The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028235	Lactobacillus plantarum strain SRCM101511 chromosome, complete genome	3074489	636875	695969	3074489	tRNA,bacteriocin,protease	uncultured_Mediterranean_phage(22.22%)	53	NA	NA
WP_003646511.1|636875_638147_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.7	4.5e-96
WP_003642042.1|638613_640227_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	1.2e-143
WP_003642041.1|640399_641008_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003642040.1|641052_641493_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_024971479.1|641855_642788_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_003642038.1|642802_644155_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.9	5.2e-26
WP_003642037.1|644174_644984_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_024971609.1|645152_646139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642034.1|646221_647244_-	YdcF family protein	NA	NA	NA	NA	NA
WP_003643830.1|647532_648513_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
WP_003642032.1|648878_649703_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003642031.1|649938_651321_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	33.2	5.7e-28
WP_003642030.1|651389_652226_-	pur operon repressor	NA	NA	NA	NA	NA
WP_003642029.1|652718_652982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642028.1|652996_653539_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_003646500.1|654617_655415_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003642023.1|655407_656106_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
WP_003642022.1|656374_657319_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003642021.1|657628_658495_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003642020.1|658627_658879_-	Veg protein	NA	NA	NA	NA	NA
WP_003642019.1|658983_659874_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_011101014.1|659870_660434_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_003642017.1|660420_661197_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_161573812.1|661319_662504_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_003643823.1|662736_664788_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
WP_003642014.1|665109_665538_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_161573813.1|666095_666938_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003642011.1|666937_667642_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_003642010.1|667663_668623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642009.1|668615_669890_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642008.1|669935_670853_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_003643820.1|671021_671816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024971613.1|671820_672954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643818.1|673407_674421_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_003642003.1|675429_676326_-	ROK family protein	NA	NA	NA	NA	NA
WP_161573814.1|676446_677883_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	5.7e-31
WP_003643816.1|677900_679256_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642000.1|679478_679901_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003641999.1|679890_680079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641998.1|680085_681447_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641997.1|681519_682230_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003643815.1|682637_683654_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003643814.1|684092_684869_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_003641994.1|685127_687437_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003641993.1|687531_687735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641992.1|687872_688559_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641991.1|688652_689333_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641990.1|689419_690088_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641987.1|690934_692311_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_041153507.1|692326_694477_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	6.1e-45
WP_003641985.1|694743_694914_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_003643811.1|694938_695097_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_003646470.1|695195_695969_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP028235	Lactobacillus plantarum strain SRCM101511 chromosome, complete genome	3074489	699398	744732	3074489	protease,bacteriocin	Paramecium_bursaria_Chlorella_virus(50.0%)	43	NA	NA
WP_003641979.1|699398_699545_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003641977.1|700422_701169_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641976.1|701199_702399_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003641975.1|702516_702684_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003641974.1|702811_703012_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003641973.1|703873_704041_+|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnJ	bacteriocin	NA	NA	NA	NA
WP_003641972.1|704071_704245_+|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnK	bacteriocin	NA	NA	NA	NA
WP_003641971.1|704241_704910_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_161573815.1|705321_705525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011100995.1|705909_707094_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_024971607.1|707138_708515_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_003641966.1|709040_709856_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003641965.1|710015_710888_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011100993.1|710958_711750_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003641963.1|711753_712908_+	MFS transporter	NA	NA	NA	NA	NA
WP_003641962.1|712911_713529_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003641960.1|713910_714186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641956.1|715456_715864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114071742.1|715940_716087_-	glycohydrolase toxin TNT-related protein	NA	NA	NA	NA	NA
WP_003641952.1|716930_717317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641950.1|717606_717885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641949.1|717996_718260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024971428.1|718303_719221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033607791.1|719217_719493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641946.1|720982_724666_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_021731937.1|725252_725972_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	3.2e-30
WP_003641944.1|725989_727819_-	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_003643773.1|727833_729351_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_024971425.1|729816_731148_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003641941.1|731225_732197_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_003641940.1|732197_733724_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003641939.1|733961_734408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024971424.1|735297_736209_-	oxidoreductase	NA	NA	NA	NA	NA
WP_025015650.1|736345_737266_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_003641936.1|737431_738004_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003641935.1|738107_738563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641934.1|738581_739052_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641933.1|739161_740358_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|740388_740898_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_003643763.1|741010_741379_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003641930.1|741643_743149_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003641929.1|743306_743975_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_003643762.1|744168_744732_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP028235	Lactobacillus plantarum strain SRCM101511 chromosome, complete genome	3074489	1868390	1876904	3074489		Synechococcus_phage(33.33%)	9	NA	NA
WP_003642585.1|1868390_1868876_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
WP_003642586.1|1868859_1869990_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003642587.1|1869992_1870724_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_003642588.1|1870725_1870980_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_016511634.1|1870982_1871660_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642590.1|1871652_1873872_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.3	7.7e-144
WP_003642591.1|1873856_1875311_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_003642592.1|1875307_1876333_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.7	8.4e-61
WP_003642593.1|1876325_1876904_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.0	1.9e-22
>prophage 4
NZ_CP028235	Lactobacillus plantarum strain SRCM101511 chromosome, complete genome	3074489	2065189	2083481	3074489	portal,head,transposase,terminase,capsid,integrase	Lactobacillus_phage(33.33%)	20	2071214:2071235	2085165:2085186
WP_161573862.1|2065189_2066842_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.3	1.8e-92
WP_003642770.1|2067826_2069803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642771.1|2069857_2070343_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003642772.1|2070391_2070664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642773.1|2070688_2070922_-	hypothetical protein	NA	NA	NA	NA	NA
2071214:2071235	attL	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
WP_024971518.1|2071410_2072568_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	34.3	6.6e-54
WP_024971519.1|2072642_2073323_-	helix-turn-helix transcriptional regulator	NA	L0P7E1	Lactobacillus_phage	56.7	1.9e-13
WP_033620097.1|2073474_2073651_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024971520.1|2073930_2074149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024971521.1|2074145_2074946_+	DNA replication protein	NA	NA	NA	NA	NA
WP_024971522.1|2074945_2076340_+	virulence protein	NA	Q4ZD27	Staphylococcus_phage	36.3	1.1e-71
WP_024971523.1|2076483_2076903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024971524.1|2076927_2077110_+	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_024971525.1|2077119_2077458_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	35.6	5.5e-09
WP_024971526.1|2077450_2077840_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	44.3	3.0e-19
WP_024971527.1|2078514_2078988_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_161573863.1|2078984_2080688_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.5	5.4e-121
WP_021356362.1|2080641_2080842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024971528.1|2080842_2081943_+|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	33.4	7.2e-50
WP_024971529.1|2081939_2083481_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.4	1.1e-43
2085165:2085186	attR	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
>prophage 5
NZ_CP028235	Lactobacillus plantarum strain SRCM101511 chromosome, complete genome	3074489	2929792	2940432	3074489	transposase	Lactobacillus_phage(90.0%)	10	NA	NA
WP_054605159.1|2929792_2931487_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.3	1.8e-92
WP_003643091.1|2931423_2931654_-	cell surface protein	NA	A0A2P0ZL95	Lactobacillus_phage	100.0	1.4e-37
WP_003643092.1|2931628_2932096_-	hypothetical protein	NA	A0A2P0ZL91	Lactobacillus_phage	100.0	2.7e-83
WP_003643094.1|2932440_2932881_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	99.3	8.0e-77
WP_003643095.1|2932951_2933512_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
WP_003643096.1|2933599_2936038_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	100.0	0.0e+00
WP_003643097.1|2936040_2936655_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_003643099.1|2936998_2937946_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_024971568.1|2938131_2939103_+	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	99.1	8.2e-183
WP_003644269.1|2939193_2940432_-	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	99.7	5.7e-221
>prophage 1
NZ_CP028236	Lactobacillus plantarum strain SRCM101511 plasmid unnamed1, complete sequence	55543	0	4340	55543		Escherichia_phage(50.0%)	4	NA	NA
WP_020923829.1|1226_1781_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	45.1	8.9e-33
WP_057704847.1|2681_2924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003554871.1|3172_3481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016526732.1|3473_4340_-	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	44.4	3.4e-55
>prophage 2
NZ_CP028236	Lactobacillus plantarum strain SRCM101511 plasmid unnamed1, complete sequence	55543	10961	17504	55543	transposase	Vibrio_phage(25.0%)	6	NA	NA
WP_057704842.1|10961_11834_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	34.8	5.4e-16
WP_161573902.1|11947_12799_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_057704848.1|12973_14305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076636276.1|14545_15448_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	41.0	2.2e-52
WP_076636277.1|15534_16167_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	33.2	1.1e-13
WP_161573835.1|16583_17504_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.2	1.3e-49
>prophage 3
NZ_CP028236	Lactobacillus plantarum strain SRCM101511 plasmid unnamed1, complete sequence	55543	25983	29628	55543	transposase	Clostridioides_phage(33.33%)	3	NA	NA
WP_022638723.1|25983_26700_-	response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	23.5	1.0e-09
WP_161573897.1|26729_28448_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.1	1.8e-47
WP_057704855.1|28716_29628_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.1	1.1e-24
>prophage 4
NZ_CP028236	Lactobacillus plantarum strain SRCM101511 plasmid unnamed1, complete sequence	55543	34939	41997	55543	transposase	Mycobacterium_phage(33.33%)	6	NA	NA
WP_057704823.1|34939_36784_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	29.0	2.7e-33
WP_057704822.1|36948_37524_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161573898.1|38033_39749_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	40.8	3.4e-91
WP_041153624.1|39851_40091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161573899.1|40161_40839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057704803.1|41190_41997_+	ParA family protein	NA	A0A1V0DZZ0	Clostridioides_phage	30.1	5.1e-21
>prophage 5
NZ_CP028236	Lactobacillus plantarum strain SRCM101511 plasmid unnamed1, complete sequence	55543	49872	53427	55543	holin	Streptococcus_phage(50.0%)	4	NA	NA
WP_161573901.1|49872_51147_-	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	39.3	7.2e-78
WP_057138770.1|51405_51510_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_057704828.1|51793_52717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020923832.1|52830_53427_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	34.0	3.5e-19
>prophage 1
NZ_CP028240	Lactobacillus plantarum strain SRCM101511 plasmid unnamed5, complete sequence	20282	0	12468	20282	integrase	Streptomyces_phage(25.0%)	16	2806:2821	18489:18504
WP_063487539.1|31_391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821993.1|1709_2639_+	replication initiation protein	NA	NA	NA	NA	NA
WP_001748066.1|2631_3150_+	HTH domain-containing protein	NA	NA	NA	NA	NA
2806:2821	attL	GATTCGTCAACAAGAT	NA	NA	NA	NA
WP_003587210.1|3494_3962_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_027822193.1|4530_5175_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_008855846.1|5300_5582_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_015474701.1|5595_5910_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.0	2.0e-13
WP_006844823.1|5930_6254_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_080280589.1|6253_6388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006844822.1|6472_7417_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	47.9	7.7e-77
WP_006844821.1|7435_8083_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_050340448.1|8244_9576_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.7	3.2e-20
WP_161573946.1|9700_10912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161573947.1|11074_11377_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_161573948.1|11366_11645_-	RelB	NA	NA	NA	NA	NA
WP_161573949.1|11880_12468_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	32.6	1.3e-21
18489:18504	attR	GATTCGTCAACAAGAT	NA	NA	NA	NA
>prophage 2
NZ_CP028240	Lactobacillus plantarum strain SRCM101511 plasmid unnamed5, complete sequence	20282	16941	18750	20282	transposase	Enterococcus_phage(50.0%)	2	NA	NA
WP_161573950.1|16941_18048_-	SH3 domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	47.6	1.5e-34
WP_080241820.1|18468_18750_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.3	3.6e-06
