The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046377	Pectobacterium polaris strain PZ1 chromosome, complete genome	4994870	5314	64671	4994870	terminase,capsid,tRNA,integrase,holin,tail,portal,head	Cronobacter_phage(54.55%)	57	12739:12754	42867:42882
WP_121313378.1|5314_5620_-|holin	holin	holin	Q6K1I2	Salmonella_virus	57.3	1.3e-17
WP_161546566.1|5606_6086_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	66.7	9.7e-52
WP_161546567.1|7239_7917_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	57.0	1.2e-66
WP_161546568.1|7913_8414_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	47.5	1.4e-37
WP_161546569.1|8410_8863_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	69.3	2.8e-53
WP_161546570.1|8957_9659_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	55.2	1.4e-67
WP_161546571.1|9661_10702_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	77.8	3.6e-144
WP_161546572.1|10778_11600_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	55.2	3.2e-71
WP_121331520.1|11763_13539_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	78.7	3.3e-270
12739:12754	attL	CGGCTCTGCCCTGACG	NA	NA	NA	NA
WP_121331521.1|13535_14555_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	79.0	8.1e-157
WP_161546573.1|14617_14884_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	67.0	4.9e-29
WP_161546574.1|14860_15070_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	57.1	5.7e-09
WP_155278034.1|15231_15507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161546575.1|15511_17809_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	60.7	4.5e-264
WP_044207000.1|18011_18323_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_044207003.1|18322_18571_-	DUF2732 family protein	NA	A0A0F7LBR4	Escherichia_phage	53.7	1.3e-07
WP_044207006.1|18633_19134_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	56.6	6.5e-51
WP_044207009.1|19135_19339_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_039543950.1|19350_19854_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	54.9	2.1e-41
WP_039275343.1|19887_20133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161546576.1|20228_20828_+	phage repressor protein	NA	F1BUN8	Cronobacter_phage	40.0	2.1e-35
WP_161546577.1|22727_23732_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	61.1	7.3e-118
WP_039512406.1|24026_24656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039482809.1|26070_27495_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_039482815.1|28881_29361_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_010298789.1|29485_30364_+	CNNM family magnesium/cobalt transport protein CorC	NA	NA	NA	NA	NA
WP_039512403.1|30371_31901_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_039482821.1|32308_33205_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010285409.1|33423_34164_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_039482823.1|34167_34842_+	glutamate/aspartate ABC transporter permease GltK	NA	NA	NA	NA	NA
WP_039482825.1|34841_35567_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	4.9e-31
WP_039512401.1|35720_36203_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_039482829.1|39110_39665_+	LPS assembly lipoprotein LptE	NA	NA	NA	NA	NA
WP_039482830.1|39661_40687_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_039482834.1|40653_41343_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_039482837.1|41537_41855_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005976291.1|41856_42327_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_039482839.1|42360_44265_+	peptidoglycan DD-transpeptidase MrdA	NA	NA	NA	NA	NA
42867:42882	attR	CGGCTCTGCCCTGACG	NA	NA	NA	NA
WP_039512397.1|45399_46521_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	43.8	6.5e-14
WP_005976281.1|48033_48297_+	YbeD family protein	NA	NA	NA	NA	NA
WP_039482925.1|48451_49126_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_039482849.1|49353_50319_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_039482851.1|50401_50599_-	twin-arginine translocase subunit TatE	NA	NA	NA	NA	NA
WP_039482854.1|51051_51435_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	54.6	4.4e-23
WP_005976270.1|51541_51751_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	85.2	9.1e-23
WP_039482856.1|51968_52679_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_137739554.1|52843_52903_-	protein YpfM	NA	NA	NA	NA	NA
WP_039482860.1|53516_54644_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_039482862.1|54640_55315_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_039482863.1|55317_55512_+	YpfN family protein	NA	NA	NA	NA	NA
WP_161546578.1|55619_57290_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_039482868.1|57658_58276_-	esterase	NA	NA	NA	NA	NA
WP_039482870.1|58441_58669_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_039512394.1|58809_59181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039482874.1|59814_60426_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_039482878.1|62307_62595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052012040.1|62622_64671_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP046377	Pectobacterium polaris strain PZ1 chromosome, complete genome	4994870	181341	292302	4994870	terminase,plate,capsid,tRNA,integrase,tail,portal,holin,lysis,head,transposase	Salmonella_phage(15.69%)	106	225425:225475	260607:260657
WP_039486568.1|181341_182274_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_072012421.1|182377_183826_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	36.3	1.5e-26
WP_039486562.1|183822_184353_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_039486560.1|184459_185257_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_039514123.1|185302_186157_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_039486661.1|186174_186555_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_039486554.1|186615_187386_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_039486551.1|187382_188321_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.4e-22
WP_039486548.1|188458_189100_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_039293187.1|189159_189696_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	34.6	1.3e-17
WP_039486546.1|189845_190277_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_039486543.1|190277_191363_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_011094845.1|193410_193758_+	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_039486534.1|193863_194727_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_161546584.1|194772_195567_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_014916295.1|196257_196497_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	59.5	9.1e-19
WP_161546585.1|196506_196914_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A220BYR7	Staphylococcus_phage	25.6	2.3e-06
WP_161547139.1|196910_199058_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.0	1.9e-203
WP_039486524.1|199082_200045_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	73.9	8.0e-138
WP_039486522.1|200426_201164_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	37.1	1.4e-38
WP_039486519.1|201220_201685_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	56.1	1.8e-47
WP_039486516.1|201704_202415_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_161546586.1|202454_203210_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_161546587.1|203280_204654_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	35.5	2.2e-08
WP_161546588.1|204722_205511_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_039488069.1|211552_214129_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.4	3.8e-126
WP_039488070.1|214262_214988_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_039488071.1|215031_216009_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_039488072.1|216143_216878_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_039488073.1|217198_217537_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_039488074.1|217886_219047_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_039488075.1|219111_220233_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_039488076.1|220239_221313_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	1.6e-86
WP_010306189.1|221562_222279_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_039488078.1|222325_222676_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_161546589.1|222736_223945_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	49.7	3.2e-51
WP_039483930.1|224258_225197_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
225425:225475	attL	AATAACAACTTTCGGATGTTGCGAAAGCGCTATCTTAGTTAAGACGCTCTT	NA	NA	NA	NA
WP_161546590.1|225572_226604_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	72.4	3.3e-150
WP_039350754.1|226608_227148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161546591.1|227166_228030_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	51.4	1.5e-82
WP_161546592.1|228151_228376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039350745.1|228414_228924_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	57.1	1.5e-50
WP_161546593.1|229281_229782_+	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	59.6	2.6e-55
WP_029369344.1|229844_230093_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_161546594.1|230092_230398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161546595.1|230400_230712_+	hypothetical protein	NA	R9TMR5	Vibrio_phage	51.7	3.4e-13
WP_161547140.1|233082_233316_+	hypothetical protein	NA	A0A1R3Y5T1	Salmonella_virus	36.6	4.3e-05
WP_072014151.1|233315_233498_+	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	51.9	2.5e-08
WP_044208969.1|233683_233905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044208971.1|234159_234978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052510498.1|234979_235726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044208974.1|235782_236793_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	74.5	6.2e-149
WP_161546596.1|236789_238559_-|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	81.2	1.5e-283
WP_103184688.1|238698_239553_+|capsid	GPO family capsid scaffolding protein	capsid	Q6K1I7	Salmonella_virus	65.3	2.4e-93
WP_103184672.1|239604_240789_+|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	65.5	4.1e-128
WP_161546597.1|240792_241452_+|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	65.6	4.4e-71
WP_103184670.1|241543_242047_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	58.9	3.3e-50
WP_039491308.1|242046_242250_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	73.1	3.4e-22
WP_161546598.1|242253_242547_+|holin	holin	holin	S4TP56	Salmonella_phage	66.7	3.3e-26
WP_161546599.1|242533_243022_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	80.6	2.3e-69
WP_161547141.1|243021_243468_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	37.0	4.4e-14
WP_161546600.1|243557_244013_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	67.7	1.4e-52
WP_116156595.1|244005_244635_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	38.1	6.6e-32
WP_103161044.1|244663_245005_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	1.4e-41
WP_161546601.1|245139_245454_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	65.0	6.2e-31
WP_103161047.1|246661_247720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161546602.1|247818_248454_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	78.2	5.3e-90
WP_039512482.1|248450_248795_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	65.8	9.1e-36
WP_161546603.1|248798_249707_+|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	77.2	1.6e-124
WP_161546604.1|249699_250311_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	68.5	3.2e-76
WP_146043910.1|252179_252560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039512476.1|254626_255148_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	79.1	1.6e-76
WP_161546605.1|255215_255512_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	67.4	8.7e-27
WP_010310409.1|255526_255649_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	81.6	4.2e-12
WP_161546606.1|255641_258524_+|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	60.8	8.2e-138
WP_161546607.1|258520_259006_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	60.9	3.2e-50
WP_161546608.1|259002_260166_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	67.4	2.3e-147
WP_010308353.1|260248_260467_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	68.1	1.2e-25
WP_161546609.1|260640_260988_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
260607:260657	attR	AATAACAACTTTCGGATGTTGCGAAAGCGCTATCTTAGTTAAGACGCTCTT	NA	NA	NA	NA
WP_161546610.1|261051_261807_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_039483924.1|261845_262394_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_010285998.1|262412_262661_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_039483922.1|262818_264180_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_039483921.1|264350_265145_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_014916315.1|265214_265730_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_039483919.1|265883_267437_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_039483917.1|267519_267948_-	DedA family protein	NA	NA	NA	NA	NA
WP_039514161.1|267944_268511_-	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_005972168.1|269658_269844_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	3.8e-12
WP_039514163.1|270168_272796_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.8	2.3e-78
WP_039483909.1|272933_273428_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_039483907.1|273473_274547_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.9	9.9e-113
WP_161546611.1|274654_275149_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.1	2.9e-27
WP_039483904.1|275373_275709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039483901.1|276760_277435_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_039483898.1|277587_279201_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_039483897.1|281341_281977_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_111778439.1|282067_283408_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_080728051.1|283419_284259_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_161546612.1|284338_285304_-	L-tyrosine/L-tryptophan isonitrile synthase family protein	NA	NA	NA	NA	NA
WP_161546613.1|286209_288774_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.1	4.4e-26
WP_039483889.1|288845_289541_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_039512979.1|289614_290169_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_010285748.1|290409_290610_+	YaeP family protein	NA	NA	NA	NA	NA
WP_029367608.1|290596_290857_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_106389064.1|290982_292302_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP046377	Pectobacterium polaris strain PZ1 chromosome, complete genome	4994870	1455811	1462583	4994870		Escherichia_phage(66.67%)	6	NA	NA
WP_039485257.1|1455811_1456468_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.0	1.1e-82
WP_039485261.1|1456464_1457739_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	65.6	2.0e-152
WP_014917036.1|1457735_1458650_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	77.2	1.5e-117
WP_039513825.1|1458988_1459750_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	62.5	6.8e-84
WP_039485268.1|1461105_1461807_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	29.3	4.0e-14
WP_039485270.1|1461812_1462583_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.7	1.7e-13
>prophage 4
NZ_CP046377	Pectobacterium polaris strain PZ1 chromosome, complete genome	4994870	2028527	2037254	4994870		Dickeya_phage(42.86%)	7	NA	NA
WP_039484594.1|2028527_2029352_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.4	5.2e-13
WP_039484591.1|2029363_2030173_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	2.3e-29
WP_039484588.1|2030394_2030967_+	peptidylprolyl isomerase A	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	35.2	1.5e-11
WP_161546787.1|2031053_2032331_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A1B1IPS8	uncultured_Mediterranean_phage	34.3	1.4e-33
WP_039484584.1|2032500_2033625_-	polysaccharide lyase	NA	A0A140XB77	Dickeya_phage	75.4	5.6e-58
WP_039484582.1|2034333_2035461_-	polysaccharide lyase	NA	A0A140XB77	Dickeya_phage	71.7	4.0e-56
WP_039484581.1|2036129_2037254_-	polysaccharide lyase	NA	A0A140XB77	Dickeya_phage	70.3	1.4e-53
>prophage 5
NZ_CP046377	Pectobacterium polaris strain PZ1 chromosome, complete genome	4994870	2863137	2959190	4994870	terminase,capsid,tRNA,integrase,tail,portal,holin,protease,head	Cronobacter_phage(47.83%)	96	2870274:2870295	2952611:2952632
WP_039485996.1|2863137_2863617_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_039485997.1|2863687_2864506_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_039485998.1|2864691_2864874_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	51.7	3.0e-06
WP_039486001.1|2864896_2865328_+	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	37.3	4.8e-18
WP_039486003.1|2865423_2868147_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.9	3.3e-112
WP_039486006.1|2868264_2868672_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_039486010.1|2868709_2869165_-	NfeD family protein	NA	NA	NA	NA	NA
WP_039486013.1|2869164_2870079_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
2870274:2870295	attL	TGCAACTCGAATTATTTAGGGT	NA	NA	NA	NA
WP_010284079.1|2870401_2870662_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	61.5	3.8e-18
WP_039486016.1|2870665_2871796_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.4e-173
WP_039486019.1|2871917_2874203_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.0	2.1e-285
WP_039486021.1|2874711_2875431_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_039486024.1|2875657_2878297_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	31.4	8.4e-105
WP_072012410.1|2878412_2881268_+	two-component system sensor histidine kinase RcsC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	35.9	1.3e-29
WP_005976164.1|2881305_2881956_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_039486031.1|2881964_2884652_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_039486034.1|2884668_2885838_-	MFS transporter	NA	NA	NA	NA	NA
WP_039486037.1|2886181_2887504_+	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_039486040.1|2887721_2889404_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_052012078.1|2889391_2890207_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_039486044.1|2890212_2891070_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_039486046.1|2891069_2892041_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_039486048.1|2892028_2893495_+	o-succinylbenzoate--CoA ligase	NA	NA	NA	NA	NA
WP_039486050.1|2893496_2893706_-	catalase	NA	NA	NA	NA	NA
WP_010301323.1|2893957_2894497_+	membrane protein	NA	NA	NA	NA	NA
WP_039486051.1|2894676_2895885_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_039486054.1|2896106_2897300_+	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_039486057.1|2897718_2898579_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_039486059.1|2898689_2899460_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_109463635.1|2899584_2900607_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S6L016	Salmonella_phage	55.2	7.7e-107
WP_109463633.1|2901310_2901565_+	Rha family transcriptional regulator	NA	F1BUS7	Erwinia_phage	39.5	1.0e-07
WP_109463632.1|2901577_2902081_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	54.9	1.4e-40
WP_109463631.1|2902094_2902298_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_109463630.1|2902300_2902645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109463629.1|2902719_2902959_+	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
WP_109463628.1|2902955_2903525_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	49.7	3.2e-46
WP_109463627.1|2903521_2904460_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	59.4	1.4e-86
WP_109463641.1|2904459_2906505_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	59.3	1.1e-218
WP_109463626.1|2906614_2906824_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	51.8	3.7e-08
WP_146190892.1|2906800_2907121_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	61.5	7.4e-32
WP_109463625.1|2907129_2908149_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	79.0	3.1e-156
WP_109463624.1|2908145_2909921_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	79.6	1.3e-271
WP_109463623.1|2910084_2910906_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	54.7	4.4e-68
WP_109463622.1|2910982_2912023_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	77.6	5.8e-142
WP_109463621.1|2912025_2912727_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	54.7	1.0e-65
WP_146190894.1|2912786_2913275_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	70.7	2.8e-54
WP_109463620.1|2913271_2913772_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	47.5	2.9e-38
WP_109463619.1|2913768_2914446_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	56.5	5.7e-66
WP_109463618.1|2914463_2915606_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	67.7	1.7e-139
WP_039543978.1|2915602_2916058_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	68.2	1.3e-53
WP_109463617.1|2916067_2916361_+|holin	holin	holin	Q6K1I2	Salmonella_virus	56.2	2.1e-17
WP_044210396.1|2916357_2916699_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	81.2	1.2e-43
WP_109463616.1|2916698_2917055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109463614.1|2917187_2917445_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	60.5	1.1e-20
WP_044209789.1|2917453_2917636_+	hypothetical protein	NA	A5X9I8	Aeromonas_virus	63.0	3.8e-09
WP_109463613.1|2917632_2919642_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	50.8	4.2e-181
WP_109463612.1|2919641_2919977_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	71.8	5.2e-36
WP_109463611.1|2919966_2921151_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	72.3	2.2e-161
WP_109463610.1|2921143_2921776_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	57.7	2.8e-54
WP_109463609.1|2921785_2923078_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	39.0	1.2e-51
WP_109463608.1|2923101_2923329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109463607.1|2923337_2923643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109463606.1|2924460_2925183_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	43.7	7.0e-46
WP_109463605.1|2925154_2925700_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	59.3	2.3e-49
WP_109463604.1|2925696_2927352_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	55.2	5.0e-172
WP_161546863.1|2928282_2928783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161546864.1|2928845_2929058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109463602.1|2929106_2929925_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_072012412.1|2930215_2930899_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_052012079.1|2930821_2931553_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.4	5.0e-07
WP_039512946.1|2931549_2933979_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_039486068.1|2934126_2934927_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	27.1	1.9e-12
WP_039512944.1|2934923_2936006_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_039512942.1|2936012_2937131_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039486077.1|2937283_2938087_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_039486079.1|2938347_2939073_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_039306127.1|2939192_2939687_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_039486081.1|2939940_2941155_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.9	4.7e-34
WP_005970177.1|2941179_2941566_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.4e-53
WP_014916217.1|2941646_2941970_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	46.7	2.7e-21
WP_039486085.1|2942040_2942559_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_039486086.1|2942634_2944482_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.7	2.5e-103
WP_039486088.1|2944483_2944819_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_010280073.1|2944840_2945041_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_010307847.1|2945255_2946563_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.5	5.4e-36
WP_039486090.1|2946615_2947410_+	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
WP_039486092.1|2947444_2948233_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039486094.1|2948274_2949144_-	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_039486096.1|2949247_2950609_-	6-phospho-alpha-glucosidase	NA	NA	NA	NA	NA
WP_039486099.1|2950622_2952203_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_039486102.1|2952687_2953116_+	nucleoside-diphosphate kinase	NA	A0A0M5KH58	Mollivirus	36.6	1.1e-11
2952611:2952632	attR	TGCAACTCGAATTATTTAGGGT	NA	NA	NA	NA
WP_161547156.1|2953411_2954638_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_039486104.1|2954869_2955625_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_039486106.1|2955614_2956616_+	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_039486108.1|2956656_2957778_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_039512938.1|2957915_2959190_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP046377	Pectobacterium polaris strain PZ1 chromosome, complete genome	4994870	3119307	3125950	4994870		Escherichia_phage(33.33%)	8	NA	NA
WP_161546893.1|3119307_3120054_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.3	6.4e-10
WP_161546894.1|3120128_3120266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161546895.1|3120292_3120460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161546896.1|3120923_3121769_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	41.0	2.2e-46
WP_161546897.1|3121765_3122302_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	60.9	1.3e-60
WP_161546898.1|3122303_3123173_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	5.4e-109
WP_039540671.1|3123416_3124313_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	40.6	2.5e-48
WP_161546899.1|3124543_3125950_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D7RI04	Synechococcus_phage	29.8	1.1e-31
>prophage 7
NZ_CP046377	Pectobacterium polaris strain PZ1 chromosome, complete genome	4994870	4101198	4107335	4994870		uncultured_Caudovirales_phage(50.0%)	8	NA	NA
WP_161546988.1|4101198_4102023_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	1.2e-20
WP_039531832.1|4102106_4102532_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.1	2.8e-50
WP_161546989.1|4102541_4103834_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.2	4.3e-171
WP_161546990.1|4103880_4104201_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.2	1.1e-19
WP_161546991.1|4104324_4104774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161546992.1|4105221_4105617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161546993.1|4105843_4106542_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	7.6e-13
WP_029367488.1|4106543_4107335_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.5	2.8e-11
>prophage 8
NZ_CP046377	Pectobacterium polaris strain PZ1 chromosome, complete genome	4994870	4135329	4185930	4994870	transposase,terminase,capsid,bacteriocin	Escherichia_phage(16.67%)	55	NA	NA
WP_161546998.1|4135329_4143714_-	hypothetical protein	NA	Q08J70	Stx2-converting_phage	31.1	0.0e+00
WP_161546999.1|4143785_4143983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161547177.1|4143979_4144387_-	hypothetical protein	NA	Q7Y5W2	Haemophilus_phage	53.0	6.8e-30
WP_161547000.1|4144838_4145021_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_161547001.1|4145117_4145534_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_161547002.1|4145613_4146036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161547003.1|4146056_4146392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161547004.1|4146434_4147778_-	hypothetical protein	NA	A0A088CBK4	Shigella_phage	28.1	1.1e-23
WP_161547005.1|4147790_4148066_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_161547006.1|4148065_4148446_-	hypothetical protein	NA	A0A1I9KFD7	Aeromonas_phage	40.7	8.6e-19
WP_161547179.1|4148447_4149107_-	hypothetical protein	NA	A0A1I9KFE8	Aeromonas_phage	52.6	7.1e-45
WP_161547007.1|4149115_4149463_-	hypothetical protein	NA	A0A088CC37	Shigella_phage	53.8	1.4e-28
WP_161547008.1|4149497_4151363_-	DUF1983 domain-containing protein	NA	A0A2L1IV54	Escherichia_phage	43.7	1.2e-78
WP_161547009.1|4151359_4152985_-	hypothetical protein	NA	A0A075M3B5	Escherichia_Stx1-converting_recombinant_phage	53.1	1.4e-163
WP_161547010.1|4153108_4153408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161547011.1|4153416_4153638_+	hypothetical protein	NA	H9C151	Pectobacterium_phage	78.1	6.0e-25
WP_161547012.1|4153638_4155984_-	hypothetical protein	NA	A0A2D2W7C0	Pectobacterium_phage	33.2	4.0e-50
WP_161547013.1|4155980_4156643_-	hypothetical protein	NA	Q08J85	Stx2-converting_phage	44.9	1.0e-51
WP_161547014.1|4156642_4157224_-	hypothetical protein	NA	A0A2L1IV64	Escherichia_phage	36.3	8.5e-26
WP_161547015.1|4157223_4157661_-	hypothetical protein	NA	A0A1I9KFH0	Aeromonas_phage	53.5	2.2e-26
WP_161547016.1|4157717_4158101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161547017.1|4158170_4159394_-|capsid	N4-gp56 family major capsid protein	capsid	A0A088CC32	Shigella_phage	74.4	9.4e-176
WP_161547018.1|4159450_4160500_-	hypothetical protein	NA	A0A0H4J3F0	Shigella_phage	41.2	5.1e-53
WP_161547019.1|4160739_4161009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161547181.1|4161005_4161974_-	pyocin	NA	NA	NA	NA	NA
WP_161547183.1|4165910_4167575_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	75.1	7.1e-251
WP_161547020.1|4167622_4168489_-|terminase	terminase	terminase	A0A1I9KFG9	Aeromonas_phage	43.8	6.2e-41
WP_161547185.1|4168553_4168883_-	hypothetical protein	NA	A0A2P1JUA7	Erwinia_phage	72.0	5.1e-44
WP_161547021.1|4169968_4170499_-	hypothetical protein	NA	H9C185	Pectobacterium_phage	67.5	2.5e-53
WP_044202447.1|4170583_4170826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014915656.1|4170822_4171143_-	hypothetical protein	NA	A0A088FVG2	Escherichia_phage	50.0	8.8e-25
WP_161509175.1|4171142_4171736_-	N-acetylmuramidase family protein	NA	H2DE58	Erwinia_phage	69.7	3.0e-71
WP_161547022.1|4171895_4172702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161547023.1|4173150_4174689_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	85.5	1.5e-255
WP_161547024.1|4174718_4175066_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	89.6	9.4e-57
WP_161547025.1|4175062_4175467_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	51.9	3.1e-11
WP_161547026.1|4175499_4176207_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_105879694.1|4176362_4176800_-	VRR-NUC domain-containing protein	NA	A0A0D4DBJ8	Acinetobacter_phage	42.9	8.6e-23
WP_161547187.1|4176805_4177102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161547027.1|4177013_4177583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161547028.1|4177590_4177950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161547029.1|4177933_4178509_-	hypothetical protein	NA	A0A1B1ITH5	uncultured_Mediterranean_phage	37.3	1.8e-28
WP_105879697.1|4178581_4178884_-	DUF1364 domain-containing protein	NA	A0A2K8HR56	Pseudomonas_phage	43.3	5.4e-16
WP_161547030.1|4178886_4179534_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	33.8	5.7e-23
WP_161547031.1|4179530_4179911_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	69.1	2.0e-44
WP_161547032.1|4179907_4180573_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	69.2	1.8e-88
WP_161547033.1|4180569_4181349_-	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	58.1	1.3e-77
WP_161547034.1|4181348_4182479_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	61.6	1.2e-100
WP_161547035.1|4182558_4183212_-	hypothetical protein	NA	H2DE84	Erwinia_phage	51.4	2.6e-39
WP_161547036.1|4183198_4184125_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	62.2	2.1e-34
WP_072014016.1|4184121_4184295_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_161547037.1|4184272_4184467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161547038.1|4184463_4184817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105879708.1|4184831_4185077_-	helix-turn-helix domain-containing protein	NA	A0A2D1GLN0	Escherichia_phage	70.3	4.8e-23
WP_161547039.1|4185186_4185930_+	helix-turn-helix transcriptional regulator	NA	A0A2D1GM27	Escherichia_phage	60.9	3.2e-78
>prophage 9
NZ_CP046377	Pectobacterium polaris strain PZ1 chromosome, complete genome	4994870	4189353	4200347	4994870		Vibrio_phage(20.0%)	15	NA	NA
WP_044202393.1|4189353_4189614_+	KTSC domain-containing protein	NA	A9YWW2	Burkholderia_phage	56.0	8.4e-18
WP_161547045.1|4189690_4190026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155277992.1|4190163_4190310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161547046.1|4190322_4191165_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	50.2	8.1e-70
WP_161547047.1|4191151_4192195_+	hypothetical protein	NA	A0A2H4J6P1	uncultured_Caudovirales_phage	55.0	4.4e-89
WP_161547048.1|4192191_4192605_+	hypothetical protein	NA	A0A2I7RQ39	Vibrio_phage	40.5	1.9e-08
WP_161547049.1|4192778_4193918_+	hypothetical protein	NA	M4MHC3	Vibrio_phage	27.7	2.6e-34
WP_161547050.1|4193914_4194337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161547051.1|4194352_4194976_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	44.0	5.7e-36
WP_161547052.1|4194990_4195800_+	hypothetical protein	NA	A0A1B0YZY3	Pseudomonas_phage	34.8	1.8e-34
WP_161547053.1|4196058_4196544_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.1	1.1e-58
WP_161547054.1|4196755_4196980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161547055.1|4197038_4197515_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	59.5	4.8e-51
WP_044202365.1|4197593_4197830_+	excisionase	NA	NA	NA	NA	NA
WP_111778702.1|4199093_4200347_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	77.8	3.8e-15
>prophage 10
NZ_CP046377	Pectobacterium polaris strain PZ1 chromosome, complete genome	4994870	4388903	4398570	4994870	tRNA	Tupanvirus(33.33%)	9	NA	NA
WP_039480522.1|4388903_4390622_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	5.5e-57
WP_009112984.1|4391399_4391696_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.1e-13
WP_039480519.1|4391700_4394088_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	28.9	5.1e-08
WP_039480516.1|4394102_4395086_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	39.3	4.5e-35
WP_106120997.1|4395268_4395313_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_005968887.1|4395395_4395752_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_010275699.1|4395795_4395993_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_072012330.1|4396096_4396639_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.5	1.7e-15
WP_039480511.1|4396641_4398570_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	1.4e-128
>prophage 11
NZ_CP046377	Pectobacterium polaris strain PZ1 chromosome, complete genome	4994870	4530174	4632612	4994870	plate,tRNA,integrase,holin,tail,protease,transposase	Burkholderia_phage(22.58%)	89	4578945:4578959	4635891:4635905
WP_039480237.1|4530174_4530834_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	48.4	5.1e-43
WP_039512636.1|4530943_4531273_+	sulfurtransferase TusE	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	50.0	1.1e-22
WP_039480232.1|4531285_4531564_-	acylphosphatase	NA	NA	NA	NA	NA
WP_039480229.1|4531788_4532097_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_039480225.1|4532179_4532593_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_039480222.1|4532787_4533312_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_039480219.1|4533449_4533908_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_039480217.1|4533985_4536043_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	24.9	2.6e-16
WP_039480214.1|4536239_4536686_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_039480211.1|4536706_4538842_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_039480210.1|4538858_4539479_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_039480208.1|4539702_4540209_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_039480205.1|4540571_4541672_+	porin OmpA	NA	NA	NA	NA	NA
WP_039480203.1|4541824_4542283_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_039480200.1|4542449_4544219_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_039480199.1|4544310_4544829_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_080728024.1|4544923_4545577_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_039480193.1|4545735_4547415_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.7	5.8e-59
WP_039480192.1|4547434_4548907_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_039512640.1|4548975_4549563_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_039512642.1|4549916_4551950_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.2	3.8e-20
WP_010287191.1|4552166_4552805_+	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_039480186.1|4553873_4554203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039480183.1|4554274_4554811_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_039480182.1|4556663_4557833_-	MFS transporter	NA	NA	NA	NA	NA
WP_039480180.1|4558182_4558698_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.0	1.2e-15
WP_039480178.1|4559074_4559962_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_039512644.1|4560858_4561362_+	DNA starvation/stationary phase protection protein Dps	NA	A0A2K9VDB4	Lactobacillus_phage	26.5	3.1e-08
WP_161547044.1|4561488_4562817_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_039480175.1|4563187_4563934_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_005972676.1|4563960_4564620_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_010294867.1|4564616_4565339_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	3.3e-35
WP_161547081.1|4565390_4567259_-	peptidase M3	NA	NA	NA	NA	NA
WP_161547082.1|4567344_4568313_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_161547083.1|4568422_4568998_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	76.8	7.0e-73
WP_161547084.1|4569073_4569715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161547085.1|4569766_4570069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039273102.1|4571783_4572365_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	63.3	8.7e-63
WP_111778406.1|4572357_4573461_-|plate	baseplate protein	plate	A4JWL6	Burkholderia_virus	54.3	6.6e-104
WP_039273098.1|4573451_4573799_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	61.1	1.2e-32
WP_039273096.1|4573857_4574439_-|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	55.4	7.9e-24
WP_039480159.1|4574435_4575596_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	50.0	1.4e-83
WP_014914964.1|4575583_4575796_-	membrane protein	NA	A4JWL2	Burkholderia_virus	58.6	2.0e-17
WP_039480157.1|4575785_4576715_-|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	60.5	3.9e-41
WP_039480155.1|4576714_4579246_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	27.4	5.6e-66
4578945:4578959	attL	CGTAGCGCTTCCTGA	NA	NA	NA	NA
WP_108723452.1|4579469_4579589_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_111778405.1|4579557_4579878_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_051910557.1|4580017_4580314_-	ferredoxin	NA	C7BUZ5	Synechococcus_phage	63.8	1.5e-18
WP_039273085.1|4580370_4580895_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	66.7	3.6e-68
WP_039273083.1|4580894_4582322_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	73.2	1.1e-202
WP_039273081.1|4582311_4582509_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	58.5	1.9e-09
WP_039273074.1|4582505_4582973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039273072.1|4583235_4583547_-	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	45.5	8.3e-20
WP_010281034.1|4583539_4583869_-	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	45.8	1.5e-19
WP_161547086.1|4583858_4584533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039480151.1|4584522_4585134_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	55.0	5.7e-57
WP_039273066.1|4585135_4585465_-	membrane protein	NA	A4JWP3	Burkholderia_virus	57.4	1.5e-24
WP_039273064.1|4585734_4587072_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_039273062.1|4587074_4588403_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_039513774.1|4588430_4590158_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	33.6	8.7e-26
WP_039513773.1|4590175_4590487_-|protease	AprI/Inh family metalloprotease inhibitor	protease	NA	NA	NA	NA
WP_039480148.1|4592522_4594622_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.7	2.5e-43
WP_039480146.1|4594771_4595617_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_039480144.1|4595669_4596317_+	LysE family translocator	NA	NA	NA	NA	NA
WP_039513768.1|4600032_4600719_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_039480136.1|4600794_4601742_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_039480134.1|4601891_4602401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039480132.1|4602463_4602820_-	FMN-binding protein	NA	NA	NA	NA	NA
WP_039480126.1|4603821_4604370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039480124.1|4604386_4605334_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_039480123.1|4605326_4606739_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_161547087.1|4606885_4610677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111778401.1|4610990_4611923_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_161547193.1|4612283_4612955_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_039513764.1|4613000_4614596_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039480118.1|4614769_4615999_+	peptidase T	NA	NA	NA	NA	NA
WP_039480116.1|4616160_4617066_-	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_039480114.1|4617075_4617996_-	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_039481520.1|4618104_4619640_-	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_039480113.1|4619674_4621576_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.7	2.7e-12
WP_039480111.1|4622177_4623413_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_039480109.1|4623415_4624174_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_039480107.1|4624274_4624874_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_039480106.1|4625068_4625983_-	lipid kinase	NA	A0A1V0SBJ0	Catovirus	27.7	3.9e-17
WP_161547195.1|4626266_4627742_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.2	6.9e-24
WP_039480104.1|4627823_4627991_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_039480102.1|4628517_4628916_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_039480098.1|4630195_4630993_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_039513760.1|4631340_4632612_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	39.4	5.0e-71
4635891:4635905	attR	TCAGGAAGCGCTACG	NA	NA	NA	NA
>prophage 12
NZ_CP046377	Pectobacterium polaris strain PZ1 chromosome, complete genome	4994870	4691710	4774751	4994870	terminase,plate,capsid,integrase,tail,portal,holin,lysis,head,transposase	Salmonella_phage(55.26%)	79	4743057:4743116	4775132:4775280
WP_161547093.1|4691710_4692884_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	72.2	1.7e-134
WP_161547094.1|4692859_4693438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052012131.1|4693430_4694060_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_039488037.1|4694126_4694603_-	phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_039488039.1|4695033_4695423_+	glyoxalase	NA	NA	NA	NA	NA
WP_161547095.1|4696191_4697232_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_039512556.1|4697688_4698738_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.3	3.8e-77
WP_039512554.1|4698861_4699479_-	LysE family translocator	NA	NA	NA	NA	NA
WP_161547096.1|4699728_4700613_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161547097.1|4700631_4701798_+	MFS transporter	NA	NA	NA	NA	NA
WP_039484477.1|4702078_4702759_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_039484519.1|4702751_4703513_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_039484475.1|4703493_4704651_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_039484473.1|4704690_4705728_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_039484470.1|4705823_4707128_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	32.3	3.8e-18
WP_014914903.1|4707314_4707722_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_039484467.1|4707721_4708417_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_039512547.1|4708590_4709481_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_039484460.1|4709686_4711384_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_039484458.1|4713064_4714498_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.8	2.0e-52
WP_039512543.1|4714785_4715595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039512578.1|4715584_4716436_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.6	4.1e-13
WP_039484452.1|4717473_4718463_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_039484449.1|4718459_4719479_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_161547098.1|4719468_4721592_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_156890153.1|4721617_4721827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039512536.1|4722126_4723155_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_039484445.1|4723147_4724890_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.1	4.8e-16
WP_161547099.1|4724882_4726058_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_039484438.1|4727261_4727969_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_161547100.1|4728080_4728782_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_039512529.1|4728778_4729273_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_039512527.1|4729291_4729810_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_039484424.1|4731458_4732391_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	28.7	2.3e-25
WP_039484421.1|4732366_4732798_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_039484419.1|4732826_4734839_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_161547101.1|4738543_4739743_+	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	33.2	7.1e-19
WP_039484410.1|4739779_4742929_+	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
4743057:4743116	attL	TGCTGCCACTTGCCTTTTTTCAGGCACAAAAAAACCACCTTTCGGTGGTTGAATTTTATT	NA	NA	NA	NA
WP_161547102.1|4743332_4744340_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	57.3	3.5e-104
WP_125233395.1|4744344_4744752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161547103.1|4744886_4745534_-	type VI secretion protein	NA	A0A141GF23	Brucella_phage	31.4	8.3e-14
WP_161547104.1|4745582_4746185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103184797.1|4746207_4746639_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	37.8	7.7e-08
WP_161547105.1|4746878_4747058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044205742.1|4747201_4747393_+	hypothetical protein	NA	A4JWR7	Burkholderia_virus	46.3	3.5e-05
WP_015840831.1|4747404_4747617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161547106.1|4747619_4747871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161547107.1|4747874_4748105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161547108.1|4748101_4748299_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_161547109.1|4748304_4748667_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	50.8	2.5e-20
WP_161547110.1|4748737_4748971_+	DUF2732 domain-containing protein	NA	F1BUS3	Erwinia_phage	48.0	6.4e-09
WP_161547111.1|4748967_4749810_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	61.8	5.4e-90
WP_043881945.1|4749916_4750096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161547112.1|4750095_4752600_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	37.2	1.0e-128
WP_161547113.1|4752938_4753247_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_161547114.1|4753227_4753767_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015840841.1|4754179_4755247_-|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	71.8	1.7e-152
WP_103164692.1|4755249_4756962_-	oxidoreductase	NA	A0A0M4S6K7	Salmonella_phage	68.1	3.8e-231
WP_161547115.1|4757108_4757954_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	55.7	1.0e-80
WP_103184781.1|4757988_4759038_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	69.5	8.7e-138
WP_161547116.1|4759089_4759911_+|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	63.7	1.8e-69
WP_161547117.1|4760007_4760514_+|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	63.7	2.1e-52
WP_103184778.1|4760513_4760717_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	65.7	2.0e-19
WP_103184777.1|4760753_4761071_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	62.1	1.7e-33
WP_044205690.1|4761073_4761457_+	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	68.9	1.6e-44
WP_080738441.1|4761727_4762018_+	hypothetical protein	NA	Q8SBD8	Shigella_phage	51.2	8.0e-09
WP_103184776.1|4761983_4762472_+|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	65.1	2.1e-49
WP_103184775.1|4762474_4763113_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	51.7	1.4e-53
WP_103184774.1|4763203_4763788_+|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	50.5	5.1e-47
WP_103184773.1|4763784_4764141_+|plate	baseplate assembly protein	plate	A0A0M4S6L5	Salmonella_phage	62.7	2.0e-33
WP_103184772.1|4764140_4765052_+|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	65.0	5.3e-99
WP_103184771.1|4765044_4765653_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	64.8	9.7e-73
WP_161547118.1|4767733_4768156_-|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	70.7	1.8e-49
WP_161547119.1|4768166_4771268_-|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	55.2	4.1e-111
WP_015840862.1|4771264_4771381_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_161547120.1|4771413_4771725_-|tail	phage tail assembly protein	tail	A0A0M4RCV2	Salmonella_phage	61.4	3.8e-25
WP_161547121.1|4771753_4772257_-|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	86.0	2.3e-80
WP_161547122.1|4772267_4773461_-|tail	phage tail sheath protein	tail	A0A0M4S6M1	Salmonella_phage	75.1	1.8e-171
WP_161547123.1|4773617_4774751_+	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	67.4	1.4e-138
4775132:4775280	attR	TGCTGCCACTTGCCTTTTTTCAGGCACAAAAAAACCACCTTTCGGTGGTTGAATTTTATTTTATAACTTATTGTTTTTATTAAAGTTAAATCAATGGTGCCCGGGGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 13
NZ_CP046377	Pectobacterium polaris strain PZ1 chromosome, complete genome	4994870	4984755	4994686	4994870	tail	Cronobacter_phage(57.14%)	9	NA	NA
WP_039482803.1|4984755_4986420_+	asparagine synthase B	NA	H8ZJK1	Ostreococcus_tauri_virus	39.1	6.1e-85
WP_161547131.1|4987379_4987991_-	Bro-N domain-containing protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	62.1	7.8e-30
WP_161547132.1|4988158_4988455_+	Arc family DNA-binding protein	NA	I6R0M0	Salmonella_phage	49.1	6.9e-08
WP_161547133.1|4989116_4990772_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	54.3	2.1e-170
WP_161547134.1|4990768_4991317_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	58.8	5.7e-48
WP_161547135.1|4991288_4992011_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	45.0	5.7e-48
WP_109463607.1|4992828_4993134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121331515.1|4993142_4993370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161547136.1|4993393_4994686_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	38.3	1.9e-49
