The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038807	Staphylococcus lugdunensis strain APC 3758 chromosome, complete genome	2570129	565981	603697	2570129	transposase,protease,integrase	Streptococcus_pyogenes_phage(33.33%)	33	563819:563836	590724:590741
563819:563836	attL	GAATGTAATAAACAAATT	NA	NA	NA	NA
WP_000410574.1|565981_566347_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000026850.1|566355_568419_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000706213.1|568421_569534_-|integrase	tyrosine-type recombinase/integrase	integrase	P97010	Streptococcus_pyogenes_phage	31.6	1.7e-11
WP_002492560.1|570577_571066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002492582.1|571127_573965_-	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_002492407.1|574273_576280_+	amidase domain-containing protein	NA	Q332B8	Clostridium_botulinum_C_phage	36.2	2.8e-12
WP_002492428.1|576785_578765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002492426.1|579410_580463_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002492563.1|580475_580835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002460656.1|581021_581864_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002478990.1|583034_583406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002460658.1|584048_584252_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002492438.1|584248_584965_+	DUF3169 family protein	NA	NA	NA	NA	NA
WP_002460661.1|585023_585866_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_002460663.1|585865_586501_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_002492500.1|586600_587476_-	ribokinase	NA	NA	NA	NA	NA
WP_002492459.1|587598_588003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002478995.1|588016_588583_-	VOC family protein	NA	NA	NA	NA	NA
WP_002492574.1|588732_589710_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002492567.1|589940_590903_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
590724:590741	attR	GAATGTAATAAACAAATT	NA	NA	NA	NA
WP_002492448.1|590970_592326_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_002460675.1|592340_592625_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002460676.1|592624_593071_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002492561.1|593086_595018_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_002492511.1|595228_596209_+	choloylglycine hydrolase family protein	NA	M1H8K9	Paramecium_bursaria_Chlorella_virus	27.4	2.9e-26
WP_002492370.1|596326_597700_-	MFS transporter	NA	NA	NA	NA	NA
WP_002460682.1|597983_598700_+	DUF969 domain-containing protein	NA	NA	NA	NA	NA
WP_002460683.1|598680_599607_+	DUF979 domain-containing protein	NA	NA	NA	NA	NA
WP_002460684.1|599651_600290_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_002492411.1|600381_601029_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002479005.1|601318_602119_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002460688.1|602277_602859_-	NDxxF motif lipoprotein	NA	NA	NA	NA	NA
WP_002460689.1|602878_603697_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP038807	Staphylococcus lugdunensis strain APC 3758 chromosome, complete genome	2570129	931047	947473	2570129	terminase,integrase	Staphylococcus_phage(53.85%)	24	936993:937052	950075:950148
WP_002492025.1|931047_931875_+	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	38.1	6.4e-11
WP_002479237.1|932083_932965_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_002479238.1|932982_933198_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_002479239.1|933197_934295_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_002479240.1|934534_934726_-	hypothetical protein	NA	A0A2H4JGI3	uncultured_Caudovirales_phage	78.3	3.7e-23
WP_002461100.1|934787_935573_-	lysozyme	NA	A0A291I9H5	Lactobacillus_phage	45.6	6.1e-35
WP_002461101.1|935890_936187_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_002461102.1|936208_936718_+	single-stranded DNA-binding protein	NA	A0A2H4JCF2	uncultured_Caudovirales_phage	79.9	3.8e-62
WP_002461103.1|936764_937007_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
936993:937052	attL	AAAGAAGAAAACTAATATATAGTTTATTATAAAACCCCGTAAGCATAGGCTTATGGGGTT	NA	NA	NA	NA
WP_002492008.1|937152_938373_-|integrase	site-specific integrase	integrase	Q4ZE80	Staphylococcus_phage	80.2	6.3e-180
WP_002459649.1|938409_939102_-	hypothetical protein	NA	A0A1J0MG42	Staphylococcus_phage	38.6	5.7e-29
WP_002459648.1|939128_939701_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_161510799.1|939872_940094_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002492070.1|940094_940367_+	helix-turn-helix domain-containing protein	NA	Q4ZE77	Staphylococcus_phage	74.4	7.4e-33
WP_002492019.1|940531_940951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002492064.1|940950_941253_+	DUF1474 family protein	NA	A0A2H4JB50	uncultured_Caudovirales_phage	82.8	5.5e-37
WP_002492075.1|941346_942216_+	hypothetical protein	NA	A0A2H4JEH3	uncultured_Caudovirales_phage	59.0	6.2e-97
WP_002492057.1|942229_943939_+	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	69.9	1.0e-236
WP_002492062.1|944263_944785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002492071.1|944786_945428_+	pathogenicity island protein	NA	Q4ZE67	Staphylococcus_phage	70.4	7.5e-84
WP_002445374.1|945713_946058_+	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	86.8	2.7e-48
WP_002445375.1|946047_946305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002445376.1|946316_946838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002445377.1|946900_947473_+|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	72.1	1.4e-73
950075:950148	attR	AAAGAAGAAAACTAATATATAGTTTATTATAAAACCCCGTAAGCATAGGCTTATGGGGTTGTTTTTGTGTTTTG	NA	NA	NA	NA
>prophage 3
NZ_CP038807	Staphylococcus lugdunensis strain APC 3758 chromosome, complete genome	2570129	1271791	1278412	2570129		Staphylococcus_phage(16.67%)	8	NA	NA
WP_002492999.1|1271791_1272628_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	44.4	1.2e-62
WP_002459768.1|1272784_1273807_+	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	41.9	3.2e-60
WP_002493007.1|1273847_1274438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002459766.1|1274536_1275253_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	40.7	1.8e-49
WP_002459765.1|1275252_1275672_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_002492964.1|1275673_1276345_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.9	3.6e-68
WP_002479366.1|1276680_1277277_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.5	1.4e-39
WP_002459762.1|1277260_1278412_+	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	35.1	6.0e-23
>prophage 4
NZ_CP038807	Staphylococcus lugdunensis strain APC 3758 chromosome, complete genome	2570129	1293675	1311456	2570129		uncultured_Caudovirales_phage(58.33%)	15	NA	NA
WP_002459751.1|1293675_1294731_+	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	27.7	3.0e-21
WP_002492147.1|1294968_1295499_+	5'-3'-deoxyribonucleotidase	NA	A0A0A0PKY7	Bacillus_phage	37.8	1.3e-28
WP_002492138.1|1295802_1296717_-	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
WP_002492139.1|1297043_1298549_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	1.2e-60
WP_002479355.1|1298833_1299334_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	70.8	1.0e-51
WP_002492137.1|1299346_1300216_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002459743.1|1301089_1301488_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	76.5	4.3e-53
WP_002459742.1|1301450_1303556_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_002459741.1|1303795_1304764_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	92.9	5.7e-176
WP_002459740.1|1305132_1306110_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	81.4	4.4e-144
WP_002459739.1|1306090_1307050_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	62.0	4.1e-09
WP_002492145.1|1307046_1307829_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.1	1.7e-16
WP_002492141.1|1307943_1308978_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002492143.1|1309538_1310516_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	79.3	5.8e-136
WP_037540663.1|1310496_1311456_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	62.0	3.2e-06
>prophage 5
NZ_CP038807	Staphylococcus lugdunensis strain APC 3758 chromosome, complete genome	2570129	1597197	1605667	2570129		Synechococcus_phage(33.33%)	9	NA	NA
WP_002478383.1|1597197_1597680_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.7	6.8e-21
WP_002492672.1|1597666_1598794_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_002478381.1|1598794_1599499_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	42.4	4.0e-46
WP_002459451.1|1599498_1599759_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002478380.1|1599760_1600432_+	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
WP_002478379.1|1600424_1602614_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	37.7	1.0e-135
WP_037540539.1|1602592_1604077_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.2	3.2e-45
WP_002478378.1|1604069_1605101_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.1	8.7e-66
WP_002492152.1|1605100_1605667_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.2	3.4e-27
>prophage 6
NZ_CP038807	Staphylococcus lugdunensis strain APC 3758 chromosome, complete genome	2570129	2009293	2017988	2570129		Bacillus_phage(33.33%)	9	NA	NA
WP_002459069.1|2009293_2010673_-	ATP-dependent DNA helicase RecQ	NA	J2YAJ8	Acanthamoeba_polyphaga_lentillevirus	33.2	1.6e-51
WP_002492332.1|2010659_2011619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002449743.1|2011729_2011978_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	49.3	5.8e-16
WP_002478165.1|2012119_2012662_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_002492342.1|2013382_2015131_-	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	31.6	1.5e-20
WP_002459064.1|2015114_2015840_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.5	3.4e-48
WP_002478163.1|2015990_2016728_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002492337.1|2016730_2017264_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	29.1	4.6e-10
WP_002459061.1|2017256_2017988_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.0	1.1e-06
>prophage 7
NZ_CP038807	Staphylococcus lugdunensis strain APC 3758 chromosome, complete genome	2570129	2144620	2153651	2570129	tRNA	uncultured_Mediterranean_phage(50.0%)	7	NA	NA
WP_002458930.1|2144620_2145139_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.8	1.4e-27
WP_037540789.1|2145158_2147435_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.0	3.3e-65
WP_037540792.1|2147707_2149996_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	34.4	2.8e-32
WP_002458927.1|2150181_2150442_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	39.3	2.8e-05
WP_002458926.1|2150460_2151600_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.0	5.4e-85
WP_002492120.1|2151618_2152644_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002478078.1|2152646_2153651_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	3.8e-05
>prophage 8
NZ_CP038807	Staphylococcus lugdunensis strain APC 3758 chromosome, complete genome	2570129	2271020	2301275	2570129	tRNA	Staphylococcus_phage(96.15%)	32	NA	NA
WP_002492605.1|2271020_2272280_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	84.5	5.7e-43
WP_002458814.1|2272399_2272711_-	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	68.0	6.5e-33
WP_002492652.1|2272729_2275144_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	87.1	0.0e+00
WP_002492648.1|2275465_2276641_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	78.8	1.4e-176
WP_002492612.1|2276744_2277698_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	85.4	4.1e-70
WP_002458810.1|2277694_2278258_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	67.4	3.5e-69
WP_002458809.1|2278308_2278710_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002458808.1|2279204_2280038_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002492647.1|2280254_2281241_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	72.6	7.2e-134
WP_002458806.1|2281318_2281777_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	80.9	8.6e-58
WP_002478008.1|2281789_2282971_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	75.3	2.9e-174
WP_002458804.1|2282983_2283616_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	70.5	2.3e-77
WP_002492592.1|2283623_2284730_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	62.6	4.9e-123
WP_002492594.1|2285041_2286541_-	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	77.2	9.9e-18
WP_002458801.1|2286924_2287779_-	autolysin	NA	A0A1W6JNR1	Staphylococcus_phage	42.1	7.5e-39
WP_002458800.1|2287980_2288205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002478005.1|2288402_2288873_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4PQT5	Staphylococcus_phage	45.5	1.6e-27
WP_002492607.1|2288888_2289335_+	competence protein ComK	NA	NA	NA	NA	NA
WP_002458797.1|2289315_2289768_-	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	43.6	1.6e-16
WP_002458796.1|2289898_2290612_-	transaldolase	NA	M1PR54	Cyanophage	36.3	1.1e-19
WP_002478003.1|2290868_2291174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002478002.1|2291242_2291608_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	62.0	2.0e-33
WP_002478001.1|2291604_2291958_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_002492600.1|2292142_2292976_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	72.9	2.1e-118
WP_002458791.1|2293090_2293999_-	hypothetical protein	NA	A0A2H4PQQ8	Staphylococcus_phage	76.6	1.3e-102
WP_002458790.1|2294097_2295294_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	87.4	1.7e-198
WP_002492597.1|2295665_2297258_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	85.8	1.5e-274
WP_002492634.1|2297321_2298095_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	69.4	5.0e-98
WP_002492645.1|2298075_2298549_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	60.6	2.6e-49
WP_002458786.1|2298615_2298873_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	70.4	1.2e-29
WP_002492644.1|2298869_2299874_-	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	51.7	2.3e-95
WP_002492603.1|2299880_2301275_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	62.3	1.1e-169
>prophage 9
NZ_CP038807	Staphylococcus lugdunensis strain APC 3758 chromosome, complete genome	2570129	2422139	2435309	2570129	terminase,integrase	Staphylococcus_phage(66.67%)	18	2419516:2419535	2433343:2433362
2419516:2419535	attL	TTTTACATCATACCTGGCAT	NA	NA	NA	NA
WP_080047653.1|2422139_2422388_-	DUF3102 domain-containing protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	51.8	1.8e-17
WP_002492698.1|2423171_2423681_-	DUF4065 domain-containing protein	NA	D7RWK7	Brochothrix_phage	37.4	3.8e-22
WP_002445377.1|2423960_2424533_-|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	72.1	1.4e-73
WP_002445376.1|2424595_2425117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002445375.1|2425128_2425386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002445374.1|2425375_2425720_-	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	86.8	2.7e-48
WP_002492310.1|2426007_2426649_-	pathogenicity island protein	NA	Q4ZE67	Staphylococcus_phage	74.2	3.0e-88
WP_002445372.1|2426662_2427028_-	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	81.8	2.7e-54
WP_002445371.1|2427375_2429085_-	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	92.8	1.2e-301
WP_002445370.1|2429098_2429968_-	hypothetical protein	NA	Q4ZE74	Staphylococcus_phage	94.5	1.2e-161
WP_002445368.1|2430031_2430355_-	DUF1474 family protein	NA	Q4ZE75	Staphylococcus_phage	88.9	6.7e-49
WP_001058489.1|2430357_2430567_-	hypothetical protein	NA	Q4ZE76	Staphylococcus_phage	98.6	1.6e-30
WP_002445365.1|2430559_2430706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002445364.1|2430702_2431020_-	helix-turn-helix domain-containing protein	NA	A0A1W6JQE0	Staphylococcus_phage	97.1	2.7e-50
WP_000153640.1|2431024_2431243_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JB11	uncultured_Caudovirales_phage	66.7	1.3e-19
WP_002445345.1|2431415_2432090_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JGT9	uncultured_Caudovirales_phage	45.8	2.7e-39
WP_002492309.1|2432103_2433276_+|integrase	site-specific integrase	integrase	A0A1W6JQD3	Staphylococcus_phage	97.4	3.9e-219
WP_002461410.1|2435024_2435309_-	co-chaperone GroES	NA	A0A221S386	uncultured_virus	45.2	1.2e-12
2433343:2433362	attR	TTTTACATCATACCTGGCAT	NA	NA	NA	NA
