The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022222	Bradyrhizobium sp. CCBAU 051011 chromosome, complete genome	9099371	3220711	3327649	9099371	integrase,transposase	Acidithiobacillus_phage(17.39%)	64	3219166:3219181	3271322:3272845
3219166:3219181	attL	GTGATCGTACCGGGCC	NA	NA	NA	NA
WP_161851751.1|3220711_3221977_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	29.6	2.7e-24
3219166:3219181	attL	GTGATCGTACCGGGCC	NA	NA	NA	NA
WP_161851752.1|3222467_3222833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161851753.1|3222959_3224303_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	44.0	2.3e-50
WP_161851754.1|3224429_3224816_-	ATP-binding domain-containing protein	NA	A0A1V0SAC2	Catovirus	34.9	1.5e-07
WP_161851755.1|3224829_3225156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161851756.1|3225287_3225500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161851757.1|3226026_3227274_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	44.4	3.1e-25
WP_161851758.1|3232202_3233522_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
3229664:3229679	attR	GGCCCGGTACGATCAC	NA	NA	NA	NA
WP_161851759.1|3234484_3234766_-	hypothetical protein	NA	NA	NA	NA	NA
3229664:3229679	attR	GGCCCGGTACGATCAC	NA	NA	NA	NA
WP_161856371.1|3236321_3236912_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_161856372.1|3236941_3238504_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	37.9	2.7e-82
WP_069279868.1|3238554_3238908_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_141343522.1|3238904_3239366_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161856373.1|3244003_3244228_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_161856374.1|3246442_3248092_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.8	1.0e-23
WP_161851760.1|3249475_3250552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161851761.1|3251302_3252646_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	44.4	3.0e-50
WP_161856375.1|3253508_3254469_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.3	3.9e-36
WP_161851761.1|3254456_3255800_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	44.4	3.0e-50
WP_161851762.1|3257669_3258968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161851763.1|3259006_3259576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161851764.1|3259572_3259929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161851765.1|3260895_3261366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161851766.1|3262352_3262538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161851767.1|3263890_3264127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161851768.1|3264494_3264752_-	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_161851769.1|3264805_3265207_-|integrase	phage integrase family protein	integrase	B0VK72	Azospirillum_phage	41.8	3.3e-05
WP_161851770.1|3265283_3265466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161851771.1|3268470_3269460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161851772.1|3269573_3270425_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_161851773.1|3271134_3271350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161851761.1|3271346_3272690_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	44.4	3.0e-50
WP_161851774.1|3272815_3273298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161851775.1|3273343_3273943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161851776.1|3278441_3279515_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_161851777.1|3280152_3280512_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_161851778.1|3283255_3283501_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_161851779.1|3287935_3288895_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_161856376.1|3289074_3289689_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_161856377.1|3289821_3292056_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	25.8	2.4e-36
WP_161851780.1|3292045_3293389_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_161851781.1|3294018_3294597_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_161851782.1|3294751_3295135_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	55.6	3.8e-06
WP_071916490.1|3295131_3295476_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	32.7	5.9e-11
WP_161851783.1|3295550_3297143_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	33.3	7.4e-56
WP_161851784.1|3298202_3298931_-	class I SAM-dependent methyltransferase	NA	Q854P7	Mycobacterium_phage	34.0	8.7e-12
WP_161851785.1|3299009_3299696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161851786.1|3299658_3300327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161851787.1|3300411_3301479_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	51.4	6.9e-90
WP_161851788.1|3301503_3302382_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	60.4	2.0e-95
WP_161851789.1|3302513_3303068_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.9	1.7e-47
WP_161851790.1|3303067_3304018_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.6	2.8e-26
WP_161851791.1|3304077_3306417_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_161856378.1|3306419_3308600_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_161851792.1|3308642_3308888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161851793.1|3308865_3309768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161851794.1|3310475_3311765_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_161851795.1|3315754_3317716_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_161856379.1|3318005_3321845_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_161851796.1|3322436_3323297_+	glycosyltransferase family 92 protein	NA	NA	NA	NA	NA
WP_161851797.1|3323351_3324470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161851783.1|3325257_3326850_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	33.3	7.4e-56
WP_071916490.1|3326924_3327269_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	32.7	5.9e-11
WP_161851798.1|3327265_3327649_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	55.6	3.8e-06
>prophage 2
NZ_CP022222	Bradyrhizobium sp. CCBAU 051011 chromosome, complete genome	9099371	3367773	3421739	9099371	integrase,transposase	Stx2-converting_phage(22.22%)	50	3409281:3409327	3421934:3421980
WP_161851827.1|3367773_3368166_+|transposase	transposase	transposase	Q76S41	Shigella_phage	43.5	1.2e-07
WP_161851828.1|3368162_3368510_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	54.7	2.9e-29
WP_161856383.1|3370229_3370469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161851829.1|3371441_3372890_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	34.0	7.2e-66
WP_161856384.1|3372964_3373375_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_161851830.1|3373371_3373824_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	52.8	2.2e-29
WP_161851831.1|3375487_3376936_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	34.0	9.4e-66
WP_161851832.1|3377462_3377849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057838549.1|3378028_3378880_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_161851833.1|3378876_3379749_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_161851834.1|3379960_3381340_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_161851835.1|3381870_3382923_+	acyltransferase	NA	C6ZR20	Salmonella_phage	22.6	3.9e-05
WP_161851836.1|3382935_3383412_-	DUF2269 domain-containing protein	NA	NA	NA	NA	NA
WP_161851837.1|3383411_3384689_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_161851838.1|3384710_3385265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161851839.1|3385291_3385453_-	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_161856385.1|3385582_3385729_-	DUF3072 domain-containing protein	NA	NA	NA	NA	NA
WP_161851840.1|3385858_3386143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161851841.1|3386290_3386515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161856386.1|3386595_3388518_-	AsmA family protein	NA	NA	NA	NA	NA
WP_161851842.1|3388781_3389489_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_057838558.1|3389511_3390162_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_161851843.1|3390166_3390820_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_161851844.1|3390937_3392584_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_161851845.1|3392783_3393809_-	Fe(3+) ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_161851846.1|3394010_3394967_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_161851847.1|3395020_3395338_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_161851848.1|3395469_3395955_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_161851849.1|3395893_3396721_-	phosphohydrolase	NA	NA	NA	NA	NA
WP_161856387.1|3397013_3398759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161851850.1|3399051_3400458_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	28.4	1.1e-39
WP_161851851.1|3400620_3402120_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_161851852.1|3402119_3402620_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_161851853.1|3402616_3403585_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_161856388.1|3403952_3404618_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_161856389.1|3404654_3407660_-	PAS domain S-box protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	24.7	2.8e-11
WP_161851854.1|3407951_3408335_+	phasin	NA	NA	NA	NA	NA
WP_161851855.1|3408588_3409023_+	phasin	NA	NA	NA	NA	NA
3409281:3409327	attL	CTGTGGAACAGGAGGTCGGTGGTTCGAGCCCACCCAACTGTACCAAC	NA	NA	NA	NA
WP_161851856.1|3409404_3411192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161851857.1|3411213_3411444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161851858.1|3411767_3412124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161851859.1|3412449_3413283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161851860.1|3413351_3413864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161851861.1|3415450_3415630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161851862.1|3415629_3415938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161851863.1|3416351_3416756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161851864.1|3418255_3418732_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_161851865.1|3418802_3419753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161851866.1|3419876_3420131_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161851867.1|3420443_3421739_-|integrase	integrase family protein	integrase	I6R9B6	Salmonella_phage	24.2	1.2e-11
3421934:3421980	attR	CTGTGGAACAGGAGGTCGGTGGTTCGAGCCCACCCAACTGTACCAAC	NA	NA	NA	NA
>prophage 3
NZ_CP022222	Bradyrhizobium sp. CCBAU 051011 chromosome, complete genome	9099371	4752503	4760209	9099371		Escherichia_phage(50.0%)	8	NA	NA
WP_161852913.1|4752503_4753238_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.6	5.2e-12
WP_161852914.1|4753221_4753926_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	3.8e-12
WP_161852915.1|4754153_4754552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161852916.1|4754574_4755240_-	aldolase	NA	A0A077SK32	Escherichia_phage	49.3	1.3e-49
WP_161852917.1|4755348_4756263_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	50.5	9.4e-72
WP_161852918.1|4756286_4757069_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_161852919.1|4757065_4758343_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	41.0	1.0e-71
WP_161852920.1|4758517_4760209_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.5	7.7e-11
>prophage 4
NZ_CP022222	Bradyrhizobium sp. CCBAU 051011 chromosome, complete genome	9099371	7131163	7140315	9099371	tRNA	uncultured_Mediterranean_phage(87.5%)	10	NA	NA
WP_161854793.1|7131163_7132543_-	LysM peptidoglycan-binding domain-containing M23 family metallopeptidase	NA	Q8SBN9	Clostridium_phage	42.7	1.8e-18
WP_161856690.1|7132652_7133270_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	48.1	6.7e-29
WP_161854794.1|7133551_7133929_+	response regulator	NA	NA	NA	NA	NA
WP_161854795.1|7134035_7134803_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	38.7	8.3e-37
WP_161854796.1|7135367_7136699_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.5	4.5e-99
WP_161854797.1|7136809_7137634_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	47.2	3.4e-52
WP_161854798.1|7137630_7138149_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_057834624.1|7138265_7138508_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	59.6	3.3e-08
WP_161854799.1|7138737_7139469_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	49.7	7.4e-43
WP_161854800.1|7139487_7140315_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.9	1.3e-27
>prophage 5
NZ_CP022222	Bradyrhizobium sp. CCBAU 051011 chromosome, complete genome	9099371	7949332	8064530	9099371	transposase	Leptospira_phage(18.18%)	80	NA	NA
WP_161855406.1|7949332_7950415_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_161855407.1|7950558_7950972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161856773.1|7951308_7951731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855408.1|7952031_7953120_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_161855409.1|7953020_7955510_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_161855410.1|7955516_7956200_+	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	32.1	1.3e-20
WP_161855411.1|7956273_7956732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855412.1|7956880_7957675_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_161855413.1|7960309_7960549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855414.1|7960715_7961033_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_161855415.1|7962163_7962721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855416.1|7965319_7965778_+	MFS transporter	NA	NA	NA	NA	NA
WP_161855417.1|7966555_7966729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855418.1|7969728_7969995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855419.1|7970477_7972304_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	39.4	2.2e-104
WP_161856774.1|7973761_7974361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855420.1|7974363_7974714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161853446.1|7978117_7979467_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.5	3.9e-50
WP_161855421.1|7979744_7980146_-	hypothetical protein	NA	A0A291AUP8	Sinorhizobium_phage	37.3	2.8e-12
WP_161851827.1|7982623_7983016_+|transposase	transposase	transposase	Q76S41	Shigella_phage	43.5	1.2e-07
WP_161851828.1|7983012_7983360_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	54.7	2.9e-29
WP_161856383.1|7985079_7985319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141343522.1|7985497_7985959_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_069279868.1|7985955_7986309_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_161856372.1|7986359_7987922_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	37.9	2.7e-82
WP_161856371.1|7987951_7988542_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_161851783.1|7989989_7991582_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	33.3	7.4e-56
WP_071916490.1|7991656_7992001_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	32.7	5.9e-11
WP_161851782.1|7991997_7992381_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	55.6	3.8e-06
WP_161856775.1|7992422_7992917_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_161855422.1|7993854_7994823_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_161855423.1|7994903_7995578_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_065745660.1|7996050_7996263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057859050.1|7999743_8000400_-	FkbM family methyltransferase	NA	Q58M88	Prochlorococcus_phage	34.7	5.1e-11
WP_161855424.1|8000870_8001956_+	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	63.3	1.8e-130
WP_161855425.1|8001936_8002890_+	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	55.0	1.9e-91
WP_161855426.1|8002864_8003617_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_084031034.1|8003613_8003892_-	helix-turn-helix transcriptional regulator	NA	A0A0K1LLP9	Caulobacter_phage	47.2	1.7e-08
WP_161855427.1|8004561_8004921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855428.1|8005238_8007116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057859058.1|8007874_8008624_+	hypothetical protein	NA	A0A1X9SH03	Bradyrhizobium_phage	43.6	1.2e-43
WP_057859056.1|8008685_8009357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057859057.1|8012285_8012624_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_161855422.1|8013538_8014507_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_161855429.1|8018238_8018640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057861906.1|8018641_8019331_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_156435706.1|8019365_8020820_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_161855430.1|8020830_8021496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855431.1|8021540_8022578_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_161855432.1|8022574_8023396_-	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_028350693.1|8023396_8023681_-	translocation protein	NA	NA	NA	NA	NA
WP_161855433.1|8023683_8024349_-	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_161855434.1|8024341_8025397_-	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_161855435.1|8025460_8025991_-	YscO family type III secretion system apparatus protein	NA	NA	NA	NA	NA
WP_161856776.1|8025966_8027277_-	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_161855436.1|8027312_8027936_-	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_161855437.1|8027925_8028564_-	nodulation protein NolU	NA	NA	NA	NA	NA
WP_161856777.1|8028575_8029385_-	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
WP_161856778.1|8029447_8029957_-	nodulation protein NolB	NA	NA	NA	NA	NA
WP_161856779.1|8030280_8031469_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.4	2.6e-45
WP_161851782.1|8032208_8032592_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	55.6	3.8e-06
WP_071916490.1|8032588_8032933_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	32.7	5.9e-11
WP_161855438.1|8034145_8035387_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.5	1.8e-33
WP_161855439.1|8036973_8039595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855440.1|8039596_8039740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855441.1|8040673_8041372_+	nodulation protein NolW	NA	NA	NA	NA	NA
WP_161855442.1|8043428_8044853_-	insulinase family protein	NA	NA	NA	NA	NA
WP_161856780.1|8044849_8046256_-	insulinase family protein	NA	L7Y3X7	Megavirus	22.4	4.6e-25
WP_161855443.1|8047372_8047582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855444.1|8048226_8049657_-	DUF1521 domain-containing protein	NA	NA	NA	NA	NA
WP_028350678.1|8050644_8050851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855445.1|8050971_8051859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855446.1|8051889_8052414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855447.1|8052855_8054973_+	EscV/YscV/HrcV family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_161855448.1|8055006_8055585_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_161856781.1|8055983_8056592_+	effector protein NopP	NA	NA	NA	NA	NA
WP_161856782.1|8058337_8059527_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.0	1.3e-44
WP_161855449.1|8059868_8060327_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161855450.1|8060599_8062864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161853446.1|8063180_8064530_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.5	3.9e-50
>prophage 6
NZ_CP022222	Bradyrhizobium sp. CCBAU 051011 chromosome, complete genome	9099371	8076125	8144727	9099371	transposase	Acidithiobacillus_phage(22.22%)	43	NA	NA
WP_161855456.1|8076125_8076533_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161856785.1|8078509_8079247_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_161856786.1|8083430_8084138_-	host specificity protein	NA	NA	NA	NA	NA
WP_161856787.1|8085137_8085971_+	Effector protein NopP	NA	NA	NA	NA	NA
WP_161856788.1|8087827_8088235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855457.1|8089764_8090100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161851761.1|8090639_8091983_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	44.4	3.0e-50
WP_065754549.1|8092093_8092996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855458.1|8092992_8094543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161856789.1|8094847_8095846_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_161855459.1|8096000_8097344_-	cytochrome P450	NA	S4VQU1	Pandoravirus	34.7	5.5e-12
WP_161855460.1|8097343_8098189_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.1	2.2e-14
WP_161855461.1|8098483_8099776_-	cytochrome P450	NA	NA	NA	NA	NA
WP_161855462.1|8099869_8101072_-	cytochrome P450	NA	NA	NA	NA	NA
WP_161855463.1|8102714_8103164_+	VirK protein	NA	NA	NA	NA	NA
WP_161855464.1|8103773_8105117_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	44.0	2.3e-50
WP_161855465.1|8106181_8107966_+	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_161855466.1|8108268_8109156_-	DMT family transporter	NA	NA	NA	NA	NA
WP_161856790.1|8109497_8109704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855467.1|8110078_8111431_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_161855468.1|8112662_8113037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855469.1|8113479_8114955_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_141688438.1|8115160_8115460_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_161855470.1|8115461_8117069_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	48.6	3.9e-12
WP_161855471.1|8117549_8118092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156434855.1|8118230_8118407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855472.1|8119432_8120251_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	47.5	7.9e-54
WP_161855473.1|8120484_8120739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161856791.1|8121297_8121798_+	flavin reductase	NA	NA	NA	NA	NA
WP_161856792.1|8123166_8124702_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	28.5	5.0e-41
WP_161856793.1|8124871_8126188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855474.1|8126314_8127763_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	34.0	9.4e-66
WP_161855475.1|8127997_8128435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855476.1|8129680_8130358_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_161855477.1|8130395_8131574_-	GFA family protein	NA	NA	NA	NA	NA
WP_161855478.1|8132158_8133460_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_065754579.1|8133937_8134780_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_161855479.1|8135534_8137358_-	nif-specific transcriptional activator NifA	NA	NA	NA	NA	NA
WP_161856794.1|8137577_8138300_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_161855480.1|8139077_8140913_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_141343522.1|8142302_8142764_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_069279868.1|8142760_8143114_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_161856372.1|8143164_8144727_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	37.9	2.7e-82
>prophage 7
NZ_CP022222	Bradyrhizobium sp. CCBAU 051011 chromosome, complete genome	9099371	8189989	8237952	9099371	integrase,transposase	Paenibacillus_phage(15.38%)	39	8189972:8189987	8227561:8227576
8189972:8189987	attL	TCTAGGTGGTGTGGAC	NA	NA	NA	NA
WP_161855508.1|8189989_8190753_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.1	3.0e-23
WP_161855509.1|8190843_8191251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855510.1|8191720_8192902_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_161855511.1|8193225_8193492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145642958.1|8193620_8193938_+	DUF3768 domain-containing protein	NA	L7TKV8	Rhizobium_phage	40.4	1.8e-17
WP_161855512.1|8194304_8194502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855513.1|8194802_8195201_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161855514.1|8195218_8196346_+|integrase	site-specific integrase	integrase	Q9T1P3	Pseudomonas_phage	25.3	1.7e-22
WP_161856801.1|8197183_8197930_-	nodulate formation efficiency C protein	NA	NA	NA	NA	NA
WP_161855515.1|8200859_8201201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855516.1|8201202_8202063_+	hypothetical protein	NA	F2Y377	Organic_Lake_phycodnavirus	30.9	4.1e-08
WP_161855517.1|8202097_8202442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161853446.1|8203395_8204745_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.5	3.9e-50
WP_161855518.1|8204758_8205010_-	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_161855519.1|8205934_8207521_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_161855520.1|8208217_8208463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161856802.1|8208779_8209079_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_161855521.1|8209495_8209741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855522.1|8210489_8210828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855475.1|8214287_8214725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855523.1|8214826_8216443_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	45.1	1.3e-95
WP_161855524.1|8216538_8216886_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	59.4	1.7e-34
WP_161855525.1|8216882_8217332_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161855474.1|8217407_8218856_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	34.0	9.4e-66
WP_161855526.1|8219657_8221823_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	4.1e-41
WP_161855527.1|8221854_8222940_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_161855528.1|8223099_8223252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855529.1|8224222_8224372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855530.1|8224614_8225800_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.0	1.8e-46
WP_161855531.1|8226918_8227398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855532.1|8227634_8228397_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	43.1	2.3e-23
8227561:8227576	attR	TCTAGGTGGTGTGGAC	NA	NA	NA	NA
WP_161853446.1|8229074_8230424_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.5	3.9e-50
WP_161855533.1|8230827_8231064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855534.1|8231115_8231559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855535.1|8232755_8233130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855536.1|8233709_8235056_-	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_057861162.1|8235045_8235387_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_161855537.1|8235890_8236163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855474.1|8236503_8237952_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	34.0	9.4e-66
>prophage 8
NZ_CP022222	Bradyrhizobium sp. CCBAU 051011 chromosome, complete genome	9099371	8276254	8340479	9099371	transposase	Acidithiobacillus_phage(21.43%)	26	NA	NA
WP_161855562.1|8276254_8276449_+|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	58.7	1.1e-09
WP_161856803.1|8277317_8278325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161853446.1|8280411_8281761_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.5	3.9e-50
WP_161855563.1|8282737_8283427_+	porin family protein	NA	NA	NA	NA	NA
WP_161853446.1|8284083_8285433_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.5	3.9e-50
WP_161855564.1|8285785_8286886_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_161855565.1|8287249_8287972_-	LuxR family transcriptional regulator	NA	A0A1I9KF49	Aeromonas_phage	31.7	7.3e-19
WP_161856804.1|8291014_8291836_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_161855566.1|8293226_8293454_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161853446.1|8294513_8295863_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.5	3.9e-50
WP_161855567.1|8296920_8298759_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.9	3.3e-31
WP_161851782.1|8302833_8303217_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	55.6	3.8e-06
WP_071916490.1|8303213_8303558_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	32.7	5.9e-11
WP_161855438.1|8304770_8306012_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.5	1.8e-33
WP_161855568.1|8308734_8310057_-	C4-dicarboxylate transporter DctA	NA	NA	NA	NA	NA
WP_161855569.1|8310277_8310613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855570.1|8312488_8312881_-	adenosylmethionine decarboxylase	NA	E3SKI8	Synechococcus_phage	44.4	3.2e-13
WP_161855571.1|8315358_8321823_+	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	24.8	6.4e-114
WP_161855572.1|8321815_8323237_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_161855573.1|8325174_8326503_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.5	7.8e-51
WP_065754933.1|8328583_8328835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855574.1|8329378_8331169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057855963.1|8332983_8333760_-	acetoacetate decarboxylase family protein	NA	NA	NA	NA	NA
WP_161855575.1|8335038_8335797_+	glucose 1-dehydrogenase	NA	A0A0K0KVL6	Prochlorococcus_phage	44.3	1.5e-06
WP_161855576.1|8335842_8337603_+	oleate hydratase	NA	NA	NA	NA	NA
WP_161856782.1|8339289_8340479_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.0	1.3e-44
>prophage 9
NZ_CP022222	Bradyrhizobium sp. CCBAU 051011 chromosome, complete genome	9099371	8366648	8464827	9099371	protease,transposase	uncultured_virus(15.79%)	97	NA	NA
WP_161851761.1|8366648_8367992_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	44.4	3.0e-50
WP_161855605.1|8368906_8369113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855606.1|8369116_8369629_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_161856805.1|8369639_8370323_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_161855607.1|8370319_8371486_+	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.5	9.1e-11
WP_161855608.1|8371713_8371890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855609.1|8372734_8373247_+	DUF2478 domain-containing protein	NA	NA	NA	NA	NA
WP_057862001.1|8373765_8374320_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_161855610.1|8374327_8374873_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_161855611.1|8376616_8377105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855612.1|8377101_8377719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057862005.1|8377711_8378002_-	DUF2604 domain-containing protein	NA	NA	NA	NA	NA
WP_161855613.1|8379339_8380098_-	glucose 1-dehydrogenase	NA	A0A0K0KVL6	Prochlorococcus_phage	30.2	6.3e-05
WP_065754704.1|8380810_8381107_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_161855614.1|8381139_8382447_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_161855615.1|8382457_8383567_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_161855616.1|8384589_8384931_-	nitrogenase stabilizing/protective protein NifW	NA	NA	NA	NA	NA
WP_161855617.1|8385131_8386319_-	homocitrate synthase	NA	NA	NA	NA	NA
WP_161855618.1|8386492_8387005_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_161855619.1|8387015_8387732_-	nitrogen fixation protein NifQ	NA	NA	NA	NA	NA
WP_028350602.1|8387850_8388735_-	nitrogenase iron protein	NA	NA	NA	NA	NA
WP_161855620.1|8389679_8390072_+|transposase	transposase	transposase	Q76S41	Shigella_phage	43.5	1.6e-07
WP_161855621.1|8390123_8390417_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	54.5	3.2e-21
WP_161851783.1|8391864_8393457_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	33.3	7.4e-56
WP_071916490.1|8393531_8393876_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	32.7	5.9e-11
WP_161851798.1|8393872_8394256_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	55.6	3.8e-06
WP_161856383.1|8394641_8394881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855622.1|8394984_8395272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065754716.1|8395508_8397122_-	tryptophan 7-halogenase	NA	M4SKV1	Cyanophage	33.1	5.5e-75
WP_161855623.1|8398967_8399777_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_161851798.1|8400511_8400895_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	55.6	3.8e-06
WP_071916490.1|8400891_8401236_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	32.7	5.9e-11
WP_161851783.1|8401310_8402903_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	33.3	7.4e-56
WP_161856806.1|8403386_8404781_-	peptidase S10	NA	NA	NA	NA	NA
WP_161855624.1|8405099_8405282_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_161856807.1|8405278_8406019_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_057856019.1|8406504_8406771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057856018.1|8408102_8408369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161851798.1|8408732_8409116_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	55.6	3.8e-06
WP_071916490.1|8409112_8409457_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	32.7	5.9e-11
WP_161851783.1|8409531_8411124_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	33.3	7.4e-56
WP_161855625.1|8411098_8411494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855626.1|8412364_8412766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855627.1|8412914_8413775_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.7	3.2e-53
WP_141343522.1|8413941_8414403_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_069279868.1|8414399_8414753_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_161856372.1|8414803_8416366_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	37.9	2.7e-82
WP_161856371.1|8416395_8416986_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_161855628.1|8416986_8417262_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_156434591.1|8418199_8418349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161853322.1|8419295_8420387_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_161855629.1|8421533_8421881_-	(2Fe-2S) ferredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_161855630.1|8423353_8423554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855631.1|8424496_8424718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141688549.1|8424807_8425044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855632.1|8425579_8425792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057861994.1|8426129_8426579_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_161855633.1|8427139_8428336_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_161855634.1|8428332_8428602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855635.1|8428636_8428996_-	DUF3024 domain-containing protein	NA	NA	NA	NA	NA
WP_065755480.1|8429011_8429251_-	nitrogen fixation protein NifZ	NA	NA	NA	NA	NA
WP_065755481.1|8429247_8429568_-	nitrogen fixation protein NifZ	NA	NA	NA	NA	NA
WP_161855636.1|8429579_8430338_-	LRV FeS4 cluster domain-containing protein	NA	NA	NA	NA	NA
WP_161855637.1|8430861_8431203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065755485.1|8431217_8431442_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.8	3.3e-10
WP_161855638.1|8431452_8433015_-	nitrogenase cofactor biosynthesis protein NifB	NA	NA	NA	NA	NA
WP_161855639.1|8433288_8434155_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_057861984.1|8434151_8434373_-	putative nitrogen fixation protein NifT	NA	NA	NA	NA	NA
WP_161855640.1|8434389_8435577_-	cysteine desulfurase NifS	NA	H7BUW1	unidentified_phage	38.5	1.9e-40
WP_161855641.1|8435573_8435864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855642.1|8435880_8436204_-	iron-sulfur cluster assembly accessory protein	NA	NA	NA	NA	NA
WP_065755490.1|8436483_8437074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161856808.1|8437089_8437422_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_057861979.1|8438870_8439074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057861978.1|8439193_8439484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065755493.1|8439605_8439857_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_161855643.1|8439856_8441164_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_156435723.1|8441188_8441329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855644.1|8442704_8443490_-|protease	YopT-type cysteine protease domain-containing protein	protease	NA	NA	NA	NA
WP_161855645.1|8443640_8444063_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_161855646.1|8444407_8445898_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_161855647.1|8445998_8446628_+	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_161855648.1|8446696_8447317_+	LysE family translocator	NA	NA	NA	NA	NA
WP_161855649.1|8448068_8448848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855650.1|8449288_8449582_-	ferredoxin III, nif-specific	NA	NA	NA	NA	NA
WP_057861972.1|8449595_8449796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855651.1|8449805_8450276_-	NifX-associated nitrogen fixation protein	NA	NA	NA	NA	NA
WP_057861970.1|8450283_8450679_-	nitrogen fixation protein NifX	NA	NA	NA	NA	NA
WP_161855652.1|8450675_8452082_-	nitrogenase iron-molybdenum cofactor biosynthesis protein NifN	NA	NA	NA	NA	NA
WP_161855653.1|8452091_8453756_-	nitrogenase iron-molybdenum cofactor biosynthesis protein NifE	NA	NA	NA	NA	NA
WP_161855654.1|8453855_8455415_-	nitrogenase molybdenum-iron protein subunit beta	NA	NA	NA	NA	NA
WP_161855655.1|8455487_8456990_-	nitrogenase molybdenum-iron protein alpha chain	NA	NA	NA	NA	NA
WP_161855656.1|8457717_8460018_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_161855657.1|8460449_8460671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161856809.1|8460681_8460876_-	ferredoxin	NA	NA	NA	NA	NA
WP_161855658.1|8462227_8462416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161853322.1|8463735_8464827_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP022222	Bradyrhizobium sp. CCBAU 051011 chromosome, complete genome	9099371	8751811	8840974	9099371	protease,integrase,transposase	Acanthocystis_turfacea_Chlorella_virus(12.0%)	77	8779713:8779730	8816631:8816648
WP_161849892.1|8751811_8752771_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	32.9	2.5e-22
WP_161855860.1|8753420_8754887_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_161855861.1|8755109_8756537_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	31.2	9.6e-47
WP_161855862.1|8756663_8757860_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	54.2	7.2e-104
WP_161856828.1|8757920_8759273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855863.1|8760211_8761330_-	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	45.0	4.7e-89
WP_161855864.1|8761364_8762081_-	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	24.0	1.1e-06
WP_161855865.1|8762073_8762826_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	24.9	1.3e-10
WP_161855866.1|8762822_8763854_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_057835590.1|8763861_8764731_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_161855867.1|8764910_8766083_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_161855868.1|8766430_8766706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855869.1|8766797_8767661_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_161855870.1|8767801_8768647_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_161855871.1|8769243_8769480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855872.1|8769781_8770540_+	porin family protein	NA	NA	NA	NA	NA
WP_161855873.1|8770798_8771236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161856829.1|8771374_8772352_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_161855874.1|8772469_8773414_-	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	56.3	2.0e-93
WP_161855875.1|8773394_8774477_-	GDP-mannose 4,6-dehydratase	NA	A0A0E3I0Y8	Synechococcus_phage	66.0	1.5e-129
WP_161855876.1|8774531_8775707_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_161855877.1|8775890_8776565_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_065756420.1|8776857_8777679_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.4	1.9e-15
WP_161855878.1|8777675_8779607_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.2	1.0e-35
8779713:8779730	attL	GGTCAAGCCCGGCGATGA	NA	NA	NA	NA
WP_161855879.1|8779755_8780649_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_161855880.1|8780655_8781729_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_161855881.1|8781780_8783061_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_161855882.1|8783210_8784050_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.9	2.3e-08
WP_161855883.1|8784175_8785336_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_161855884.1|8785425_8786649_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_161855885.1|8787609_8787996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161851761.1|8788150_8789494_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	44.4	3.0e-50
WP_161855886.1|8789833_8790550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855887.1|8790789_8791017_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161855888.1|8791147_8791978_+	YqaJ viral recombinase family protein	NA	NA	NA	NA	NA
WP_161855889.1|8791958_8793086_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	42.5	7.4e-10
WP_161853322.1|8793252_8794344_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_161855890.1|8796999_8797524_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_161855891.1|8797652_8798738_+	GDP-mannose 4,6-dehydratase	NA	M1HF79	Acanthocystis_turfacea_Chlorella_virus	62.8	1.6e-131
WP_161855892.1|8798718_8799714_+	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	52.6	5.4e-89
WP_161855893.1|8799932_8800871_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_161856830.1|8800931_8802521_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	37.1	4.8e-87
WP_161855894.1|8802589_8802715_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161851782.1|8802830_8803214_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	55.6	3.8e-06
WP_057019331.1|8803210_8803357_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_161855895.1|8803460_8804699_+|integrase	site-specific integrase	integrase	Q7Y4M3	Streptococcus_phage	25.1	1.2e-05
WP_161855896.1|8804695_8805628_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_161855897.1|8805624_8806632_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F2H8	Mycobacterium_phage	31.5	7.1e-12
WP_161855898.1|8806831_8807260_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161855899.1|8807347_8808529_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_161855900.1|8808525_8809455_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_161856831.1|8809451_8810303_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_161855901.1|8810371_8811226_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_161855902.1|8811236_8812325_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_161855903.1|8812328_8814167_-	asparagine synthase (glutamine-hydrolyzing)	NA	H8ZJK1	Ostreococcus_tauri_virus	25.6	2.5e-15
WP_161855904.1|8814169_8815723_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_161855905.1|8815765_8816863_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	34.3	2.3e-48
8816631:8816648	attR	TCATCGCCGGGCTTGACC	NA	NA	NA	NA
WP_161855906.1|8816862_8817342_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_161855907.1|8817338_8818400_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_161855908.1|8818853_8820212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855909.1|8820538_8821882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855910.1|8821878_8823171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855911.1|8823950_8825021_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	44.9	2.0e-81
WP_161855912.1|8825020_8825914_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	50.2	6.2e-76
WP_161856832.1|8825957_8827091_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	36.3	1.9e-21
WP_161855913.1|8827159_8829019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161856833.1|8829146_8829785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855914.1|8830441_8830723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855915.1|8830795_8831323_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_161855916.1|8831527_8832247_+	WbqC family protein	NA	NA	NA	NA	NA
WP_161855917.1|8832695_8833358_+	acetyltransferase	NA	NA	NA	NA	NA
WP_161855918.1|8833370_8834297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161855919.1|8834293_8834923_-	class I SAM-dependent methyltransferase	NA	A0A1B1IT46	uncultured_Mediterranean_phage	25.1	4.3e-07
WP_161855920.1|8834936_8835650_-	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_161855921.1|8835646_8836492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161855922.1|8836442_8837471_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_161855923.1|8837791_8840974_-|protease	protease	protease	NA	NA	NA	NA
