The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP021873	Serratia marcescens strain ATCC 274	5148533	486941	531346	5148533	tRNA,holin,transposase,integrase	Enterobacteria_phage(20.0%)	30	499795:499815	510174:510194
WP_161544346.1|486941_487706_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_033638869.1|487721_489329_-|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0S9J5	Catovirus	30.3	1.5e-59
WP_161544347.1|489554_490058_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_161544348.1|490258_493135_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.0	3.9e-140
WP_016929275.1|493147_493597_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_004933352.1|493828_495340_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.7	4.6e-47
WP_016929274.1|495622_496717_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_004933350.1|496716_497787_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_147881878.1|497923_498640_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
499795:499815	attL	GAGTCCGGCCTTCGGCACCAT	NA	NA	NA	NA
WP_033638864.1|499978_501235_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.5	2.8e-74
WP_072009637.1|501265_503671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072009635.1|504066_504321_-	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	50.0	6.8e-12
WP_033641320.1|504317_505043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033638863.1|505584_505848_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	53.8	2.7e-16
WP_033638862.1|505844_506090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042707092.1|506095_506641_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	55.2	5.3e-22
WP_033638860.1|506637_506901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033638859.1|506897_507233_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_161544349.1|507243_509577_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	59.8	3.1e-260
WP_165440187.1|510349_511461_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	29.7	2.2e-06
510174:510194	attR	GAGTCCGGCCTTCGGCACCAT	NA	NA	NA	NA
WP_161544351.1|511936_512989_+	DNA (cytosine-5-)-methyltransferase	NA	A0A0R6PG08	Moraxella_phage	55.1	8.5e-109
WP_161544352.1|513038_516179_+	DEAD/DEAH box helicase family protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	29.6	4.8e-99
WP_115116806.1|516995_518193_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	76.4	2.2e-129
WP_161544353.1|521720_525695_+	helicase	NA	NA	NA	NA	NA
WP_161544354.1|525697_527557_+	DUF1998 domain-containing protein	NA	NA	NA	NA	NA
WP_161544355.1|527558_528320_+	phospholipase	NA	NA	NA	NA	NA
WP_161544356.1|528341_528689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161544357.1|528778_530350_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.4	4.3e-173
WP_161544358.1|530369_530717_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	70.4	4.5e-43
WP_161545161.1|530713_531346_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.4e-20
>prophage 2
NZ_AP021873	Serratia marcescens strain ATCC 274	5148533	1090362	1159647	5148533	tRNA,protease,transposase,integrase	Stx2-converting_phage(15.0%)	58	1132435:1132455	1157821:1157841
WP_004940240.1|1090362_1090842_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_147881635.1|1091070_1091877_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_161544451.1|1092010_1094722_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.1	4.9e-108
WP_016928822.1|1094928_1095657_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_060444125.1|1095675_1096734_-	prodigiosin biosynthesis protein PigM	NA	NA	NA	NA	NA
WP_161544452.1|1096730_1097378_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_004940233.1|1097361_1097676_-	RedY-like protein	NA	NA	NA	NA	NA
WP_060444127.1|1097689_1099978_-	polyketide synthase	NA	NA	NA	NA	NA
WP_161544453.1|1099974_1101495_-	AMP-binding protein	NA	A0A2K9L3I8	Tupanvirus	23.4	4.5e-26
WP_161544454.1|1101454_1103401_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	V5LQ39	Emiliania_huxleyi_virus	27.8	3.2e-29
WP_004940224.1|1103397_1103661_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_004940222.1|1103684_1104701_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_147827475.1|1104711_1107273_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	A0A1V0SKB7	Klosneuvirus	28.2	4.1e-24
WP_089184314.1|1107269_1109873_-	biosynthesis protein PigD	NA	NA	NA	NA	NA
WP_161544455.1|1110043_1112710_-	phosphoenolpyruvate synthase	NA	NA	NA	NA	NA
WP_161545166.1|1112706_1114719_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_161545167.1|1114718_1115876_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_015376888.1|1116282_1116684_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_016928811.1|1116680_1117142_-	NfeD family protein	NA	NA	NA	NA	NA
WP_004940203.1|1117144_1118050_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_161544456.1|1118375_1119527_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	43.3	2.6e-79
WP_025160052.1|1119641_1120496_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_016928808.1|1120573_1121350_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_161545168.1|1121376_1122015_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_004940192.1|1121985_1122672_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	1.8e-30
WP_089184318.1|1122668_1125101_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016928804.1|1125229_1125529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033641106.1|1125606_1126674_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016928802.1|1126670_1127195_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_016928801.1|1127344_1128067_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_016928800.1|1128077_1128572_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_016928799.1|1128881_1130267_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	34.7	2.9e-40
WP_015376914.1|1130327_1130540_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_016928798.1|1130550_1131417_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.7	1.2e-31
WP_080441325.1|1131649_1131832_+	hypothetical protein	NA	NA	NA	NA	NA
1132435:1132455	attL	TGGGGGCATTATTGGGGGCAT	NA	NA	NA	NA
WP_161544457.1|1132485_1133694_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	54.1	1.7e-124
WP_161544458.1|1133825_1134623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161544459.1|1134813_1135011_+	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	47.3	6.0e-08
WP_161544460.1|1135107_1135917_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	55.2	3.0e-29
WP_165440189.1|1135909_1136662_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_161544462.1|1136654_1136834_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_161544463.1|1136826_1137051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161544464.1|1137047_1137644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161544465.1|1137627_1137984_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	50.0	1.2e-22
WP_115116806.1|1139304_1140502_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	76.4	2.2e-129
WP_161544466.1|1142480_1143701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165440190.1|1145374_1145548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161544467.1|1145552_1148249_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	27.0	3.7e-31
WP_161544468.1|1148245_1149934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161544469.1|1149933_1152486_+	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	44.6	1.8e-205
WP_161544357.1|1152569_1154141_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.4	4.3e-173
WP_161544358.1|1154160_1154508_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	70.4	4.5e-43
WP_161545161.1|1154504_1155137_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.4e-20
WP_161544470.1|1155211_1155646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161544471.1|1155681_1156086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077791462.1|1156082_1156658_-	SocA family protein	NA	NA	NA	NA	NA
WP_161544472.1|1157057_1157297_-	AlpA family phage regulatory protein	NA	A0A193GYW1	Enterobacter_phage	50.0	8.9e-14
WP_115116806.1|1158449_1159647_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	76.4	2.2e-129
1157821:1157841	attR	TGGGGGCATTATTGGGGGCAT	NA	NA	NA	NA
>prophage 3
NZ_AP021873	Serratia marcescens strain ATCC 274	5148533	2115708	2136002	5148533	coat,protease	Moraxella_phage(100.0%)	19	NA	NA
WP_161544644.1|2115708_2117127_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_033640556.1|2117274_2117484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162835083.1|2117643_2117796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004931522.1|2118264_2118657_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_028128159.1|2118661_2119261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004931517.1|2119315_2119555_-	YebV family protein	NA	NA	NA	NA	NA
WP_048795228.1|2119690_2120623_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_161545179.1|2120643_2122986_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_033640548.1|2123131_2123896_-	molecular chaperone	NA	NA	NA	NA	NA
WP_165440192.1|2123920_2124469_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_033640544.1|2124474_2124978_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_016928005.1|2124980_2125520_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_161544646.1|2125794_2127231_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_161544647.1|2127333_2129964_-	MCE family protein	NA	NA	NA	NA	NA
WP_028128162.1|2129932_2131180_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_033640540.1|2131435_2131933_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_016928000.1|2132029_2132740_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_033640537.1|2132759_2134808_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.0	2.0e-85
WP_016927998.1|2135117_2136002_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 4
NZ_AP021873	Serratia marcescens strain ATCC 274	5148533	3176518	3221321	5148533	plate,transposase,integrase	Ralstonia_phage(20.0%)	34	3168228:3168242	3191718:3191732
3168228:3168242	attL	TGCGCGCCTTCAGCG	NA	NA	NA	NA
WP_115116831.1|3176518_3177721_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	38.0	1.6e-58
WP_115117078.1|3178213_3178927_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_115116830.1|3178935_3180240_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_115116829.1|3180236_3180989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115116828.1|3180988_3182773_-	KAP family P-loop domain protein	NA	NA	NA	NA	NA
WP_161544856.1|3184151_3184907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115117077.1|3185023_3185236_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_147282151.1|3185305_3186169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115116825.1|3186284_3188093_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_115116824.1|3188128_3189352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161544857.1|3189338_3191165_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_161544858.1|3191248_3192493_-	GIY-YIG nuclease family protein	NA	Q9MC01	Enterobacteria_phage	61.2	5.4e-70
3191718:3191732	attR	TGCGCGCCTTCAGCG	NA	NA	NA	NA
WP_115117076.1|3192589_3192982_-	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
WP_115116823.1|3193085_3193529_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_161544859.1|3193528_3194074_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_161544860.1|3194051_3195137_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_115116821.1|3195100_3196855_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_115116820.1|3196883_3198479_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_115116819.1|3198503_3201920_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_115116818.1|3201912_3203043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115116817.1|3203039_3203297_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_115116816.1|3203317_3205759_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_115116815.1|3205746_3206277_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_161544861.1|3206334_3206856_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_115116814.1|3206855_3207620_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_115116813.1|3207620_3209999_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.8	8.3e-19
WP_115116812.1|3209988_3212649_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.3	2.1e-95
WP_115116811.1|3212825_3213317_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_115116810.1|3213321_3215034_-	OmpA family protein	NA	NA	NA	NA	NA
WP_115116809.1|3215030_3215720_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_161544862.1|3215716_3217057_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_115117075.1|3217074_3218622_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_161544863.1|3218654_3219152_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_115116806.1|3220123_3221321_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	76.4	2.2e-129
>prophage 5
NZ_AP021873	Serratia marcescens strain ATCC 274	5148533	3458775	3480375	5148533	holin,tail	Klebsiella_phage(27.78%)	23	NA	NA
WP_115116729.1|3458775_3460797_-|tail	phage tail protein	tail	A0A1I9SF20	Klebsiella_phage	46.7	2.0e-29
WP_161544904.1|3460793_3461987_-|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	47.9	4.2e-104
WP_147282148.1|3462243_3463062_-	hypothetical protein	NA	A0A1P8DUT0	Escherichia_phage	41.3	4.8e-51
WP_161544905.1|3466601_3467228_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	55.7	5.7e-52
WP_145957362.1|3467284_3467644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161544906.1|3467683_3468388_-	peptidase P60	NA	K7PJV6	Enterobacteria_phage	74.6	2.2e-105
WP_033639816.1|3468397_3469150_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	64.8	4.5e-96
WP_004935824.1|3469159_3469498_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	60.0	1.1e-33
WP_161544907.1|3469497_3471789_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	43.1	2.2e-16
WP_004935830.1|3471781_3472003_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	47.9	1.7e-11
WP_115116724.1|3472020_3472386_-|tail	phage tail protein	tail	Q7Y401	Yersinia_phage	44.2	1.9e-23
WP_089184835.1|3472511_3472967_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	74.3	2.1e-56
WP_060444516.1|3473008_3473401_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	47.6	5.5e-21
WP_048796965.1|3473397_3473787_-	hypothetical protein	NA	Q7Y405	Yersinia_phage	42.9	3.7e-25
WP_016926943.1|3473842_3474283_-	lysozyme	NA	A0A0M5M782	Salmonella_phage	63.4	2.0e-43
WP_028127738.1|3474279_3474591_-|holin	holin	holin	F1C5D1	Cronobacter_phage	81.0	2.5e-40
WP_016926941.1|3475389_3475752_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	64.6	2.7e-38
WP_161544908.1|3475993_3476671_+	S26 family signal peptidase	NA	K7PK07	Enterobacteria_phage	44.6	1.6e-07
WP_004935874.1|3477073_3477403_-	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_016926939.1|3477530_3477998_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_060444513.1|3478104_3478683_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060444512.1|3478676_3479093_-	glyoxalase	NA	NA	NA	NA	NA
WP_028127739.1|3479244_3480375_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	53.9	1.4e-104
>prophage 6
NZ_AP021873	Serratia marcescens strain ATCC 274	5148533	4431281	4477370	5148533	lysis,transposase,tRNA,capsid,integrase,tail,plate,terminase,head,portal	Erwinia_phage(41.3%)	58	4437911:4437958	4473185:4473232
WP_161545059.1|4431281_4432295_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	1.4e-108
WP_001144069.1|4432620_4432836_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_049191730.1|4432972_4434721_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.6	3.3e-73
WP_004937194.1|4434878_4436720_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_080286907.1|4436775_4437228_-	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_033639354.1|4437244_4437733_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
4437911:4437958	attL	CTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAAT	NA	NA	NA	NA
WP_072055861.1|4438136_4438367_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	64.5	1.1e-21
WP_161545060.1|4438456_4439605_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	63.1	7.1e-125
WP_015379102.1|4439601_4440087_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	65.7	1.5e-47
WP_161545061.1|4440086_4442936_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	51.5	7.2e-110
WP_023456045.1|4442928_4443051_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	72.5	1.5e-09
WP_161545062.1|4443083_4443365_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	69.8	7.0e-26
WP_023447563.1|4443418_4443928_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	76.2	1.7e-70
WP_161545063.1|4443943_4445113_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	82.0	1.4e-184
WP_033632043.1|4445773_4446058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161545064.1|4446227_4446752_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	44.8	1.4e-35
WP_161545207.1|4446753_4449273_-	hypothetical protein	NA	A0A0M3ULH6	Salmonella_phage	52.0	2.5e-58
WP_015379109.1|4449279_4449813_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.6	4.3e-77
WP_033639347.1|4449805_4450714_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	68.9	5.6e-109
WP_033639346.1|4450718_4451069_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	66.4	6.4e-37
WP_023447556.1|4451065_4451206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033639345.1|4451216_4451846_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	72.8	8.2e-75
WP_128868867.1|4451919_4452366_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	57.7	7.9e-40
WP_161545065.1|4452358_4452829_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	65.4	4.0e-50
WP_161545066.1|4452924_4453353_-|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	37.3	1.9e-14
WP_161545067.1|4453349_4453862_-	glycoside hydrolase family protein	NA	A0A218M4K3	Erwinia_phage	66.5	2.5e-58
WP_161545068.1|4453845_4454055_-	hypothetical protein	NA	F1BUQ4	Erwinia_phage	51.7	1.4e-10
WP_015379118.1|4454057_4454261_-	phage Tail protein X	NA	A0A0F7LCN2	Escherichia_phage	68.7	2.4e-20
WP_033639340.1|4454260_4454749_-|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	54.3	1.1e-39
WP_033649039.1|4454842_4455502_-|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	69.4	5.2e-80
WP_033644564.1|4455504_4456689_-|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	78.6	2.7e-159
WP_161545069.1|4456731_4457547_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	53.1	4.6e-70
WP_161545070.1|4457689_4459462_+|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	82.4	6.7e-292
WP_161545071.1|4459461_4460148_+|terminase	terminase-like family protein	terminase	A0A0F7LCM8	Escherichia_phage	30.5	1.5e-18
WP_033632040.1|4460144_4461179_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	80.5	1.3e-162
WP_033633573.1|4461223_4461565_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_071605322.1|4461564_4461819_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	47.6	5.9e-16
WP_142076094.1|4462279_4462543_-	hypothetical protein	NA	A0A1L2CUJ8	Pectobacterium_phage	71.2	1.5e-25
WP_142076096.1|4462690_4463017_+	killer suppression protein HigA	NA	NA	NA	NA	NA
WP_142076098.1|4463013_4464096_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A075BTZ7	Microcystis_phage	34.2	9.6e-07
WP_142076100.1|4464099_4465044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161545072.1|4465040_4466021_-	thymidylate synthase	NA	A0A218MKK4	uncultured_virus	30.0	3.1e-20
WP_142076104.1|4466293_4466518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161545073.1|4466556_4468773_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	58.0	3.7e-239
WP_161545074.1|4468769_4469051_-	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	51.2	4.5e-17
WP_161545075.1|4469173_4469398_-	TraR/DksA family transcriptional regulator	NA	A0A218M4I6	Erwinia_phage	56.9	1.8e-13
WP_161545076.1|4469397_4469709_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_060437235.1|4469708_4470002_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	54.4	4.9e-06
WP_161545077.1|4470066_4470369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322123.1|4470380_4470560_-	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	51.0	1.1e-05
WP_161545078.1|4470570_4471080_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	54.2	3.2e-45
WP_161545079.1|4471110_4471332_-	regulator	NA	NA	NA	NA	NA
WP_161545080.1|4471467_4472046_+	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	38.1	3.9e-31
WP_161545081.1|4472049_4473135_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	59.5	1.1e-114
WP_115116806.1|4473640_4474838_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	76.4	2.2e-129
4473185:4473232	attR	CTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAAT	NA	NA	NA	NA
WP_161545082.1|4474835_4476374_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.4	6.1e-164
WP_161544358.1|4476393_4476741_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	70.4	4.5e-43
WP_161545161.1|4476737_4477370_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.4e-20
