTACGTAAAGTGATTTACCTGGCAATTGATGCAGCGTCTAAAAAGTGGAATATGCCTATTCGCGACTGGCGTTTAGCCATGAGCCGCTTTATTATTGAATTCGGTGACCGCTTAAGCAATCACCTTTAAATTTATGAAAAGCAATTACACAAAATTATTTACAGGCTCA	NA	NA	NA	NA
WP_005180554.1|251144_252032_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005180552.1|252340_253618_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	27.5	1.3e-13
WP_005180550.1|253934_255596_+	energy-dependent translational throttle protein EttA	NA	A0A1B0RXA0	Streptococcus_phage	27.5	7.0e-41
WP_005180548.1|255858_256200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104470270.1|256587_258096_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_075174952.1|258248_258560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075174951.1|259130_260150_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_160255428.1|261814_262726_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_005180539.1|262737_263070_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_005180537.1|263082_264906_+	penicillin-binding protein PBP3	NA	NA	NA	NA	NA
WP_160255429.1|264917_266411_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_104500558.1|266423_267833_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_005180530.1|267833_268952_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_104489989.1|269017_269821_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_104483912.1|269943_272520_-	penicillin-binding protein PBP1a	NA	NA	NA	NA	NA
WP_005180516.1|273756_274392_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_160255430.1|274813_275263_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	49.2	9.4e-33
WP_160255431.1|275335_276727_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A2I7RKG5	Vibrio_phage	24.1	7.0e-10
WP_045795346.1|277103_277631_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_104487954.1|279866_280409_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_016658450.1|280431_281514_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_104500006.1|281526_282363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160255432.1|282801_287277_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_104489340.1|287350_288772_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_160255433.1|289014_289899_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_005180484.1|290065_290656_+	LemA family protein	NA	NA	NA	NA	NA
WP_104500004.1|290682_291747_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_104500003.1|291740_292301_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_160255434.1|292801_293734_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	5.5e-59
WP_160255435.1|294100_295741_+	O-antigen ligase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_104492369.1|295851_296316_-	bacterioferritin	NA	NA	NA	NA	NA
WP_171065121.1|296542_296725_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_005180461.1|296891_297275_-	RidA family protein	NA	NA	NA	NA	NA
WP_075174935.1|297346_299446_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	37.2	2.4e-09
WP_005013174.1|299669_299951_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_045795273.1|300027_300651_-	guanylate kinase	NA	A0A240FAU9	Liberibacter_phage	32.9	4.7e-14
WP_158650875.1|300768_301737_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_104473458.1|301900_302437_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_104500001.1|302433_302937_+	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
WP_032028744.1|303892_305101_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	49.2	2.1e-50
WP_160255436.1|305158_306010_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.8	2.0e-52
WP_003792460.1|306235_306610_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_104470238.1|306783_307533_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_104473451.1|307559_308108_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_075167878.1|308136_308394_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_104473448.1|308802_309708_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_160255437.1|309743_310511_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_075168265.1|310670_311129_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_034598244.1|311198_312071_-	EamA family transporter	NA	NA	NA	NA	NA
WP_104500021.1|312217_313093_-	EamA family transporter	NA	NA	NA	NA	NA
WP_005180397.1|313329_314562_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.1	4.5e-101
WP_045795292.1|314916_316326_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_104498747.1|316478_316850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160255438.1|317082_318312_+	MFS transporter	NA	S4TR35	Salmonella_phage	24.0	2.4e-14
WP_045795347.1|318424_318724_-	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_104498749.1|319010_319556_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	54.5	5.3e-38
WP_163143403.1|319661_320789_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005180385.1|320925_321570_-	ParA family protein	NA	NA	NA	NA	NA
WP_005180383.1|321689_322157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081410767.1|322220_322793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160255439.1|322799_324191_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A2I7RKG5	Vibrio_phage	24.1	7.0e-10
WP_023274418.1|324263_324713_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.0	7.2e-33
WP_104488148.1|324742_325291_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_104471534.1|325461_326025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104489426.1|326065_326500_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
>prophage 3
NZ_CP045127	Acinetobacter indicus strain XG03 chromosome, complete genome	2988937	518866	591689	2988937	transposase,tRNA	Helicobacter_phage(20.0%)	59	NA	NA
WP_104499951.1|518866_519934_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	I4AZM3	Saccharomonospora_phage	37.8	3.0e-29
WP_104490684.1|519979_520405_+	RcnB family protein	NA	NA	NA	NA	NA
WP_005180016.1|520553_521051_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_104498930.1|521197_522979_-	acyl-CoA dehydrogenase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_075168330.1|523152_524955_-	acyl-CoA dehydrogenase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_075168329.1|525251_525863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104500575.1|525997_527668_+	sensor histidine kinase efflux regulator BaeS	NA	NA	NA	NA	NA
WP_104499948.1|527683_528370_+	response regulator	NA	W8CYM9	Bacillus_phage	32.4	1.8e-27
WP_045796031.1|528633_528900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104499947.1|528969_529350_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_104484493.1|529425_530871_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.9	1.5e-42
WP_035269493.1|531036_532341_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005179996.1|532387_533554_-	acyl-CoA desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	34.3	1.4e-35
WP_075168219.1|533782_534274_+	META domain-containing protein	NA	NA	NA	NA	NA
WP_104511557.1|534336_535050_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_016658650.1|535195_535777_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_160255474.1|535868_537740_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_171260948.1|538123_538789_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_005179981.1|538769_540014_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_075168222.1|540383_540902_+	DUF1543 domain-containing protein	NA	NA	NA	NA	NA
WP_005179978.1|541069_542062_+	DUF2804 domain-containing protein	NA	NA	NA	NA	NA
WP_075168223.1|542163_543042_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_160255475.1|543162_544233_+	AraC family transcriptional regulator ligand-binding domain-containing protein	NA	NA	NA	NA	NA
WP_160242839.1|544262_545594_-	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_005179970.1|545958_546762_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_005179967.1|546758_547655_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_104501071.1|547651_548935_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_104473719.1|548931_549957_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_160255476.1|549990_550572_-	dual specificity protein phosphatase family protein	NA	NA	NA	NA	NA
WP_005179960.1|550692_551334_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_160255477.1|551673_554391_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_005179954.1|554549_554903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160255478.1|555063_556284_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_016658665.1|556428_557496_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_104473721.1|558670_559798_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_160255479.1|559893_560406_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_171294642.1|566553_567804_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_104489480.1|567949_569401_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_005179935.1|569576_569909_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_005179933.1|570046_570298_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_005179929.1|570305_571562_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_104484557.1|571561_572257_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_168370025.1|572447_573749_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_075175510.1|573848_574937_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	27.4	3.7e-22
WP_075175511.1|575059_576397_-	anthranilate synthase component I family protein	NA	A0A0B5J984	Pandoravirus	35.8	1.1e-33
WP_075167884.1|579340_579754_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	61.6	6.2e-47
WP_034586922.1|579774_580833_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3UZC2	Geobacillus_virus	36.2	4.8e-27
WP_104470910.1|580852_581401_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_005179902.1|581523_582132_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_163143421.1|582144_582672_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_075175593.1|582796_583462_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016659491.1|583474_584299_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_005179895.1|584292_585120_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_075175594.1|585233_586640_+	peptidase C13 family protein	NA	NA	NA	NA	NA
WP_075175595.1|586654_587491_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_104492516.1|587611_588715_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_075175597.1|588726_589746_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016659780.1|589775_590225_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	49.2	2.7e-32
WP_160255431.1|590297_591689_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A2I7RKG5	Vibrio_phage	24.1	7.0e-10
>prophage 4
NZ_CP045127	Acinetobacter indicus strain XG03 chromosome, complete genome	2988937	846335	900458	2988937	transposase,tRNA,protease	Vibrio_phage(16.67%)	43	NA	NA
WP_023274418.1|846335_846785_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.0	7.2e-33
WP_160255431.1|846857_848249_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A2I7RKG5	Vibrio_phage	24.1	7.0e-10
WP_045796254.1|848923_849370_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_075167098.1|849683_850151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104484247.1|850151_851072_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_075167096.1|851213_851510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075167095.1|851616_852114_+	DUF2505 family protein	NA	NA	NA	NA	NA
WP_075167094.1|852177_853464_-	MFS transporter	NA	NA	NA	NA	NA
WP_075167093.1|853591_854737_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.8	1.2e-20
WP_075167092.1|854960_856235_+	glutaminase	NA	NA	NA	NA	NA
WP_075167091.1|856328_858059_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001055589.1|859414_859798_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000618091.1|859794_860130_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_160255506.1|860204_861830_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	53.6	2.3e-145
WP_160255507.1|861833_864701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160255508.1|864755_868442_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	59.6	6.2e-13
WP_171065112.1|869019_870543_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_160255509.1|870863_872402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005179424.1|872576_872735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104469992.1|872871_873489_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_075174571.1|873648_874287_+	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
WP_160255510.1|874465_876535_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.6	3.2e-11
WP_160242931.1|876610_877903_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_160242932.1|877933_878938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075167084.1|878952_879975_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_034598190.1|880284_880899_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016659292.1|880994_881606_-	arylesterase	NA	NA	NA	NA	NA
WP_005179393.1|881638_882364_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	6.8e-33
WP_160255511.1|882365_884849_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_160255512.1|884882_885701_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_005179383.1|885779_886454_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_075167080.1|886565_888647_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005179377.1|888739_889639_-	hydrogen peroxide-inducible genes activator	NA	NA	NA	NA	NA
WP_164845007.1|889652_890546_-	alpha/beta fold hydrolase	NA	A0A1L7N183	Ralstonia_phage	30.4	1.3e-09
WP_075167079.1|890639_891818_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005179369.1|891895_892060_-	rubredoxin	NA	NA	NA	NA	NA
WP_005179368.1|892564_893107_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	38.4	5.9e-21
WP_034598188.1|893160_893667_-	esterase	NA	A0A2I7QX93	Vibrio_phage	24.7	5.0e-06
WP_171065110.1|893887_895450_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.5	4.7e-87
WP_016659284.1|895545_896088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005179347.1|896411_897326_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_160255513.1|897429_899043_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	1.8e-41
WP_160255514.1|899153_900458_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP045127	Acinetobacter indicus strain XG03 chromosome, complete genome	2988937	1061335	1070185	2988937	tRNA	uncultured_Caudovirales_phage(50.0%)	10	NA	NA
WP_045794839.1|1061335_1062469_+	toxic anion resistance protein	NA	K4F9M7	Cronobacter_phage	22.8	2.8e-17
WP_104516546.1|1062512_1063427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075174384.1|1063624_1065190_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.5	1.5e-24
WP_005179080.1|1065325_1065580_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	46.6	2.0e-16
WP_104516325.1|1065583_1066975_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	64.9	2.8e-131
WP_075166952.1|1067119_1067548_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	60.6	1.2e-40
WP_005179068.1|1067632_1067950_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	64.4	7.9e-26
WP_104484512.1|1067954_1068428_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	54.5	6.0e-38
WP_005179062.1|1068431_1069481_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_104470299.1|1069480_1070185_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.5	8.2e-92
>prophage 6
NZ_CP045127	Acinetobacter indicus strain XG03 chromosome, complete genome	2988937	1165277	1175845	2988937		Bacillus_phage(16.67%)	9	NA	NA
WP_075174381.1|1165277_1167416_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	23.5	1.1e-25
WP_005178811.1|1167412_1168597_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_075174380.1|1168700_1169300_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.0	6.5e-21
WP_171293264.1|1169313_1169910_+	acyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	52.7	8.2e-08
WP_005178808.1|1170046_1170889_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	1.3e-35
WP_005178807.1|1171031_1171697_-	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	38.7	5.0e-30
WP_005178806.1|1171829_1172552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005178805.1|1172682_1173006_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_104470856.1|1173211_1175845_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.6	3.8e-33
>prophage 7
NZ_CP045127	Acinetobacter indicus strain XG03 chromosome, complete genome	2988937	1546587	1591939	2988937	holin,transposase	uncultured_virus(28.57%)	39	NA	NA
WP_160255607.1|1546587_1548624_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.1	5.4e-19
WP_005235723.1|1548895_1549474_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_160255608.1|1549495_1550971_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_104484587.1|1550987_1552655_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	30.2	1.8e-52
WP_160255609.1|1552813_1553587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104489327.1|1553610_1555002_-	sensor histidine kinase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_104470221.1|1555004_1555676_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	2.3e-30
WP_160255610.1|1555785_1557768_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_160255611.1|1557764_1558607_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_104470224.1|1558619_1559360_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_160255612.1|1559677_1560556_+	Abi family protein	NA	A3QSC6	Clostridium_virus	30.9	3.9e-30
WP_160255613.1|1560917_1561925_-	OmpA family protein	NA	NA	NA	NA	NA
WP_104473240.1|1562586_1563573_+	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_104473241.1|1563601_1564630_+	methionine synthase	NA	NA	NA	NA	NA
WP_104473242.1|1564739_1565231_+	flavin reductase	NA	NA	NA	NA	NA
WP_075168281.1|1565272_1566073_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_104487249.1|1567265_1567619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104492492.1|1567703_1568639_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_075168278.1|1568889_1569426_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_127801122.1|1569843_1571169_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_160255821.1|1571352_1572561_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	49.2	2.1e-50
WP_104473252.1|1574352_1575117_-	alpha/beta fold hydrolase	NA	A0A023W7H4	Mycobacterium_phage	34.8	2.3e-07
WP_075175227.1|1575258_1576134_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_075167750.1|1576130_1576553_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_075167749.1|1576554_1576971_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005177777.1|1577466_1578213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075175226.1|1578216_1578474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077164742.1|1580449_1580785_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_160255614.1|1580859_1582506_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	53.8	2.3e-145
WP_000618091.1|1582858_1583194_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001055589.1|1583190_1583574_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_005177772.1|1584639_1585095_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_005177770.1|1585111_1585534_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_005177767.1|1585551_1586916_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005177765.1|1586981_1587446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160255615.1|1587670_1589158_+	amidase	NA	NA	NA	NA	NA
WP_160255616.1|1589206_1590367_-	MFS transporter	NA	NA	NA	NA	NA
WP_158650429.1|1590803_1591169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121533679.1|1591372_1591939_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP045127	Acinetobacter indicus strain XG03 chromosome, complete genome	2988937	1738317	1793516	2988937	transposase,tRNA	Escherichia_phage(45.45%)	42	NA	NA
WP_104489753.1|1738317_1739394_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_016658257.1|1739514_1739730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016658258.1|1739873_1740875_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_075166751.1|1740918_1741128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160255625.1|1741786_1743421_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.5	3.3e-27
WP_075166749.1|1743528_1744128_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_005177380.1|1744198_1745146_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_005177377.1|1745206_1746499_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_104470845.1|1748491_1749916_+	MFS transporter	NA	NA	NA	NA	NA
WP_005177343.1|1750183_1750678_+	DNA starvation/stationary phase protection protein	NA	W5S6G8	Pithovirus	38.6	1.5e-15
WP_104470846.1|1751051_1751480_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_160255626.1|1751665_1752655_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_104498661.1|1752651_1753575_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_160255627.1|1753892_1756352_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_160255628.1|1756410_1758378_+	phytase	NA	NA	NA	NA	NA
WP_075166741.1|1758449_1759136_+	protein TolQ	NA	NA	NA	NA	NA
WP_075166740.1|1759142_1759589_+	protein TolR	NA	NA	NA	NA	NA
WP_075166739.1|1759585_1760380_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_160255629.1|1761071_1763225_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_104484314.1|1763289_1763901_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_160255630.1|1763941_1764226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075174478.1|1764229_1765789_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_075166735.1|1765785_1766067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160255631.1|1768208_1769843_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_075166811.1|1769912_1771175_+	MFS transporter	NA	NA	NA	NA	NA
WP_075166733.1|1771250_1771736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160255632.1|1774500_1775274_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	57.0	1.8e-76
WP_159153814.1|1775273_1776293_-|transposase	IS21-like element ISAba8 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.8	6.2e-80
WP_160255634.1|1776983_1777916_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.6	1.4e-59
WP_160255635.1|1778665_1779172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160255636.1|1779150_1780110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160255637.1|1780109_1781306_-	DNA/RNA helicase	NA	NA	NA	NA	NA
WP_160255638.1|1781416_1782636_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	50.9	3.8e-76
WP_160255639.1|1783074_1783536_+	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	61.9	1.1e-52
WP_160255640.1|1783638_1785078_-	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	48.1	2.3e-104
WP_160255641.1|1785356_1785776_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_160255822.1|1785785_1787459_-	DEAD/DEAH box helicase	NA	M4QQR7	Ostreococcus_lucimarinus_virus	28.5	9.3e-33
WP_160255642.1|1787604_1788438_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_160255643.1|1788430_1790077_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_160255644.1|1791079_1792099_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	46.4	8.0e-80
WP_160232339.1|1792098_1792872_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	57.0	2.4e-76
WP_160255645.1|1793069_1793516_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP045127	Acinetobacter indicus strain XG03 chromosome, complete genome	2988937	1853699	1905255	2988937	portal,tail,protease,head,tRNA,terminase,capsid	Moraxella_phage(17.65%)	48	NA	NA
WP_075166682.1|1853699_1854416_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_104509742.1|1854572_1855349_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_104469905.1|1855433_1856231_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_104498230.1|1856294_1856966_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_104488771.1|1857323_1859012_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	28.1	4.5e-27
WP_005177074.1|1859114_1859744_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104469947.1|1859891_1861064_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_075166678.1|1861098_1862700_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	69.4	2.3e-20
WP_104489703.1|1862712_1863507_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_104469902.1|1863527_1865522_+	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_104469901.1|1865518_1866421_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	36.8	8.5e-41
WP_005177058.1|1866517_1867222_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_104469900.1|1867225_1867864_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_160255649.1|1867986_1869441_-	OmpA family protein	NA	NA	NA	NA	NA
WP_075174772.1|1869589_1870825_-	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_005177046.1|1870835_1871852_-	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_016658379.1|1872088_1872430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171261356.1|1872627_1874850_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_005177034.1|1875115_1877695_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	33.9	1.4e-125
WP_005177032.1|1878020_1878443_-	OsmC family protein	NA	NA	NA	NA	NA
WP_005177031.1|1878590_1879295_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_075166669.1|1879465_1880515_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_005177027.1|1880603_1881386_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_104472979.1|1881548_1881857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104469896.1|1881945_1882731_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005177019.1|1882867_1884187_-	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.2	8.8e-71
WP_104469895.1|1884258_1885425_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_005177014.1|1885723_1886038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016658386.1|1886201_1887236_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_171293306.1|1887641_1890335_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.1	1.6e-71
WP_104472976.1|1890395_1891676_+	aspartate kinase	NA	NA	NA	NA	NA
WP_016658388.1|1891920_1892175_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
WP_104469946.1|1892240_1892819_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.9	7.1e-25
WP_005177001.1|1892880_1893258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104469893.1|1893360_1894572_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_160255650.1|1894585_1895344_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_104491670.1|1895489_1896488_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_005176982.1|1896555_1897878_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.4	2.6e-62
WP_075174775.1|1898222_1898459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160255651.1|1898667_1899096_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_160255652.1|1899433_1899784_-|head	phage head closure protein	head	A0A0R6PE02	Moraxella_phage	32.4	4.8e-08
WP_160255653.1|1899780_1900068_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4JAM4	uncultured_Caudovirales_phage	34.8	1.1e-05
WP_160255654.1|1900067_1901621_-|terminase	terminase large subunit	terminase	E4ZFM0	Streptococcus_phage	42.9	2.1e-108
WP_151708020.1|1901595_1901988_-	hypothetical protein	NA	A0A0R6PF88	Moraxella_phage	31.7	4.9e-09
WP_160255655.1|1902001_1902385_-	HNH endonuclease	NA	Q8W6N0	Burkholderia_virus	45.3	4.0e-08
WP_160255656.1|1902371_1903529_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	36.7	5.0e-54
WP_160255657.1|1903525_1904038_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	46.4	2.9e-30
WP_160255658.1|1904040_1905255_-|capsid	phage major capsid protein	capsid	A0A0K1Y730	Rhodobacter_phage	30.7	3.0e-41
>prophage 10
NZ_CP045127	Acinetobacter indicus strain XG03 chromosome, complete genome	2988937	2084719	2090643	2988937		Acinetobacter_phage(83.33%)	7	NA	NA
WP_171293323.1|2084719_2085295_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	93.2	2.9e-103
WP_016659977.1|2085314_2086361_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	87.1	5.2e-167
WP_005176475.1|2086378_2087185_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	85.1	1.2e-126
WP_160232543.1|2087391_2088075_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	75.5	7.0e-88
WP_005176473.1|2088168_2088717_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	95.1	3.4e-93
WP_005176472.1|2088813_2089170_+	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_005176471.1|2089281_2090643_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.8	9.9e-17
>prophage 11
NZ_CP045127	Acinetobacter indicus strain XG03 chromosome, complete genome	2988937	2097737	2131762	2988937	transposase,tRNA,protease	Escherichia_phage(33.33%)	28	NA	NA
WP_160255682.1|2097737_2098670_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.7	1.3e-57
WP_005176376.1|2098977_2099472_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_104470899.1|2099838_2100954_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016659963.1|2101024_2101408_-	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005176370.1|2101624_2102548_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	63.3	2.3e-89
WP_160255683.1|2103056_2103899_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	59.7	2.0e-36
WP_005176364.1|2104014_2104920_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_160255684.1|2105036_2106341_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005176362.1|2106415_2107009_-	DUF4112 domain-containing protein	NA	NA	NA	NA	NA
WP_005176359.1|2107097_2108435_-	magnesium transporter	NA	NA	NA	NA	NA
WP_160232559.1|2108552_2111645_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_160232560.1|2111929_2113828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160232561.1|2113866_2115018_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_104470894.1|2115220_2116855_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	61.2	6.6e-177
WP_004810787.1|2116912_2117203_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	51.1	1.0e-16
WP_075174437.1|2117403_2118162_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_160255685.1|2118142_2119081_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_005176337.1|2119497_2121327_+	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_016659954.1|2121502_2121937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160255686.1|2121968_2122637_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_160255687.1|2122834_2123683_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.6	1.5e-26
WP_075167184.1|2124101_2124833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075174433.1|2124873_2126643_-	alkaline phosphatase D family protein	NA	NA	NA	NA	NA
WP_160255483.1|2126831_2127473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016659757.1|2127472_2128072_+|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	56.5	1.2e-59
WP_016659756.1|2128075_2129458_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_160232339.1|2129969_2130743_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	57.0	2.4e-76
WP_160255688.1|2130742_2131762_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	46.4	3.6e-80
>prophage 12
NZ_CP045127	Acinetobacter indicus strain XG03 chromosome, complete genome	2988937	2903286	2971986	2988937	transposase,tRNA,protease	Helicobacter_phage(16.67%)	55	NA	NA
WP_121533679.1|2903286_2903853_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_004973749.1|2903842_2904298_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_160255791.1|2904485_2905520_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_160255792.1|2905516_2906632_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_160255793.1|2906647_2908117_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_160255794.1|2908121_2909369_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HZW8	Acanthocystis_turfacea_Chlorella_virus	25.5	2.1e-21
WP_160255795.1|2909381_2910506_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	28.1	3.3e-26
WP_160255796.1|2910515_2911793_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	A0A218MKK1	uncultured_virus	24.3	2.3e-07
WP_171519209.1|2912110_2913214_+	polysaccharide biosynthesis/export family protein	NA	NA	NA	NA	NA
WP_160255798.1|2913213_2913642_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_160255799.1|2913659_2915846_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_160255800.1|2915991_2917434_+	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
WP_016658891.1|2917533_2918178_-	START domain-containing protein	NA	NA	NA	NA	NA
WP_160255801.1|2918234_2919056_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_104472331.1|2919304_2919577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075167668.1|2919648_2920758_-	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	36.6	5.7e-31
WP_005181203.1|2920864_2921242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160255802.1|2921373_2924520_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_075167670.1|2924522_2925623_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_160255803.1|2925776_2926388_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160255804.1|2926528_2929213_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_005181189.1|2929512_2930823_+	hypothetical protein	NA	Q9KX94	Enterobacteria_phage	63.6	5.2e-148
WP_005181183.1|2931065_2931242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075167674.1|2931652_2931940_-	chorismate mutase	NA	NA	NA	NA	NA
WP_104505695.1|2931920_2933243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104487868.1|2933322_2935008_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_067731511.1|2935301_2935505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160255409.1|2935748_2937053_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075174681.1|2937106_2938936_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_160255805.1|2939362_2940325_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.3	1.7e-07
WP_160255806.1|2940321_2941626_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_005181164.1|2941705_2941816_-	methionine/alanine import family NSS transporter small subunit	NA	NA	NA	NA	NA
WP_160255807.1|2941817_2943305_-	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_075174677.1|2943827_2945279_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_104510266.1|2945637_2946087_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	49.2	2.1e-32
WP_160255808.1|2946159_2947551_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A2I7RKG5	Vibrio_phage	24.1	7.0e-10
WP_005181158.1|2947818_2949180_-	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_016659793.1|2955426_2955999_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_160255809.1|2956096_2956807_+	acetoacetate decarboxylase family protein	NA	NA	NA	NA	NA
WP_005181046.1|2956817_2957894_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	32.2	4.0e-29
WP_005181048.1|2958096_2958522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075168303.1|2958766_2959018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005181051.1|2959849_2960398_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_005181052.1|2960517_2962458_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.7	2.9e-147
WP_160255810.1|2962688_2963432_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_168382072.1|2963552_2963942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171260954.1|2963984_2965166_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_104498503.1|2965751_2965994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104484542.1|2966008_2967130_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_005181065.1|2967145_2967658_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.9	1.4e-19
WP_075175484.1|2967946_2969227_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_005181069.1|2969229_2969568_-	DMT family protein	NA	NA	NA	NA	NA
WP_005181071.1|2969822_2971190_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_158650729.1|2971197_2971515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160255811.1|2971536_2971986_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.0	1.2e-32
>prophage 1
NZ_CP045124	Acinetobacter indicus strain XG03 plasmid pXG-160kb, complete sequence	160891	1013	149133	160891	transposase,protease,integrase	uncultured_Caudovirales_phage(35.48%)	118	5907:5925	60166:60184
WP_160255338.1|1013_1985_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_001067790.1|3054_3759_+|transposase	IS6-like element IS1008 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	5.1e-118
WP_005245161.1|4263_5151_-	cation transporter	NA	NA	NA	NA	NA
WP_005245162.1|5137_5869_-	transglutaminase family protein	NA	NA	NA	NA	NA
5907:5925	attL	GACTCTATAGTAACTATAG	NA	NA	NA	NA
WP_160255339.1|6403_7603_-|integrase	tyrosine-type recombinase/integrase	integrase	E5AGD0	Erwinia_phage	29.3	3.4e-37
WP_160255340.1|7887_11070_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016658820.1|11072_13397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123785435.1|13438_13876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160255341.1|14466_15801_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_016658823.1|15829_16555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016658824.1|16582_17494_-	glutamine amidotransferase family protein	NA	NA	NA	NA	NA
WP_035363638.1|17538_18873_-	type III glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016658826.1|19211_19811_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016658827.1|20003_21320_+	ammonium transporter	NA	NA	NA	NA	NA
WP_171066707.1|21718_23029_+	ammonium transporter	NA	NA	NA	NA	NA
WP_160255342.1|23445_24027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160255343.1|24531_25626_-	hypothetical protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	32.1	7.2e-18
WP_160255344.1|26531_28397_+	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_004897649.1|28383_28722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004668309.1|28708_29653_+	copper resistance protein B	NA	NA	NA	NA	NA
WP_160255345.1|29884_31210_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000246755.1|31319_31565_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	42.0	1.9e-11
WP_160255346.1|31924_33250_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_016658833.1|33463_33793_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_033917441.1|34510_34951_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_016658836.1|35366_35945_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	60.5	1.4e-52
WP_160255347.1|35960_37265_+	DUF4113 domain-containing protein	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	60.7	7.5e-155
WP_160255348.1|37474_38446_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_160255349.1|38502_39423_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_160255350.1|39409_41323_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_005021637.1|41412_41709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004679347.1|41857_42538_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.9	1.9e-29
WP_005105857.1|42530_43931_+	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.8	4.6e-17
WP_045796007.1|43969_45253_-	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_160255351.1|45249_47625_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.3	1.0e-93
WP_004663997.1|47636_48287_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_004755892.1|48283_48556_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_160255352.1|48584_49016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004281876.1|49741_49984_-	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_004681441.1|50335_50716_+	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_160255353.1|50780_51662_+	CopD family protein	NA	NA	NA	NA	NA
WP_004679365.1|52125_52320_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_160255354.1|52496_54974_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.4	9.0e-93
WP_160255355.1|55044_55977_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.0	1.3e-60
WP_160255356.1|56237_56852_-	DsbA family protein	NA	NA	NA	NA	NA
WP_001067784.1|58071_58776_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_160255357.1|58839_60120_-	cation transporter	NA	NA	NA	NA	NA
WP_000550240.1|60209_60602_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
60166:60184	attR	CTATAGTTACTATAGAGTC	NA	NA	NA	NA
WP_001140620.1|60898_61201_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081403899.1|62097_63423_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004870779.1|63839_65327_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	78.6	2.3e-216
WP_160255358.1|65339_66191_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	44.2	1.8e-64
WP_005253618.1|66350_67442_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	56.7	9.8e-92
WP_160255359.1|67551_68502_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	2.0e-61
WP_005253621.1|68519_69224_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.8	2.4e-91
WP_010116223.1|69228_70269_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_005253624.1|70274_70748_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	53.8	9.3e-39
WP_058869063.1|70752_71076_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	58.5	2.9e-20
WP_131367349.1|71120_71555_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	61.2	2.0e-43
WP_160255360.1|71700_72504_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_160255361.1|72516_73188_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_096911503.1|74444_75431_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_019838469.1|76191_76692_-	YqhA family protein	NA	NA	NA	NA	NA
WP_160255362.1|77138_77843_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.3	3.2e-120
WP_104988194.1|77920_78895_-	calcium/sodium antiporter	NA	A0A2I7QY17	Vibrio_phage	27.0	2.8e-05
WP_000480968.1|79291_80128_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|80127_80931_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001067790.1|81005_81710_-|transposase	IS6-like element IS1008 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	5.1e-118
WP_160255363.1|82354_83254_-	cation diffusion facilitator family transporter	NA	A0A1V0SED0	Indivirus	31.5	1.2e-10
WP_160255364.1|83340_86481_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	24.2	2.0e-73
WP_156189611.1|86470_87700_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_160255365.1|87701_89027_-	TolC family protein	NA	NA	NA	NA	NA
WP_035269733.1|89075_89444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160255366.1|90141_92181_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_160255367.1|92210_94835_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_160255368.1|94831_96772_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_160255369.1|96774_100314_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	A0A2R2ZGH5	Clostridioides_phage	21.3	1.8e-06
WP_160255370.1|100360_104041_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_096902453.1|104082_104658_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_096902446.1|104675_105287_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_160255371.1|105297_106164_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_005403805.1|106372_106702_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_160255372.1|106975_108208_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001043260.1|109352_110168_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|110254_110557_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|110450_110702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|110732_112226_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016658787.1|112932_113592_-	sarcosine oxidase subunit gamma	NA	NA	NA	NA	NA
WP_016658788.1|113595_116505_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_016658789.1|116501_116828_-	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_016658790.1|116839_118078_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016658791.1|118117_119011_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.4	1.3e-30
WP_016658792.1|119007_119874_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016658793.1|120080_120314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016658794.1|120464_120782_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016658795.1|120988_121855_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_160255373.1|121985_122324_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016658797.1|122430_123561_-	aminomethyl transferase family protein	NA	NA	NA	NA	NA
WP_016658798.1|123608_124628_-	DUF3445 domain-containing protein	NA	NA	NA	NA	NA
WP_016658799.1|124644_125589_-	oxidoreductase	NA	NA	NA	NA	NA
WP_160255374.1|125585_126116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016658801.1|126321_127686_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042119772.1|127805_128570_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_087090746.1|128581_129274_-	response regulator	NA	NA	NA	NA	NA
WP_160255375.1|129276_130437_-	histidine kinase	NA	NA	NA	NA	NA
WP_160255376.1|130620_132960_+	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_160255377.1|133122_134034_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	43.8	2.0e-13
WP_035363640.1|134048_134822_-	AAA family ATPase	NA	Q8JL10	Natrialba_phage	33.3	1.3e-13
WP_160255378.1|135678_136851_+	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_160255379.1|138579_140505_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_034585141.1|140730_141213_+	MSMEG_0572 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_087090703.1|141246_142254_+	Nit6803 family nitriliase	NA	NA	NA	NA	NA
WP_087090705.1|142302_143382_+	MSMEG_0568 family radical SAM protein	NA	NA	NA	NA	NA
WP_087090707.1|143393_143996_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_087090709.1|143996_145043_+	sll0787 family AIR synthase-like protein	NA	NA	NA	NA	NA
WP_087090712.1|145030_145324_+	MSMEG_0570 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_087090714.1|145335_146622_+	MSMEG_0569 family flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_160255380.1|147913_149133_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.9	7.6e-77
>prophage 1
NZ_CP045128	Acinetobacter indicus strain XG03 plasmid pXG03-X3, complete sequence	103629	2654	63568	103629	integrase,transposase,protease	uncultured_virus(29.41%)	57	NA	NA
WP_005021615.1|2654_4694_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_100355917.1|5332_5767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|5786_6491_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001447541.1|7415_8300_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214119.1|8516_9731_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	4.2e-19
WP_001255015.1|9758_10064_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001120888.1|10175_11669_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_099143682.1|11911_12619_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	35.8	6.2e-31
WP_024160783.1|12808_13975_+	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_001366550.1|14123_14861_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|14857_15082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|15292_16786_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|16816_17068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|16961_17264_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|17350_18166_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001067790.1|18655_19360_-|transposase	IS6-like element IS1008 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	5.1e-118
WP_014386410.1|20822_21602_+	APH(3')-VI family aminoglycoside O-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	34.7	6.9e-31
WP_004994718.1|21753_22779_+|transposase	IS30-like element ISAba125 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	1.2e-51
WP_004201164.1|22879_23692_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|23695_24061_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|24065_24704_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|24714_25746_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004993315.1|26218_26866_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	31.4	2.6e-15
WP_100355865.1|27155_28319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100355864.1|28610_28928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100355867.1|29118_29352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100355863.1|29935_30622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100355862.1|30625_31183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100355861.1|31239_31674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157797517.1|34546_34897_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	77.2	4.4e-46
WP_100355859.1|35802_37692_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_100355858.1|38557_39172_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	37.0	3.8e-32
WP_100355857.1|39171_39609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934717.1|40320_41586_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000366814.1|41585_41891_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004726728.1|42811_43069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004658347.1|43418_44015_-	putative adenosine monophosphate-protein transferase Fic	NA	NA	NA	NA	NA
WP_002125865.1|44027_44195_-	DUF2559 family protein	NA	NA	NA	NA	NA
WP_000911011.1|44469_44934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002058482.1|44946_47286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002046149.1|47290_50491_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000550047.1|50803_51022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001190354.1|51026_52322_-	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	51.3	2.0e-128
WP_000038641.1|52336_52963_-	hypothetical protein	NA	A0A2H4J538	uncultured_Caudovirales_phage	41.6	4.1e-26
WP_160232618.1|53074_53566_-	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	56.4	1.4e-45
WP_159516858.1|53638_55222_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	54.3	2.5e-144
WP_000618087.1|55296_55632_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_119026765.1|55628_55838_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_159516858.1|55954_57538_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	54.3	2.5e-144
WP_000618087.1|57612_57948_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_119026765.1|57944_58154_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_159516858.1|58270_59854_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	54.3	2.5e-144
WP_000618087.1|59928_60264_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_004646130.1|60260_60644_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000364662.1|61086_61515_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_160232616.1|61511_61847_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_160232617.1|61921_63568_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	52.4	2.1e-138
