The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	3375	56485	3218154	transposase,tRNA	Escherichia_phage(28.57%)	55	NA	NA
WP_017378478.1|3375_4755_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_017378479.1|4869_6762_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_017378480.1|6809_7436_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_017378481.1|7455_8340_+	ParA family protein	NA	Q8JL10	Natrialba_phage	28.4	5.8e-18
WP_027242747.1|8372_9263_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.8	6.7e-14
WP_017378483.1|9377_9776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378484.1|9780_10596_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_016209328.1|10647_11052_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_017378485.1|11106_11577_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_017378486.1|11588_12116_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_017378487.1|12132_13674_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_027242748.1|13699_14560_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_016209339.1|14590_15982_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_017378489.1|16006_16435_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_027242749.1|16528_17893_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	40.9	3.9e-37
WP_027242750.1|17949_19785_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.7	5.8e-121
WP_036773290.1|19898_20627_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	2.3e-44
WP_027242751.1|21153_22695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378498.1|22961_23618_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_048876081.1|24315_24975_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_017376300.1|25119_25377_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275376.1|25489_26242_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_017376303.1|26300_27014_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	2.2e-28
WP_027242752.1|27205_27838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999959.1|28898_29138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|29572_30976_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046628.1|30972_31197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|31276_32251_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_036815787.1|32270_32588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162039024.1|32658_32877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063559.1|33123_33543_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_036816796.1|33640_34087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242563.1|34431_35430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929590.1|35462_35816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929591.1|35860_36133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376728.1|36528_37947_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376729.1|38173_39115_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_026063560.1|39149_41129_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_027242562.1|41125_41731_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211294.1|41732_42074_+	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_027242561.1|42074_42911_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_080963573.1|43076_43394_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027242560.1|43471_44893_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376735.1|44889_45585_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_047927112.1|45748_46075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420744.1|46771_47617_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_017376738.1|47626_47965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876080.1|48533_49937_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876181.1|50050_50914_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046627.1|51118_51292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876079.1|51899_52949_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275379.1|53103_53322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|53641_55045_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|55055_55613_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772663.1|55609_56485_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	185868	322729	3218154	transposase,protease,tail,tRNA	Acinetobacter_phage(11.76%)	120	NA	NA
WP_048876075.1|185868_187005_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|187044_187272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053063431.1|187268_187934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619448.1|188164_188365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377599.1|188458_189553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377600.1|189618_190200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377602.1|190937_191195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377603.1|191172_191799_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_017377604.1|191876_193859_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	41.1	1.0e-115
WP_017377605.1|194068_195412_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_017377606.1|195678_198348_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_017377607.1|198371_200288_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_017377609.1|202022_202997_+	phospholipase A	NA	NA	NA	NA	NA
WP_027242692.1|203006_203306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377612.1|203423_203645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377613.1|203808_205470_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.5	7.7e-181
WP_016209850.1|205542_205833_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_017377614.1|206059_206515_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_017377615.1|206579_207044_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_027242691.1|207135_208482_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_017377618.1|208481_209387_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_017377619.1|209448_210435_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|210427_210670_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377620.1|210788_212333_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	1.6e-63
WP_017377621.1|212379_213666_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_017377622.1|213708_215112_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_144420750.1|215116_217654_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_144420593.1|218050_218299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963589.1|218230_218692_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017377624.1|219186_219882_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080963590.1|219983_221546_-	APC family permease	NA	NA	NA	NA	NA
WP_017377626.1|221873_223667_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.0	2.2e-117
WP_017377627.1|223753_224026_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_017377628.1|224031_224658_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_017377629.1|224644_226075_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_017377630.1|226396_227452_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.7	5.1e-29
WP_017377631.1|227420_228098_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377632.1|228087_228936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210080.1|229081_229375_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_036772063.1|229486_230299_-	trfA family protein	NA	NA	NA	NA	NA
WP_017377635.1|230597_231452_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_017377636.1|231605_232655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377637.1|232700_233357_-	DedA family protein	NA	NA	NA	NA	NA
WP_017377638.1|233374_234655_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_017377639.1|234928_236290_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_036772069.1|236350_236902_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_162034387.1|241214_241373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376225.1|242332_243604_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_017376226.1|243660_244644_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_027243088.1|244640_245426_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_017376227.1|245732_246182_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|246275_247679_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376228.1|248116_249598_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_017376229.1|249653_250763_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376234.1|252335_252548_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243087.1|252588_253284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155062829.1|253547_255806_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_017376236.1|256008_256575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243085.1|256732_257293_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_053856766.1|257412_258816_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875886.1|258812_259169_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376838.1|259424_260249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243084.1|260946_261471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|261756_262731_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243083.1|262830_263382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275261.1|263494_264007_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_144420594.1|264399_265857_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420595.1|265970_266450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|266687_267293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376843.1|267572_268688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|268626_269313_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_027243079.1|269306_270284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|270318_271482_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243078.1|271821_272046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|272428_272716_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_017376847.1|272890_273646_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|273678_274110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376849.1|274085_274562_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376850.1|274568_276146_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376851.1|276148_276913_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376852.1|276966_277503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|277499_278231_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_027243077.1|278455_279217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|279542_280418_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378284.1|281820_281976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|282169_283879_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375924.1|284532_284841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420596.1|284858_287051_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_069971668.1|287858_288107_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_017375921.1|288219_288453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375920.1|288687_289218_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375919.1|289222_289936_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_144420751.1|290563_291289_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_048875888.1|291297_293361_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_027243033.1|293540_294020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312049.1|294512_295880_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376531.1|296271_297069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243034.1|297180_298470_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_144420597.1|298650_299637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376534.1|299753_299933_+	rubredoxin	NA	NA	NA	NA	NA
WP_017376535.1|299944_300376_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_017376536.1|300588_300948_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	4.4e-25
WP_017376537.1|301117_302743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|303465_304893_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376538.1|305186_306368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243035.1|308970_310269_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420752.1|310624_311518_+	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_047927468.1|311514_311820_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_017376543.1|311845_312625_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_144420598.1|312654_312885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069734.1|313060_313282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376547.1|313468_314260_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_017376548.1|314959_315682_+	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376549.1|315678_316560_+	ROK family protein	NA	NA	NA	NA	NA
WP_027243038.1|316583_318074_+	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_027243039.1|318163_319051_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_017376551.1|319723_320215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|320219_320447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|320539_321514_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971669.1|321490_322729_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	330695	384107	3218154	transposase	Staphylococcus_phage(57.14%)	50	NA	NA
WP_053856767.1|330695_332099_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|332204_332390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|333088_334492_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_053063427.1|334582_334777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162039072.1|334831_335086_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|335125_336100_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376774.1|336096_336666_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_017376776.1|337152_337845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420601.1|338452_339445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376778.1|339434_341207_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_080963634.1|341207_341396_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036774259.1|341433_342408_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036815640.1|342466_342661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|342727_342955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|343084_343960_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046623.1|344187_344337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420602.1|344328_344595_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420603.1|344739_345639_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046619.1|345725_345983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|346595_347822_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_027243074.1|347911_348451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243073.1|348570_349209_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275265.1|349242_349731_-	VUT family protein	NA	NA	NA	NA	NA
WP_157894715.1|349977_350238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772686.1|350260_350749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038646.1|351319_352495_-	MFS transporter	NA	NA	NA	NA	NA
WP_017378171.1|352734_353025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|353063_355718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243070.1|356431_356686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063658.1|356995_357724_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_017377650.1|358494_359679_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_017377649.1|359697_360642_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027243069.1|360947_361733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377647.1|361846_362215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377646.1|362443_364021_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_144420753.1|364804_369229_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_065653746.1|369365_370889_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377643.1|371093_371321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377642.1|371465_371723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|372290_373262_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080999964.1|373186_373426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772729.1|373558_373780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|373899_374874_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771744.1|374927_375899_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|375978_376953_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_027242739.1|377313_379983_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036774478.1|380153_381035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378307.1|381045_381702_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_017378308.1|381768_382473_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_048876031.1|382703_384107_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	441094	563492	3218154	transposase,tRNA	Staphylococcus_phage(25.0%)	109	NA	NA
WP_048875895.1|441094_442258_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_144420756.1|442311_443313_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_017378362.1|443394_443964_+	elongation factor P	NA	NA	NA	NA	NA
WP_144420608.1|444177_445149_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.9	7.3e-22
WP_017378364.1|445160_446756_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_036772406.1|446776_447808_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_017378367.1|448139_449243_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_017378368.1|449354_450539_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_017378369.1|450616_452605_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_155046621.1|453055_453277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420609.1|453764_455138_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378374.1|455155_456142_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	2.2e-42
WP_080963622.1|456144_457299_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.2	2.3e-14
WP_017378376.1|457295_457991_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	32.3	8.6e-09
WP_017378377.1|458133_459624_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_017378378.1|459644_460694_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_027242727.1|460760_462155_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378381.1|463105_465037_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
WP_075273353.1|465041_465572_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378382.1|465606_465801_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|465843_466203_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378383.1|466334_467330_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_017378384.1|467342_469724_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|469729_470017_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_017378388.1|472097_472871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378389.1|472872_473814_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378390.1|473947_475525_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_017378391.1|475718_476675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378392.1|476694_476847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378393.1|477117_477324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875897.1|478128_478773_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_069971672.1|478840_480097_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|480352_480532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|480754_480982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377704.1|482257_483016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420757.1|483233_483797_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377702.1|483900_484449_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_157894716.1|484904_485042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|485043_486196_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377698.1|486541_486838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|487097_488009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619438.1|488243_488795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619481.1|489295_489892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046620.1|489945_490083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|490329_491058_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377686.1|491104_491713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210764.1|492987_493248_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377283.1|493421_494960_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_017377282.1|495138_496065_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_048875900.1|496169_497102_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377279.1|497598_500412_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_017377278.1|500404_500914_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377277.1|500917_501361_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_027243089.1|501456_502758_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377276.1|503020_503389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377275.1|503380_504103_-	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377274.1|505164_506517_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	3.2e-36
WP_017377273.1|506510_506750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|507284_508259_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017377271.1|508669_508999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377270.1|509384_509750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377269.1|509873_510734_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|510720_511500_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_016210168.1|511575_512259_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036771941.1|512419_513025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377265.1|513241_513745_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_017377264.1|513946_514201_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377263.1|514702_515170_+	DoxX family protein	NA	NA	NA	NA	NA
WP_036771922.1|515736_516927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|517761_519165_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275269.1|519471_520092_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875903.1|520271_521246_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017376501.1|521411_521678_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_144420759.1|521674_522175_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048875904.1|522295_523171_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075275277.1|524260_524500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375999.1|524830_525361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376000.1|525360_525885_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017376001.1|526047_527163_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376003.1|527399_528560_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376004.1|529011_531015_+	transketolase	NA	NA	NA	NA	NA
WP_017376005.1|531083_532091_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376006.1|532164_533349_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376007.1|533358_534813_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376008.1|534843_535881_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376009.1|536203_536494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|537848_538823_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_146619442.1|538956_539619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|540142_540394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377795.1|540598_541762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275388.1|541784_542474_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377798.1|542621_543272_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_017377799.1|543372_544032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|546092_546854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|547272_547533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|547618_548281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|548397_549525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|549900_550062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420613.1|552193_552565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155051411.1|552796_554086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275272.1|554223_554454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377811.1|554587_555472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243005.1|555500_556127_-	ribonuclease T	NA	NA	NA	NA	NA
WP_036773165.1|556157_557357_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_144420614.1|557595_558693_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_017377815.1|558846_560385_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_017375632.1|560705_561041_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377700.1|561853_562147_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_036773116.1|562517_563492_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 5
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	571701	678815	3218154	transposase,protease,tRNA	Acinetobacter_phage(16.67%)	110	NA	NA
WP_082303813.1|571701_572184_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_162038649.1|572390_573546_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_048875857.1|573803_574778_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_053856766.1|575201_576605_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420615.1|576638_577427_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_017376557.1|577557_578253_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_017376558.1|578757_579264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242585.1|579357_579915_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080999966.1|580212_581562_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046619.1|581648_581906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376564.1|581973_582684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420761.1|582828_583008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376566.1|583531_584791_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_017376567.1|584923_585397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162039073.1|585437_586787_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_026063542.1|586779_587394_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_017376570.1|587473_588190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376571.1|588364_590689_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.7	7.6e-25
WP_036771330.1|590855_591830_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376573.1|592759_594502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376574.1|594673_595765_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376575.1|595797_596436_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376576.1|596474_596747_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_144420763.1|596845_597088_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376578.1|597105_597408_-	YciI family protein	NA	NA	NA	NA	NA
WP_017376579.1|597491_598034_-	septation protein A	NA	NA	NA	NA	NA
WP_016210074.1|598194_598821_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376580.1|598826_599666_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_017376581.1|599655_600306_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_026063543.1|600309_601143_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376583.1|601232_602360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157894717.1|602626_602755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|602886_603081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376585.1|603273_603924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376586.1|604178_605270_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376587.1|605266_606631_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376588.1|606755_607952_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_144420764.1|608008_608572_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376590.1|609504_610173_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_017376591.1|610319_611621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376593.1|613111_613516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243040.1|613749_614832_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376596.1|614816_615437_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|615501_616377_+	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376598.1|616454_617030_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017377700.1|617838_618132_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_080999967.1|618248_618398_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|619726_620701_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420617.1|620799_620955_-	phosphatase	NA	NA	NA	NA	NA
WP_075275275.1|620873_621065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157894718.1|621418_621838_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.5	6.7e-33
WP_026063680.1|622092_622317_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_144420618.1|622461_623283_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_017377700.1|623240_623534_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_162038639.1|623910_624402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243138.1|625010_625298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|625790_626561_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243137.1|626630_627974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|628409_629780_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|629776_629941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|630000_630288_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017377833.1|631319_631910_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_026063682.1|632036_633422_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377835.1|633519_633717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243136.1|633809_634643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|635180_635534_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243135.1|635546_635783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243134.1|635782_635989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377840.1|636150_636870_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_017377841.1|636958_638743_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_155601396.1|639049_639205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377842.1|639131_639386_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|639531_640353_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_157894719.1|640625_640760_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|640865_642269_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377200.1|642833_643022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243131.1|643151_643418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377198.1|643803_645444_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_017377197.1|645556_646906_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	3.0e-74
WP_027243130.1|646902_647772_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	9.3e-69
WP_017377194.1|648696_650010_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_048875913.1|650006_650777_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_017375625.1|650773_651001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875914.1|651705_652866_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_069971647.1|652834_653431_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162038649.1|653470_654626_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_048875916.1|655594_655999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875923.1|656002_656998_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_157894720.1|656983_658156_-	MFS transporter	NA	NA	NA	NA	NA
WP_036774946.1|658112_658727_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_155046615.1|659423_659585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377737.1|659864_660410_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_017377736.1|660443_661109_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_027243185.1|661168_662125_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_144420767.1|662403_663081_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048875918.1|663123_663705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|663849_664521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927746.1|665123_665711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|665750_666906_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_162039027.1|667040_667274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377727.1|667702_668518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377726.1|668608_669595_+	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377725.1|669764_670286_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377724.1|670319_670571_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377723.1|670581_671859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377722.1|672550_673078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377721.1|673194_675507_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_036773913.1|675635_676451_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377718.1|676707_677172_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_162038649.1|677659_678815_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
>prophage 6
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	686170	750177	3218154	transposase,tRNA	Staphylococcus_phage(37.5%)	52	NA	NA
WP_048875919.1|686170_686488_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377706.1|686505_686718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|686742_687898_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_144420621.1|689056_689818_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275277.1|689688_689928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771325.1|692008_692983_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242902.1|693107_694544_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_017376308.1|694623_696084_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_017376309.1|696204_696492_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|696689_697733_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376311.1|697748_698648_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_017376312.1|698644_699163_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376313.1|699232_699850_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_026063524.1|699859_701347_+	ribonuclease G	NA	NA	NA	NA	NA
WP_027242903.1|701356_705037_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_017376318.1|705110_705920_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017376319.1|705919_706600_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_036773116.1|707223_708198_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|708240_709236_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|709288_710263_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376224.1|710575_711460_-	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_017376223.1|711590_712412_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|712413_713451_-	asparaginase	NA	NA	NA	NA	NA
WP_017376221.1|713454_716112_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376220.1|716189_716999_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376219.1|717405_718173_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017376218.1|718337_719216_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376217.1|719219_719957_+	UMP kinase	NA	NA	NA	NA	NA
WP_017376216.1|719960_720518_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_026063514.1|720525_721272_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_027242904.1|721279_722086_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_036771906.1|722174_723050_+	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_144420622.1|723146_724724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420623.1|724923_725121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376212.1|725168_727079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376211.1|727615_728155_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376210.1|728151_729180_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017376209.1|729169_730234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162039029.1|730221_732471_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_027242906.1|732436_733504_-	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_036771893.1|733788_736206_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_017376207.1|736286_736820_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_017376206.1|736930_737980_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|737997_738444_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376204.1|738443_739217_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_027242907.1|739235_740390_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376201.1|740603_741173_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_017376200.1|741196_744703_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.6	1.9e-192
WP_027242908.1|744780_745740_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376198.1|745714_747175_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_017376197.1|747210_748740_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_080999970.1|748773_750177_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	753987	893076	3218154	transposase,integrase	Staphylococcus_phage(15.38%)	115	870831:870890	886986:887482
WP_048876012.1|753987_755391_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|755536_756940_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|757424_758399_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420769.1|758867_759758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243146.1|760418_761255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243147.1|761543_764216_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_080963645.1|764464_765655_+	MFS transporter	NA	NA	NA	NA	NA
WP_155046613.1|765987_766182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377214.1|766118_767771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|768371_769598_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243150.1|769993_770539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377217.1|770498_770876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|770872_772276_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082300719.1|772494_772920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243151.1|772971_774459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377221.1|774768_775308_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_162038653.1|775597_776754_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.9	2.0e-50
WP_017377224.1|777070_777646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999971.1|777759_779163_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377226.1|779159_779450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377227.1|779816_780230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106211.1|780917_782705_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017377229.1|782871_783492_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_155046612.1|783838_783979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377230.1|783998_785975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377231.1|786347_787805_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.1	9.4e-98
WP_017377232.1|787873_789454_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	1.1e-16
WP_017377234.1|790094_793991_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	3.4e-118
WP_016210741.1|793997_794321_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_017377235.1|794394_794868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772195.1|794899_795895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243012.1|796146_797784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910659.1|798142_799090_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.3e-35
WP_017377238.1|799408_799753_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_144420626.1|799846_800518_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_017377240.1|800558_801386_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_036772199.1|801472_802000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243013.1|802885_803305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106212.1|803414_803996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377245.1|804350_805631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377247.1|806702_807497_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036772212.1|807734_808721_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_027243014.1|808726_810253_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_144420771.1|810348_811593_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_162039030.1|811646_813026_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.4	4.1e-34
WP_026063614.1|813143_813929_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	3.7e-32
WP_016211687.1|814271_814916_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_017377253.1|814950_816756_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|816779_817355_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036771330.1|818404_819379_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_081377824.1|820262_820601_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053093666.1|821915_822593_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_144420627.1|824091_824313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274768.1|824793_825093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|825193_825355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|825291_825792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|825887_826316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|826575_827025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619452.1|827215_827512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999973.1|827488_828454_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_017377288.1|828672_828933_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_087910637.1|829027_829762_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_155046611.1|829790_829943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|830147_831092_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377293.1|831077_831506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046610.1|831650_831977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243030.1|832289_833198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377295.1|833660_834626_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_016209646.1|834670_835246_-	VOC family protein	NA	NA	NA	NA	NA
WP_036771756.1|835276_836551_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420629.1|837199_837916_+	aldolase	NA	NA	NA	NA	NA
WP_017377300.1|837994_838732_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017377301.1|838852_840208_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_075275279.1|840387_841059_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377303.1|841174_842050_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_017377304.1|842650_843955_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|844067_844673_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377306.1|846122_848555_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	1.2e-219
WP_016209655.1|848658_848931_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075275280.1|849013_850912_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_017377308.1|850943_851828_+	hypothetical protein	NA	A0A1W6JP29	Morganella_phage	35.7	2.2e-41
WP_017377309.1|851836_852232_-	CrcB family protein	NA	NA	NA	NA	NA
WP_048875932.1|852655_854803_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	3.1e-25
WP_017377313.1|854774_856124_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377314.1|856120_858241_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_017377315.1|858237_859941_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.0	3.4e-22
WP_017377316.1|860075_861218_-	galactokinase	NA	NA	NA	NA	NA
WP_017377317.1|861274_862303_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_026063623.1|862429_863944_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_017377319.1|864050_864251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420630.1|864395_864731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275281.1|864875_865112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420772.1|865382_866261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999974.1|868114_869518_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|869522_870308_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_075275282.1|870698_871541_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
870831:870890	attL	TCTAATTACCGAAATTTTAAGATGTATTATCTTCATGTAATAAAAGGTAGCATGGTAAAA	NA	NA	NA	NA
WP_017377467.1|871537_871834_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_017377471.1|873315_873927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377472.1|873995_874802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|875105_876080_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_162039074.1|876246_878142_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.2	7.9e-81
WP_027243186.1|878648_881030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|881444_882848_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|883288_883768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420633.1|883835_885092_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772665.1|885238_885763_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376899.1|886167_886308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|886505_887210_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376902.1|888064_888376_-	hypothetical protein	NA	NA	NA	NA	NA
886986:887482	attR	TTTTACCATGCTACCTTTTATTACATGAAGATAATACATCTTAAAATTTCGGTAATTAGATTTGTGAAAATAAATCATAATTGTCATTATTTCACTTGTTGACATTTGTGAAGGCTTATTACGTTTTTTATTCGTATCTTCTAGCAAAATAGCATTCCATTGAGGTAATAACTCTTGGCAGAAATCATCTATTACACAAAAGAGAGAAATCAATGTTAAGTCCATTTTATTGCTTCTTTAGAACTAAATTTAGACTCTATTTAGCCGCAAAATCACTGGTTTTTCAAATACTTCTTATGTCGAACTCACGTTAGAATCACAAATGATTACTGATGAGGTGTTTTTATCATTTTGTCAAACAACTATCTTGACTATAACAAAAGTTATGAGTGATTTTTGTGTGGGTTATAAGGACTTTGAACATAAAGAAATTTGGCTGGAAGGCGTGAAAGATAAAATTCATCAGGGAGTAGACAAATTTTTTAATGCAGGAAATG	NA	NA	NA	NA
WP_017376903.1|888439_888619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|889181_889364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|889427_889655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063576.1|889862_890627_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_026063577.1|890853_891147_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_048875878.1|891672_893076_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	902562	1038307	3218154	transposase,tRNA,protease	Staphylococcus_phage(21.74%)	111	NA	NA
WP_048875936.1|902562_903411_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017375855.1|904005_904452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063481.1|905141_906563_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375857.1|906945_908388_+	MFS transporter	NA	NA	NA	NA	NA
WP_144420634.1|908786_910118_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771639.1|910222_911197_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377669.1|911246_911951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|912391_913204_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420636.1|913262_915773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|916118_917294_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420637.1|918641_918866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875940.1|918894_920058_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_036774146.1|922300_923446_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_027243152.1|924038_924974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875941.1|926471_926783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|926779_927862_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377679.1|928177_928384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243160.1|928481_929012_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_017377681.1|929299_930478_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.6	7.7e-50
WP_027243161.1|930626_934463_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_017377683.1|934449_935952_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_036773927.1|936503_937139_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_016211781.1|937643_938891_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_075275285.1|939113_940550_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|940725_941943_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999976.1|942404_943184_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|944190_945165_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048875941.1|946210_946522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|946518_947601_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046609.1|947911_948118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243178.1|949838_951200_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_017375734.1|951310_951682_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_017375735.1|951904_952555_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375736.1|952597_953680_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_069971648.1|954406_955381_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_017376860.1|958659_960213_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017376859.1|961001_961238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|961357_962401_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|962647_963049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774710.1|963222_964122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|964516_965728_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036771959.1|965738_965963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046608.1|966284_966449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|966541_967945_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243219.1|968111_968420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046689.1|968704_968881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155051404.1|968927_969098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875947.1|969503_970553_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875948.1|970621_971644_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_017378198.1|971689_972604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|972643_973799_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_017378197.1|973756_974626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093667.1|976063_976780_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376026.1|977223_979095_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_027243175.1|979186_980932_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376029.1|981011_981461_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_016211035.1|981513_981729_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376030.1|981975_982992_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_017376031.1|983040_983670_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376032.1|984010_985222_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_048875949.1|985254_985605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|985570_986251_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376035.1|986527_986947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157894724.1|987092_987893_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|987972_988947_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420641.1|988966_989602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275290.1|989845_990847_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376037.1|990945_992154_-	MFS transporter	NA	NA	NA	NA	NA
WP_036771498.1|992143_993874_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036771517.1|994057_995194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376041.1|995937_996216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376042.1|996167_996572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376043.1|996686_998021_-	dihydroorotase	NA	NA	NA	NA	NA
WP_017376044.1|998149_998791_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376045.1|999096_999519_+	universal stress protein	NA	NA	NA	NA	NA
WP_017376046.1|999796_1000759_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_075275404.1|1000797_1001973_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_087910638.1|1002061_1003762_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_017376050.1|1003761_1005300_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_017376051.1|1005339_1006992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|1007065_1007821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|1008007_1008883_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420642.1|1009147_1009342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|1009486_1009960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046586.1|1010229_1010403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1010607_1011921_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376055.1|1011917_1012562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|1013080_1014268_-	MFS transporter	NA	NA	NA	NA	NA
WP_162039031.1|1014400_1014616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162039032.1|1014669_1015089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376060.1|1015162_1016512_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_048876123.1|1016615_1018796_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_036772169.1|1018865_1019741_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376064.1|1019883_1020084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376065.1|1020207_1020615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420776.1|1020594_1021173_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376067.1|1021595_1022258_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|1022288_1022657_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376068.1|1022667_1023984_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420644.1|1024230_1024842_+	DedA family protein	NA	NA	NA	NA	NA
WP_017376070.1|1024944_1025097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|1025267_1025561_-	cold shock domain-containing protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_036772670.1|1025801_1026104_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_017376072.1|1026158_1028432_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_016211259.1|1028491_1028737_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_048875955.1|1029724_1030699_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_036771709.1|1030906_1031668_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_017376076.1|1031651_1032608_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_017376078.1|1035371_1036112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376079.1|1036561_1037356_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376080.1|1037518_1038307_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	1043876	1102634	3218154	transposase,tRNA	unidentified_phage(18.18%)	55	NA	NA
WP_017376088.1|1043876_1045154_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_027242842.1|1045168_1045897_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_048875956.1|1045883_1047125_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_027242841.1|1047234_1048638_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_155046606.1|1048790_1048961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|1050366_1051197_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046605.1|1051424_1051574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|1051768_1052590_+	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_017375751.1|1052586_1053480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375750.1|1053525_1054047_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375749.1|1054124_1054610_+	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_048875957.1|1054743_1055400_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375746.1|1055396_1055705_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_036771957.1|1056053_1057025_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875958.1|1058108_1058972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209435.1|1058998_1059370_-	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.1e-05
WP_017377896.1|1059469_1060426_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_027242839.1|1060907_1063580_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377894.1|1063660_1064287_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_026063687.1|1064443_1066042_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377892.1|1066131_1067553_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377891.1|1067583_1068105_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_017377890.1|1068101_1068707_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_017377889.1|1068783_1069794_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.9e-07
WP_017377888.1|1069906_1070611_+	protein TolQ	NA	NA	NA	NA	NA
WP_017377887.1|1070645_1071077_+	protein TolR	NA	NA	NA	NA	NA
WP_036771700.1|1071079_1072174_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_048875959.1|1072233_1073586_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_017377882.1|1073621_1074263_+	OmpA family protein	NA	NA	NA	NA	NA
WP_144420778.1|1074335_1075235_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_027242836.1|1075237_1075885_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	38.6	1.6e-36
WP_027242835.1|1075935_1076739_-	AAA family ATPase	NA	A0A0E3G5H5	Synechococcus_phage	43.1	6.8e-42
WP_017377879.1|1076920_1077136_+	SlyX family protein	NA	NA	NA	NA	NA
WP_017377878.1|1077139_1077373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377877.1|1077434_1079027_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_017377875.1|1079229_1080159_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.9	7.0e-14
WP_017377874.1|1080160_1080928_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927659.1|1081293_1082064_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_048875960.1|1082122_1083097_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377870.1|1083204_1083567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377869.1|1083736_1085446_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_048875961.1|1085686_1087090_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619530.1|1087141_1087399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|1088147_1089455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773793.1|1089914_1090292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|1090436_1090838_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875964.1|1091402_1092182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|1092249_1092390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|1092590_1092788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|1092925_1093525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771696.1|1093707_1095168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|1095582_1097328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|1097763_1098624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378007.1|1099141_1101085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|1101230_1102634_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	1110932	1152991	3218154	transposase,protease	Acinetobacter_phage(33.33%)	37	NA	NA
WP_027243145.1|1110932_1111988_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_017377998.1|1111998_1112529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275277.1|1114028_1114268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875965.1|1114686_1115607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|1115751_1115892_-	phosphatase	NA	NA	NA	NA	NA
WP_017375623.1|1116780_1117164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|1117173_1117533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081049196.1|1118028_1118385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999979.1|1118467_1118614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|1118852_1120109_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|1120364_1120544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420651.1|1120863_1121517_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_157894725.1|1121814_1122048_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999971.1|1122819_1124223_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377761.1|1124393_1125764_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_144420780.1|1125810_1126710_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377763.1|1126690_1129495_-	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377764.1|1129574_1130171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377765.1|1130584_1131340_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_162038649.1|1131429_1132586_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_027242898.1|1132773_1133415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377768.1|1133684_1135010_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_047927230.1|1135006_1137064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377771.1|1137041_1137614_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377773.1|1138091_1139126_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_162039033.1|1139113_1139296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377775.1|1139382_1140234_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_017377777.1|1140327_1141305_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_027242896.1|1141467_1143135_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.3	1.2e-19
WP_027242895.1|1143421_1144273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377782.1|1144681_1147150_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_017377783.1|1147163_1148138_+	homoserine kinase	NA	NA	NA	NA	NA
WP_017377784.1|1148124_1149393_+	threonine synthase	NA	NA	NA	NA	NA
WP_027242894.1|1149426_1151175_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017375591.1|1151354_1151558_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420652.1|1151776_1152454_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_017377787.1|1152763_1152991_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 11
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	1193178	1247566	3218154	transposase,tRNA	uncultured_Mediterranean_phage(28.57%)	44	NA	NA
WP_051929562.1|1193178_1193883_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036771332.1|1194133_1195108_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_017376395.1|1195995_1198722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|1199245_1200220_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376397.1|1200417_1201899_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1202358_1203021_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376398.1|1203262_1204495_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017376399.1|1204651_1207423_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376400.1|1207491_1207935_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376401.1|1208087_1209560_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
WP_017376402.1|1209671_1210733_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_075286728.1|1210758_1211763_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_017376405.1|1211765_1212806_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_026063528.1|1212990_1214106_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376407.1|1214144_1214498_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_017376408.1|1214518_1216387_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376409.1|1216408_1217353_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376410.1|1217586_1217865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1218227_1218866_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376411.1|1218840_1220265_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_017376412.1|1220465_1221143_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_027242801.1|1221263_1222538_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376414.1|1222605_1223361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376415.1|1223412_1224330_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_144420654.1|1224754_1225534_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1225586_1225874_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929627.1|1225933_1226284_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046603.1|1226477_1226630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999981.1|1226557_1227031_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_048875973.1|1227043_1227679_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773947.1|1228190_1229066_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772615.1|1229852_1230176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|1230672_1232031_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_026063530.1|1232254_1232443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376430.1|1232456_1233590_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_048875975.1|1233790_1237663_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376428.1|1237697_1238423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|1238812_1239541_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_027242772.1|1239694_1240741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|1240733_1241759_+	FUSC family protein	NA	NA	NA	NA	NA
WP_017375766.1|1241825_1243856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|1244233_1245389_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_017375561.1|1246733_1246877_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062365727.1|1246873_1247566_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	1265068	1305750	3218154	transposase,tRNA	Staphylococcus_phage(25.0%)	36	NA	NA
WP_047927692.1|1265068_1265257_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1265276_1266251_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_157894735.1|1266330_1267170_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.3e-19
WP_036815628.1|1267523_1268351_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080963648.1|1268450_1268612_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375762.1|1269262_1270603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|1270725_1271881_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_027243003.1|1272023_1273385_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_027243002.1|1273480_1274140_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144420701.1|1274980_1275337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375757.1|1275933_1277493_-	APC family permease	NA	NA	NA	NA	NA
WP_017375893.1|1280309_1281380_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017375892.1|1281437_1281644_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375891.1|1281650_1283126_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375890.1|1283261_1283825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1283994_1285398_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242999.1|1286364_1287459_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_027242998.1|1287540_1288062_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_146619421.1|1288115_1288595_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_027242996.1|1288633_1288930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242995.1|1288994_1289702_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_027242994.1|1290078_1290477_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_027242993.1|1290522_1290954_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_027242992.1|1290964_1291648_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|1291722_1293918_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_027242991.1|1294022_1294760_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_027242990.1|1294787_1295573_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_047927192.1|1295663_1296323_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_087910648.1|1296310_1297498_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_027242987.1|1297552_1298386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242986.1|1298455_1301443_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_027242985.1|1301484_1302876_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_075275338.1|1302889_1303339_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_047927184.1|1303360_1303705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1303701_1304577_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876030.1|1304646_1305750_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	1320994	1384672	3218154	transposase	Acinetobacter_phage(22.22%)	52	NA	NA
WP_036772169.1|1320994_1321870_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375562.1|1321906_1322071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1323279_1323693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774270.1|1323703_1324039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420796.1|1324183_1325302_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_157894734.1|1325555_1325798_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162038649.1|1326151_1327307_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_036773258.1|1327318_1327825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243127.1|1327902_1328520_-	VOC family protein	NA	NA	NA	NA	NA
WP_017376680.1|1328651_1329884_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_017376681.1|1329873_1330536_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_026063554.1|1330810_1332067_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_027243126.1|1332234_1332864_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376683.1|1332938_1333640_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036771330.1|1334387_1335362_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376688.1|1336570_1336924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1337137_1337332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376691.1|1338048_1338903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1338951_1339596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1339629_1340274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243125.1|1340796_1341090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376695.1|1341188_1341971_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017376696.1|1342053_1343004_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_027243124.1|1345046_1347887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376700.1|1347909_1348491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376701.1|1348610_1349339_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_036771330.1|1349484_1350459_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243123.1|1350574_1351480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376705.1|1352078_1352825_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376706.1|1353077_1353470_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376707.1|1353507_1354155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1355870_1357241_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376714.1|1357925_1358579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242970.1|1358638_1360618_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_026063557.1|1360748_1361567_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_087910646.1|1361651_1362776_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_026063558.1|1362778_1363345_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	2.8e-74
WP_017375873.1|1364536_1364698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375871.1|1366568_1367117_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_144420795.1|1367244_1367922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242968.1|1368038_1371530_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_017375867.1|1371587_1372841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375866.1|1372950_1373853_-	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	3.2e-56
WP_017375865.1|1373907_1374945_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_017375864.1|1375082_1376321_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_047927270.1|1376313_1377039_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	6.4e-31
WP_017375862.1|1377142_1378870_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016211829.1|1379170_1379524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375861.1|1380220_1380721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876023.1|1381060_1382164_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_087910645.1|1382254_1383407_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876022.1|1383820_1384672_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	1414427	1454363	3218154	transposase,plate	Staphylococcus_phage(50.0%)	34	NA	NA
WP_036772663.1|1414427_1415303_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772025.1|1416225_1416732_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027243218.1|1416749_1416947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1416965_1417109_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155046586.1|1417176_1417350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1417554_1418868_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000010.1|1418877_1419141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1419199_1420174_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_162038649.1|1421113_1422269_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_144420697.1|1422309_1422606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157894733.1|1422681_1423773_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027242924.1|1423785_1425537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420696.1|1425822_1427088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420695.1|1427232_1428666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971656.1|1428681_1428954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275333.1|1430155_1430338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275427.1|1430520_1430592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772036.1|1431847_1432354_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027242922.1|1432370_1433870_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_027242921.1|1433884_1434508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157894732.1|1434585_1435677_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_017376650.1|1435708_1438249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242919.1|1438280_1440173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275426.1|1440534_1441257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376655.1|1441259_1444139_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_027242917.1|1444139_1444544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772028.1|1444558_1446280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242914.1|1446279_1449228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376660.1|1449230_1450628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376661.1|1450641_1451382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376662.1|1451362_1451797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242913.1|1451841_1452471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376663.1|1452535_1453450_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_036772026.1|1453487_1454363_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	1460136	1586058	3218154	transposase,tRNA	Acinetobacter_phage(15.38%)	103	NA	NA
WP_027242911.1|1460136_1461153_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_027242910.1|1461587_1463042_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376672.1|1463123_1466180_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_144420694.1|1466473_1466710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081329473.1|1467570_1467990_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376676.1|1468362_1468827_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075275332.1|1468899_1469901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771585.1|1472793_1473126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420693.1|1473487_1473631_-	phosphatase	NA	NA	NA	NA	NA
WP_048876152.1|1473618_1474563_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376272.1|1474566_1474824_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_075275328.1|1474774_1475113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376273.1|1475487_1476087_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017376274.1|1476086_1476434_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_026063520.1|1476584_1477568_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017377701.1|1478477_1478711_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420691.1|1478939_1479098_-	phosphatase	NA	NA	NA	NA	NA
WP_144420690.1|1479069_1479999_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_026063521.1|1480913_1481330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1482458_1483175_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376099.1|1483923_1484082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1484130_1484706_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075275424.1|1484850_1485129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376100.1|1485193_1486069_-	ParA family protein	NA	NA	NA	NA	NA
WP_048876018.1|1486234_1490101_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376104.1|1491114_1491936_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376105.1|1492135_1493368_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376106.1|1493538_1494264_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376107.1|1494306_1495845_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376108.1|1495851_1497237_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_048876011.1|1497550_1498600_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1499159_1499537_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_075275326.1|1499752_1500604_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162038666.1|1500656_1501812_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_048876149.1|1501865_1502384_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420793.1|1503238_1504012_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_144420687.1|1506483_1506669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1506679_1507216_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876016.1|1507360_1507771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876015.1|1508041_1508446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876014.1|1508650_1508986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375878.1|1509323_1509596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243180.1|1509667_1510927_-	phosphoesterase	NA	NA	NA	NA	NA
WP_017375881.1|1511011_1512277_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_026063485.1|1512435_1512918_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_036772592.1|1512995_1514456_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	2.3e-56
WP_155046587.1|1514578_1514719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063486.1|1515132_1515633_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_162034387.1|1520076_1520235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375698.1|1521747_1522941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243221.1|1523284_1524913_+	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
WP_027243222.1|1524928_1526077_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_051929845.1|1526151_1526976_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1527379_1528354_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927610.1|1528539_1529133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1529313_1529778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910660.1|1530171_1530453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1530449_1531853_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377324.1|1532504_1532885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1533124_1533781_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_036773200.1|1533925_1534222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1534281_1534569_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_027243051.1|1534852_1535062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772296.1|1535758_1536136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1536335_1537385_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377209.1|1537361_1539179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1539449_1540028_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_065653751.1|1540055_1540520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|1540556_1542014_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_027243048.1|1542075_1543563_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377202.1|1544332_1544935_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|1545496_1545967_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_036772316.1|1547614_1548358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275422.1|1548509_1548941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|1551578_1552925_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_162039040.1|1552981_1554817_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.9e-57
WP_017378301.1|1555282_1556080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378302.1|1556464_1556926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1557148_1558123_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963614.1|1558165_1558288_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376833.1|1558359_1560315_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1560704_1560890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376832.1|1561211_1562201_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_027243043.1|1562613_1564239_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376830.1|1564347_1564662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1564957_1566343_+	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376829.1|1566507_1566735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1566875_1567334_-	amino acid permease	NA	NA	NA	NA	NA
WP_144420685.1|1567534_1567720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1567788_1568616_-	DsbA family protein	NA	NA	NA	NA	NA
WP_144420792.1|1569070_1569595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420684.1|1569777_1570026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243041.1|1570195_1571149_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_036771330.1|1571342_1572317_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876009.1|1572444_1573470_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275277.1|1573340_1573580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1574122_1574410_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929542.1|1574469_1574802_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_157894730.1|1575042_1575567_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.6	2.5e-37
WP_017376814.1|1578161_1578887_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_026063564.1|1579261_1582081_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	5.2e-312
WP_048876146.1|1582930_1584064_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_017376809.1|1584288_1586058_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
>prophage 16
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	1608418	1650711	3218154	transposase,protease,integrase	Staphylococcus_phage(30.0%)	44	1629757:1629816	1640217:1640507
WP_048876008.1|1608418_1609393_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_155046589.1|1609472_1609622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046590.1|1609801_1609966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1609967_1610843_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_162038664.1|1611133_1611352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157894729.1|1611266_1612079_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_017375696.1|1612094_1612478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1612804_1613761_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_144420678.1|1614028_1614307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243017.1|1614804_1616148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046591.1|1616321_1616465_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1616544_1617519_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_162039041.1|1617666_1619451_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_075275322.1|1619570_1619669_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378518.1|1619904_1620534_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017378517.1|1620517_1620940_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378516.1|1620946_1622686_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378515.1|1622686_1623751_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1623754_1624108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1624220_1625189_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017378513.1|1625198_1625510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1625525_1626095_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378512.1|1626358_1627687_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_053856779.1|1627747_1628701_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.5	2.1e-29
WP_144420677.1|1629287_1629689_-|transposase	transposase	transposase	NA	NA	NA	NA
1629757:1629816	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_027243019.1|1630208_1632779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|1632867_1633719_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_027243020.1|1633764_1635270_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_162039042.1|1635317_1635590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971648.1|1636941_1637916_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_047927336.1|1638278_1638524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653736.1|1638887_1639916_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017375591.1|1640046_1640250_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420676.1|1640534_1641491_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
1640217:1640507	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGGCCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTAGTGGAGTGTGCCGCTTCAAGGCACGTAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTCT	NA	NA	NA	NA
WP_047927838.1|1641783_1642029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1642025_1642325_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_036774927.1|1642547_1643018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275277.1|1643178_1643418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162038662.1|1643628_1644785_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	2.2e-49
WP_036772851.1|1645078_1645396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243023.1|1645389_1645632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243024.1|1645982_1647083_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_017377328.1|1647251_1648553_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_053856766.1|1649307_1650711_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	1660704	1692235	3218154	transposase	Staphylococcus_phage(22.22%)	31	NA	NA
WP_036771330.1|1660704_1661679_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375989.1|1662198_1662699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243163.1|1662769_1664098_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|1664233_1665622_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243165.1|1665769_1667080_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1667420_1668704_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_017375982.1|1668777_1669398_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_051929832.1|1669596_1669857_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155046592.1|1670059_1670206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774659.1|1670181_1670475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075286720.1|1670534_1670774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275277.1|1672186_1672426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|1672637_1672856_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772303.1|1674108_1674879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|1674965_1675181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376496.1|1675277_1676399_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771330.1|1676664_1677639_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771628.1|1677901_1679023_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_017376491.1|1679315_1679603_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1679575_1680079_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_053093673.1|1680159_1680819_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876005.1|1681160_1682078_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_075275317.1|1682207_1682381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1683046_1684405_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_144420789.1|1684596_1685043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376485.1|1685237_1686467_-	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_017376484.1|1686512_1687139_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_027242833.1|1687288_1688476_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_048876004.1|1688484_1689177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910642.1|1689298_1690451_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876002.1|1691251_1692235_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
>prophage 18
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	1750566	1783040	3218154	transposase,tRNA	Staphylococcus_phage(12.5%)	31	NA	NA
WP_036774017.1|1750566_1751442_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377182.1|1751831_1752170_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_026063604.1|1752166_1752763_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|1752765_1754760_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017377185.1|1754823_1755762_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_036771332.1|1756110_1757085_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_080999986.1|1757288_1757486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000007.1|1757647_1758052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816928.1|1759635_1760076_+	universal stress protein	NA	NA	NA	NA	NA
WP_048875996.1|1760402_1761278_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420669.1|1761290_1761533_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1761939_1762194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1763405_1764371_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772586.1|1764463_1764730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1764975_1765752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377572.1|1766581_1766752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377573.1|1767501_1768551_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377574.1|1768721_1769495_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377575.1|1769555_1771145_-	APC family permease	NA	NA	NA	NA	NA
WP_017377576.1|1771335_1772427_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377577.1|1772449_1772767_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377578.1|1772853_1774131_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377579.1|1774152_1774989_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377580.1|1774995_1776630_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_026063647.1|1777061_1777421_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377583.1|1777702_1779061_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_017377584.1|1779086_1779329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|1779822_1780002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1780257_1781514_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377585.1|1781627_1781885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|1782029_1783040_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
>prophage 19
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	1786565	1902060	3218154	transposase,tRNA,protease	Acinetobacter_phage(14.81%)	101	NA	NA
WP_047927606.1|1786565_1786886_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_144420665.1|1787104_1788010_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_048875992.1|1788095_1788494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1788638_1789136_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047927093.1|1790796_1791900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929549.1|1791998_1792376_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1792455_1793430_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_051929871.1|1794974_1795655_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1795777_1796065_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420664.1|1796349_1797222_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_048875990.1|1797178_1797955_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816484.1|1798159_1798495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963600.1|1798893_1799250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377440.1|1799411_1799687_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_017377441.1|1799796_1800144_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377442.1|1800161_1800941_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|1800940_1801450_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1801485_1801734_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377444.1|1802045_1802381_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017377445.1|1802680_1803931_+	MFS transporter	NA	NA	NA	NA	NA
WP_162039076.1|1804012_1806016_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377447.1|1806585_1806804_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242819.1|1806975_1807338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1807486_1808890_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242818.1|1809171_1810347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377453.1|1810364_1812362_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242817.1|1812342_1813323_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075275308.1|1813378_1814221_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_036772544.1|1814220_1814637_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275307.1|1814617_1815037_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017377459.1|1815059_1815689_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017377460.1|1816257_1818447_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_048875988.1|1819659_1821495_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_047927302.1|1821494_1822718_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242814.1|1822704_1824573_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_027242813.1|1824606_1825860_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017377465.1|1825865_1826723_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_017377694.1|1826741_1827470_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_081078114.1|1828608_1829400_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017376231.1|1829765_1830053_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_162038641.1|1831423_1831567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376477.1|1832175_1832565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376476.1|1832741_1833500_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_162039047.1|1833512_1835894_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	8.8e-69
WP_027242812.1|1835907_1837185_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376475.1|1837274_1838573_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_017376474.1|1838770_1839664_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_027242811.1|1839663_1840878_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_026063533.1|1842198_1842453_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_017376470.1|1842728_1844096_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_017376469.1|1844452_1845475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376467.1|1845994_1847470_+	APC family permease	NA	NA	NA	NA	NA
WP_036772167.1|1847689_1848637_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_017376465.1|1849178_1850741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046597.1|1851285_1851462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971651.1|1851576_1852452_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376461.1|1852824_1853088_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_017376460.1|1853394_1855989_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376459.1|1855985_1856468_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376458.1|1856445_1857486_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376457.1|1857660_1858146_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376456.1|1858253_1860824_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376455.1|1860857_1861319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773947.1|1861655_1862531_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376452.1|1862808_1864569_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_017376451.1|1864662_1865328_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376450.1|1865340_1866846_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376449.1|1866867_1867398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376448.1|1867471_1868734_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376447.1|1868920_1869793_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_026063532.1|1869894_1870683_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376445.1|1870775_1872101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376444.1|1872454_1873630_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376443.1|1873798_1874452_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376442.1|1874607_1876548_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_036773538.1|1876544_1877168_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036773116.1|1877332_1878307_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_075275305.1|1878578_1879199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1879195_1880599_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910640.1|1880666_1881083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|1881490_1881988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1881984_1882959_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046598.1|1883038_1883608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1883752_1884289_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375549.1|1884293_1884590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1884598_1885204_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017378212.1|1885389_1885788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1885978_1886182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046599.1|1886326_1886482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378213.1|1886606_1887059_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_036773427.1|1887175_1888654_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_016211840.1|1889086_1889551_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_144420785.1|1890238_1891489_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_017378219.1|1891598_1892069_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047927040.1|1892091_1892685_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_027242798.1|1892822_1893872_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_017378221.1|1893895_1894819_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1894835_1895297_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378223.1|1895404_1896223_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155046600.1|1896832_1896976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378228.1|1901139_1902060_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 20
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	1988783	2055249	3218154	transposase	Staphylococcus_phage(20.0%)	57	NA	NA
WP_017378288.1|1988783_1989005_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1989063_1990038_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046582.1|1990236_1990401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|1990397_1991033_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420659.1|1991309_1992089_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_053093670.1|1992202_1992883_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.0	1.1e-43
WP_075275303.1|1992859_1993849_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|1993984_1994860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157894727.1|1994887_1995538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148037443.1|1995564_1995774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927801.1|1995779_1996226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1996222_1997626_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378294.1|1997739_1998585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1998729_2000379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378296.1|2000469_2001255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875980.1|2002695_2004099_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927313.1|2004904_2007835_-	peptidase M16	NA	NA	NA	NA	NA
WP_027242809.1|2007978_2009937_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	2.5e-45
WP_144420783.1|2010130_2010778_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377496.1|2010833_2012159_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.3e-37
WP_017377495.1|2012193_2012445_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_162039077.1|2012419_2012584_+	phosphatase	NA	NA	NA	NA	NA
WP_017375667.1|2012732_2013218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036817939.1|2013706_2013895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777920.1|2014203_2014437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242807.1|2014878_2015367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242806.1|2015496_2016465_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_027242805.1|2017171_2020498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377489.1|2020556_2021594_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377488.1|2021798_2023712_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	1.8e-117
WP_017377487.1|2023763_2024411_-	hypothetical protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_017377486.1|2024522_2025647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377485.1|2025643_2026240_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_016209821.1|2026270_2026603_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_027242804.1|2026705_2028559_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	2.2e-43
WP_027242803.1|2029005_2030718_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	2.5e-25
WP_036772905.1|2030926_2031280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875923.1|2032836_2033832_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420656.1|2034543_2034705_+	phosphatase	NA	NA	NA	NA	NA
WP_017376418.1|2035621_2036161_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017376419.1|2036543_2036960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|2037055_2037871_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376421.1|2038003_2039497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|2039682_2040108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376423.1|2040104_2042165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376424.1|2042448_2043264_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376425.1|2043364_2044183_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_075316649.1|2044179_2044635_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_075275409.1|2044728_2045556_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|2045619_2046348_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_036771312.1|2046473_2047469_+	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_048876036.1|2047766_2048405_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_017375978.1|2049118_2050306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375977.1|2050471_2051425_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375975.1|2053553_2053877_-	YqcC family protein	NA	NA	NA	NA	NA
WP_155046584.1|2054125_2054302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093677.1|2054529_2055249_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	2079969	2141157	3218154	transposase	Acinetobacter_phage(27.27%)	49	NA	NA
WP_036771639.1|2079969_2080944_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378201.1|2083852_2084524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2085602_2087006_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242788.1|2088593_2091995_-	UvrD-helicase domain-containing protein	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_017378193.1|2091991_2094685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378192.1|2094988_2096488_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_027242789.1|2097154_2097976_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_155049741.1|2098047_2098491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2098681_2100085_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378188.1|2100081_2101152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242790.1|2101397_2103572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|2103594_2104275_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_036774233.1|2104303_2104537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038666.1|2104589_2105746_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_048876044.1|2105895_2106396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|2106885_2107059_+	phosphatase	NA	NA	NA	NA	NA
WP_144420800.1|2107356_2108058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375730.1|2108208_2109456_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_017375728.1|2110530_2111397_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|2111400_2112162_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375727.1|2112325_2113231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|2113453_2114269_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375724.1|2114454_2114844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375723.1|2115121_2115580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275340.1|2115850_2116459_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375657.1|2116602_2116785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2116989_2117865_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929548.1|2118105_2118780_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999996.1|2118808_2119297_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_080999997.1|2120342_2120777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2120982_2122386_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927811.1|2122633_2124145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876046.1|2125105_2125399_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_144420706.1|2125356_2125935_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876047.1|2126020_2126896_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378015.1|2126888_2127245_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_017378014.1|2127253_2127649_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082300708.1|2128973_2129534_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046583.1|2130656_2132558_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_027243106.1|2132580_2133786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420707.1|2133788_2135087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243104.1|2135067_2136291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243103.1|2136340_2137141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155048038.1|2137137_2137500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243102.1|2137532_2137841_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|2138234_2138963_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377851.1|2139003_2139648_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377852.1|2139660_2140128_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|2140182_2141157_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 22
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	2146869	2207259	3218154	transposase	Staphylococcus_phage(30.0%)	52	NA	NA
WP_017377694.1|2146869_2147598_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963626.1|2147648_2149283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|2149553_2150741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377863.1|2151342_2151780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|2154313_2154586_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_036772457.1|2154661_2154970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772454.1|2157445_2157763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2157919_2158894_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_162039021.1|2158890_2159247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876052.1|2159360_2160107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|2160075_2160804_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017377223.1|2161548_2161836_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2161895_2162060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876053.1|2162056_2163460_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_053093670.1|2163573_2164254_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.0	1.1e-43
WP_017376296.1|2164539_2165256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|2166033_2166939_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376294.1|2167425_2168718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619460.1|2168953_2171737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242868.1|2173342_2173810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|2173810_2174512_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420801.1|2174773_2174956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420802.1|2175692_2177684_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2177673_2178720_-	glutathione synthase	NA	NA	NA	NA	NA
WP_017376284.1|2179160_2180012_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_017376283.1|2180012_2180930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046581.1|2181325_2181499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2182101_2183073_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157894741.1|2185296_2186427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162038643.1|2186395_2186539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|2186766_2187078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420710.1|2187555_2187861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242870.1|2188182_2188713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|2189159_2190089_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_144420711.1|2190245_2190671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2190787_2191015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2191168_2192143_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999998.1|2192409_2192679_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420803.1|2192823_2193780_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377028.1|2193940_2194846_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242871.1|2195162_2195924_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211971.1|2196125_2196737_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_051929560.1|2196757_2197957_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_017377024.1|2198051_2198192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|2198204_2198609_-	SufE family protein	NA	NA	NA	NA	NA
WP_017377022.1|2198839_2199409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377021.1|2199475_2200516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|2200542_2201699_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_027242872.1|2201820_2202678_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_144420712.1|2202674_2203436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242873.1|2203520_2206250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2206383_2207259_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	2228000	2278121	3218154	transposase,protease,tRNA	Vibriophage(14.29%)	43	NA	NA
WP_017377003.1|2228000_2228624_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_017377001.1|2229330_2230029_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377000.1|2230172_2230742_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_026063589.1|2231056_2231683_-	porin family protein	NA	NA	NA	NA	NA
WP_017376998.1|2231879_2232626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376997.1|2232721_2233561_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_016210463.1|2233611_2233959_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376996.1|2234149_2235037_+	ROK family protein	NA	NA	NA	NA	NA
WP_017376995.1|2235151_2235754_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376994.1|2235750_2236470_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_080963631.1|2236538_2238251_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376991.1|2238398_2240336_+	AsmA family protein	NA	NA	NA	NA	NA
WP_027242882.1|2240448_2241498_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376990.1|2241497_2241773_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_017376989.1|2241853_2242402_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_162038666.1|2242726_2243883_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_144420713.1|2244653_2245355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774751.1|2245584_2246508_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047927028.1|2246521_2247445_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027243112.1|2247392_2248049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|2248351_2249179_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_017376518.1|2249329_2249701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927029.1|2249929_2251420_+	nuclease	NA	NA	NA	NA	NA
WP_017376516.1|2251487_2252825_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_017376515.1|2252967_2254434_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_162039053.1|2254430_2255480_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_027243115.1|2255603_2257712_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|2257874_2258279_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|2258340_2259066_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_017376511.1|2259151_2260045_+	YicC family protein	NA	NA	NA	NA	NA
WP_017376510.1|2260085_2260706_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_016210310.1|2260766_2260973_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376509.1|2260994_2263139_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_017376506.1|2265334_2266258_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376505.1|2266324_2267608_+	MFS transporter	NA	NA	NA	NA	NA
WP_036771330.1|2267848_2268823_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046579.1|2269138_2269300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2269296_2270700_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|2270813_2271581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2271939_2273343_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963604.1|2274163_2274364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377826.1|2274604_2276050_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875904.1|2277245_2278121_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	2281841	2288512	3218154		Staphylococcus_phage(50.0%)	7	NA	NA
WP_017376521.1|2281841_2282315_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376522.1|2282440_2283097_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376523.1|2283093_2283768_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376524.1|2283773_2284922_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376525.1|2284918_2285380_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376526.1|2285455_2286706_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376527.1|2286832_2288512_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
>prophage 25
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	2367090	2413797	3218154	transposase,tRNA	Synechococcus_phage(20.0%)	41	NA	NA
WP_048875859.1|2367090_2367885_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036773621.1|2368174_2369098_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_017377984.1|2369365_2369659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377983.1|2370860_2371784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377982.1|2371919_2372762_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_017377981.1|2372849_2373500_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.6	2.7e-20
WP_026063695.1|2373513_2374572_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	45.3	3.0e-69
WP_036773623.1|2374676_2375762_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_027243121.1|2375788_2376898_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377976.1|2377202_2377520_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377975.1|2377516_2377876_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377974.1|2377978_2380711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052106250.1|2382200_2382725_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_144420807.1|2383124_2383343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|2383487_2384696_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_065653755.1|2385123_2386581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|2387416_2387692_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773050.1|2390395_2390575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063690.1|2390571_2390943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|2390953_2392036_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420718.1|2392032_2392254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|2393239_2393458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|2393948_2394215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420719.1|2394473_2394794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243154.1|2396179_2397430_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377905.1|2397418_2398300_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_017377906.1|2398292_2399378_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377907.1|2399374_2400634_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377908.1|2400802_2401462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653730.1|2401632_2402295_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_026063691.1|2402641_2403589_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_017377911.1|2403685_2404312_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_017377912.1|2404317_2404899_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377913.1|2404970_2406062_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377914.1|2406151_2406865_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_027243155.1|2406958_2407783_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_144420808.1|2408016_2408694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377920.1|2410371_2410629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2411029_2412004_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048876067.1|2412178_2412823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046574.1|2413002_2413797_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	2419492	2455769	3218154	transposase,protease	Acinetobacter_phage(25.0%)	36	NA	NA
WP_087910651.1|2419492_2419669_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_053856762.1|2419964_2420399_-	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_017377929.1|2420592_2422062_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_027243054.1|2422055_2423432_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377930.1|2423444_2423837_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_017377931.1|2423833_2424937_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_144420809.1|2425115_2426408_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377933.1|2426418_2427366_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_027243055.1|2427377_2428190_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_087910662.1|2428192_2428972_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377934.1|2428986_2430045_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_017377935.1|2430041_2431052_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|2431058_2431256_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_048876070.1|2431316_2434223_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_017377937.1|2434264_2435116_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_144420810.1|2435198_2435744_-	chorismate lyase	NA	NA	NA	NA	NA
WP_027243057.1|2435841_2436702_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155048031.1|2436844_2437210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377942.1|2437291_2437798_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_162039056.1|2437843_2439043_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_162039057.1|2439009_2440215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162039058.1|2440205_2440793_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_017377945.1|2440814_2441147_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	4.7e-05
WP_047927125.1|2441264_2441774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046571.1|2442307_2442463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774650.1|2443537_2444704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377687.1|2444848_2445601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2445956_2446931_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016209908.1|2447063_2447774_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_017377690.1|2447770_2448805_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_017377691.1|2448908_2449250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876071.1|2449760_2450921_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_069971647.1|2450889_2451486_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046570.1|2452454_2452625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2452621_2453596_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_087910645.1|2454615_2455769_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
>prophage 27
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	2500913	2566522	3218154	transposase,plate,tRNA	Staphylococcus_phage(18.18%)	57	NA	NA
WP_027242858.1|2500913_2502221_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027242859.1|2502225_2502936_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242860.1|2502948_2506119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|2506184_2507321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376336.1|2508183_2509041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376335.1|2509182_2509983_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376334.1|2510081_2510657_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_027242862.1|2510739_2511411_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_027242863.1|2511456_2512356_+	DUF3530 family protein	NA	NA	NA	NA	NA
WP_017376331.1|2512390_2512774_-	response regulator	NA	NA	NA	NA	NA
WP_017376330.1|2512923_2513688_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376328.1|2514384_2515410_-	phosphotransferase	NA	NA	NA	NA	NA
WP_048876074.1|2515540_2518045_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376325.1|2518051_2519320_+	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_017376324.1|2519321_2520305_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376323.1|2520317_2521139_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376322.1|2521183_2521576_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376321.1|2521650_2522457_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_036774104.1|2522644_2523073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2523131_2524106_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375660.1|2524129_2524567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2524601_2526005_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376011.1|2526585_2526747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376015.1|2527967_2528339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242569.1|2528446_2529997_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376017.1|2530029_2530869_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017376018.1|2530865_2531381_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376019.1|2531384_2532377_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376020.1|2532755_2534126_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_027242570.1|2534334_2535474_+	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_075275355.1|2535687_2536662_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_036816881.1|2536685_2536904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376024.1|2536981_2537230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034387.1|2538088_2538247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|2542885_2543566_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376634.1|2543630_2544917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376633.1|2545518_2545788_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_144420813.1|2545971_2546943_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376631.1|2547010_2547985_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_017376630.1|2548082_2549159_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_144420721.1|2549239_2550232_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_036772145.1|2550236_2552039_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243119.1|2552056_2553358_-	aspartate kinase	NA	NA	NA	NA	NA
WP_157894744.1|2553373_2554606_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_017376625.1|2554789_2555182_+	RidA family protein	NA	NA	NA	NA	NA
WP_017376624.1|2555288_2556374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376623.1|2556589_2557606_-	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376622.1|2557608_2558616_-	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_026063550.1|2558619_2559774_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_016209558.1|2559788_2560151_-	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_027243117.1|2560147_2561863_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_026063546.1|2561962_2562637_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2562665_2563070_+	RidA family protein	NA	NA	NA	NA	NA
WP_027243116.1|2563094_2564054_-	response regulator	NA	NA	NA	NA	NA
WP_017376616.1|2564186_2564969_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275357.1|2565070_2566030_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376613.1|2566174_2566522_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	2570523	2634291	3218154	transposase	Planktothrix_phage(10.0%)	55	NA	NA
WP_144420814.1|2570523_2571441_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875883.1|2571585_2572122_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929685.1|2572381_2573284_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376607.1|2574273_2575263_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_017376606.1|2575431_2575770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|2575766_2576342_+	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376604.1|2576390_2576606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|2576792_2577632_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376601.1|2581328_2582237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375685.1|2582367_2582832_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856764.1|2583132_2584059_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772137.1|2584377_2584938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377036.1|2585407_2586727_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_017377037.1|2586794_2587661_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_036772169.1|2587653_2588529_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377039.1|2588587_2588806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377041.1|2590206_2590536_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_026063593.1|2590770_2591475_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377043.1|2591455_2593684_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_017377044.1|2593946_2594960_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377045.1|2595068_2595290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377046.1|2595294_2596932_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377047.1|2597070_2597604_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377048.1|2597724_2598843_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_036815950.1|2598835_2599054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815948.1|2599053_2600157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|2600143_2601280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|2601510_2601936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242609.1|2605265_2605619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2605653_2606529_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929903.1|2606685_2607090_-	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_051929897.1|2607237_2608413_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_027242610.1|2608672_2609176_-	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_047927710.1|2609215_2610718_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.6e-46
WP_017377060.1|2610923_2611877_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_027242611.1|2611857_2612949_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_027242612.1|2613251_2613494_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_155046568.1|2614394_2614553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|2614561_2615137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|2615253_2615436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162039022.1|2615580_2615808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377065.1|2616011_2616284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|2616436_2616691_-	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_027242613.1|2616805_2618209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|2618293_2618800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|2619362_2621183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|2621249_2621780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774569.1|2623324_2624041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774567.1|2624083_2624521_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017377073.1|2624558_2625938_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377074.1|2626332_2628327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377075.1|2628791_2629604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|2629787_2631251_-	nuclease	NA	NA	NA	NA	NA
WP_017377077.1|2631610_2632990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772726.1|2633742_2634291_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
>prophage 29
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	2666078	2691200	3218154	transposase	Staphylococcus_phage(33.33%)	23	NA	NA
WP_036773116.1|2666078_2667053_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971661.1|2667049_2667487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162039080.1|2667661_2668654_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375685.1|2668599_2669064_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377105.1|2669074_2669350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377106.1|2669627_2670098_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377107.1|2670400_2671771_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_075275363.1|2672100_2672568_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377110.1|2672580_2673591_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_053856766.1|2673792_2675196_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242632.1|2675622_2676411_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927448.1|2676397_2677426_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_017377113.1|2677403_2677808_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_017377115.1|2678035_2680003_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377116.1|2680198_2680690_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_026063598.1|2680724_2681567_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377118.1|2681612_2682065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377119.1|2682354_2682987_+	LysE family translocator	NA	NA	NA	NA	NA
WP_017377120.1|2682987_2684238_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_155050374.1|2684271_2685381_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.6e-49
WP_144420723.1|2685698_2687084_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|2687123_2687381_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053856767.1|2689796_2691200_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	2708426	2758349	3218154	transposase	Escherichia_phage(16.67%)	46	NA	NA
WP_048875923.1|2708426_2709422_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420725.1|2710541_2710772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773936.1|2711271_2712027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375825.1|2712221_2713715_-	amino acid permease	NA	NA	NA	NA	NA
WP_129556626.1|2714161_2715550_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375827.1|2715981_2716419_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_027242638.1|2716666_2717095_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_047927246.1|2717215_2717653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|2717766_2719170_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|2719166_2719304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875872.1|2719476_2720760_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875871.1|2720964_2721168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376862.1|2721342_2722347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376863.1|2722704_2723940_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376864.1|2724106_2725057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162039023.1|2725114_2725429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2725629_2726358_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_027242662.1|2726527_2727355_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_048875864.1|2727768_2728794_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275277.1|2728664_2728904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377336.1|2729086_2731897_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_144420730.1|2733239_2734130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036818827.1|2734160_2734892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242661.1|2735194_2736232_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_017377343.1|2736296_2737721_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.0e-16
WP_144420819.1|2737941_2738391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377345.1|2738409_2738646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377348.1|2741174_2741927_-	ComF family protein	NA	NA	NA	NA	NA
WP_036773024.1|2741970_2742933_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_017377349.1|2742932_2744171_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_017377350.1|2744201_2744975_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377351.1|2744955_2745816_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_017377352.1|2745880_2746588_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_017377353.1|2746550_2747054_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	41.2	1.9e-13
WP_162039062.1|2747606_2749184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377355.1|2749323_2749614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377356.1|2749632_2750166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377357.1|2750158_2750497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377358.1|2750499_2751069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063625.1|2751087_2751465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377360.1|2751570_2751984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910663.1|2752221_2753424_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	1.7e-36
WP_027242659.1|2753531_2754557_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	76.9	2.0e-17
WP_036774259.1|2754865_2755840_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377364.1|2755989_2756826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|2756945_2758349_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	2795375	2866490	3218154	transposase,tRNA,protease	Staphylococcus_phage(25.0%)	79	NA	NA
WP_017377694.1|2795375_2796104_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_048876012.1|2796304_2797708_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|2797853_2798351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|2798420_2799323_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376921.1|2799580_2799913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772950.1|2799974_2800511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376923.1|2800609_2801776_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_017376924.1|2802081_2804880_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376925.1|2804938_2806159_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376927.1|2806664_2806802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376929.1|2807228_2807516_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376930.1|2807672_2808002_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376931.1|2808036_2809674_-	response regulator	NA	NA	NA	NA	NA
WP_017376932.1|2809775_2810825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376933.1|2810897_2811542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|2811538_2812792_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376935.1|2812809_2814081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376936.1|2814105_2814696_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_016209991.1|2815044_2815374_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_026063582.1|2815600_2816164_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_017376939.1|2816200_2816662_+	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_017376940.1|2816739_2818425_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_026063583.1|2818474_2819302_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_016210000.1|2819301_2819850_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_017376942.1|2819979_2820372_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_017376943.1|2820622_2820880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|2820876_2821488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046563.1|2821924_2822062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046562.1|2822206_2822350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|2822531_2823506_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_027242664.1|2823789_2824992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929598.1|2825288_2825546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|2825503_2825944_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_053856769.1|2826049_2826616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875862.1|2826760_2827015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875861.1|2827159_2828029_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774534.1|2828033_2828459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063584.1|2828550_2829510_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_017376953.1|2829506_2830154_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_017376954.1|2830182_2831034_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376955.1|2831048_2832326_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376956.1|2832366_2832882_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376957.1|2832959_2834021_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_036818645.1|2834042_2835131_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376959.1|2835175_2837011_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2837053_2837524_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2837560_2837896_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_162039067.1|2837908_2838553_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_036772771.1|2838561_2839602_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_017376963.1|2839574_2840054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376964.1|2840140_2842621_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_036772765.1|2842683_2843115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376966.1|2843314_2843605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242666.1|2843664_2845263_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376969.1|2845427_2845763_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_017376970.1|2845791_2847456_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_027242667.1|2847455_2848097_-	lipoprotein	NA	NA	NA	NA	NA
WP_017376972.1|2848096_2848840_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_017376973.1|2848898_2849135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376974.1|2849285_2850653_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376975.1|2850663_2851215_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_065653729.1|2851295_2852399_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376977.1|2852400_2854158_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_062312189.1|2854380_2855004_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|2855058_2855478_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_047927116.1|2855618_2856233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242668.1|2856290_2857076_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376980.1|2857707_2858724_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_144420820.1|2858726_2859239_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_017376982.1|2859280_2859754_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_162038682.1|2859809_2860559_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_036771653.1|2860638_2861379_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
WP_017376985.1|2861468_2861717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|2862092_2862746_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|2862714_2862894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856770.1|2863291_2864506_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875859.1|2864814_2865609_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2865741_2865969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772490.1|2866211_2866490_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	2950148	3060985	3218154	transposase,tRNA,protease	Staphylococcus_phage(14.29%)	101	NA	NA
WP_017378106.1|2950148_2951093_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_017378107.1|2951092_2951446_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_017378109.1|2954185_2955703_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_016209273.1|2955779_2956232_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_017378110.1|2956450_2957890_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_017378111.1|2957889_2959428_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_017378112.1|2959442_2961413_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_016209309.1|2961416_2961722_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_017378113.1|2961745_2962369_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_017378114.1|2962388_2962877_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_027242679.1|2962890_2963916_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_017378117.1|2963920_2966314_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_016209307.1|2966363_2967653_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_017378118.1|2967659_2968160_-	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_017378119.1|2968159_2969413_-	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_017378120.1|2969414_2970092_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_016209262.1|2970109_2970595_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_016209283.1|2970585_2970954_-	NAD(P)H-quinone oxidoreductase subunit 3	NA	NA	NA	NA	NA
WP_017378122.1|2971632_2971995_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_017378123.1|2972008_2972770_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_017378124.1|2973071_2974418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771461.1|2974514_2975057_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
WP_017378126.1|2975172_2976006_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_027242680.1|2976027_2976621_+	thymidine kinase	NA	A0A0B7MRR0	Enterobacteria_phage	53.6	6.4e-53
WP_048875856.1|2976796_2977816_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|2978086_2978488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378129.1|2978498_2978822_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_065653735.1|2978845_2979856_-	lipase	NA	NA	NA	NA	NA
WP_017378132.1|2979922_2980771_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_026063707.1|2980887_2981799_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_036772169.1|2982565_2983441_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063708.1|2983499_2983880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063709.1|2984026_2984263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378135.1|2984559_2985030_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_017378136.1|2985084_2985939_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378137.1|2986410_2986629_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378138.1|2986731_2987982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|2988037_2988520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242682.1|2988756_2989185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2989520_2990495_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017378141.1|2990553_2991606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378142.1|2991924_2992890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378143.1|2993192_2994017_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378144.1|2994218_2995295_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378145.1|2995379_2996366_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378146.1|2996384_2997029_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_027242684.1|2997040_2998150_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_027242685.1|2998216_2998879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242686.1|2999138_3001022_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_017378149.1|3001335_3002835_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_017378150.1|3002925_3003708_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378151.1|3003835_3004756_+	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378152.1|3004779_3005238_+	NfeD family protein	NA	NA	NA	NA	NA
WP_048875854.1|3005359_3006235_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|3006268_3007534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|3007721_3008597_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|3008795_3008987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|3009191_3010487_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275379.1|3010806_3011025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375941.1|3011061_3012441_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_017375942.1|3012468_3012927_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_036773720.1|3012904_3014122_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375944.1|3014314_3014551_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|3014564_3014720_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375945.1|3014800_3015763_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375947.1|3015922_3017239_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375948.1|3017248_3017917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|3018327_3020142_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_144420736.1|3020857_3021043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375951.1|3021224_3021683_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|3022401_3023277_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420737.1|3023508_3023907_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081000012.1|3023910_3024153_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375794.1|3025042_3026794_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375795.1|3026804_3027605_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375796.1|3027707_3028196_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_047927156.1|3028695_3029619_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375799.1|3029715_3030060_+	DMT family protein	NA	NA	NA	NA	NA
WP_162034387.1|3030972_3031131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377528.1|3035754_3036717_-	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_036772663.1|3036755_3037631_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063646.1|3037890_3039150_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|3039372_3039699_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_048875850.1|3039893_3040844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242725.1|3040901_3042968_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_017377534.1|3042973_3043969_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242724.1|3044717_3046298_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|3046445_3047855_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_017377536.1|3047914_3049048_-	cation transporter	NA	NA	NA	NA	NA
WP_017377537.1|3049186_3050011_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377539.1|3050534_3050747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|3050760_3050898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377540.1|3051035_3051269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|3052320_3052692_-	isochorismatase	NA	NA	NA	NA	NA
WP_017377542.1|3053002_3053290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377543.1|3053441_3054290_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_048875849.1|3054412_3055384_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377545.1|3055486_3056527_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_017377550.1|3059065_3059356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377551.1|3059623_3059884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|3060010_3060985_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 33
NZ_CP048056	Piscirickettsia salmonis strain Ps-8942B chromosome, complete genome	3218154	3093979	3155137	3218154	transposase,tRNA	Acinetobacter_phage(33.33%)	56	NA	NA
WP_053093682.1|3093979_3094723_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_162039070.1|3096062_3096485_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_017377391.1|3096755_3097334_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377386.1|3101856_3103362_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_017377385.1|3103389_3103671_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3103819_3104161_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_017377384.1|3104281_3106186_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_047927397.1|3106318_3107890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927396.1|3107907_3109125_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377379.1|3109246_3110245_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_144420826.1|3110248_3111007_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_017377377.1|3111008_3112208_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_036771983.1|3112191_3112863_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_017377375.1|3112884_3113661_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	31.1	2.0e-22
WP_017377374.1|3113664_3114663_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.4	2.7e-40
WP_017377373.1|3114664_3115243_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.5	1.1e-44
WP_017377372.1|3115239_3116709_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3116752_3117040_-	trp operon repressor	NA	NA	NA	NA	NA
WP_026063627.1|3117240_3118161_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017377369.1|3118276_3118831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377368.1|3118946_3119372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771981.1|3119642_3119993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242711.1|3120186_3120726_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_017377365.1|3120810_3121347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242710.1|3122006_3122309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162039071.1|3122757_3123225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771979.1|3123418_3123739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376171.1|3123917_3124892_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046560.1|3125158_3125332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|3125437_3126841_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875844.1|3126845_3127865_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275373.1|3128481_3128811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378398.1|3129036_3129435_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_017378399.1|3130302_3131253_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378400.1|3131252_3133331_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378401.1|3133472_3133988_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378402.1|3133996_3134560_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378403.1|3134540_3135287_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378404.1|3135425_3135878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927132.1|3136013_3136850_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_027242707.1|3136846_3137743_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017378407.1|3137775_3138843_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3138861_3139230_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_017378410.1|3140712_3142092_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_036773239.1|3142132_3143446_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_026063734.1|3143435_3144410_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_017378413.1|3144503_3145007_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_017378414.1|3145141_3146293_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3146289_3146769_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_027242705.1|3146915_3149237_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_080963576.1|3149181_3149808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378416.1|3149812_3150712_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_036773242.1|3150892_3151447_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|3151486_3152461_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|3153050_3153428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|3154162_3155137_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 1
NZ_CP048060	Piscirickettsia salmonis strain Ps-8942B plasmid Ps8942B-p4, complete sequence	208102	1798	118632	208102	portal,integrase,terminase,transposase	Streptococcus_phage(34.78%)	108	19184:19243	88719:89008
WP_162039105.1|1798_2365_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377667.1|3035_3206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377666.1|3349_3607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162039106.1|4457_4598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816379.1|5626_5950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162039107.1|6192_6378_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_162039108.1|9128_9608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162039121.1|11307_11424_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162039122.1|11457_11976_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.8	2.8e-20
WP_036771330.1|12718_13693_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_036771293.1|14231_14498_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772437.1|14793_16692_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_048876182.1|17047_18943_+	DUF1561 family protein	NA	NA	NA	NA	NA
19184:19243	attL	CCGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTT	NA	NA	NA	NA
WP_017375632.1|19642_19978_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017375836.1|20172_20376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243203.1|20469_21264_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
WP_080999971.1|25440_26844_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000017.1|27108_27360_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_048875857.1|27760_28735_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_048876221.1|29722_30178_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
WP_016212398.1|30272_30734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162039109.1|32794_34147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034493.1|34251_34866_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_017377509.1|34895_35624_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_144420837.1|35765_36698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377511.1|36727_37456_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|37458_37731_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|38581_39310_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|39365_39986_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|41134_41863_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_162038694.1|42082_42985_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377667.1|43654_43825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619477.1|43969_44263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036815609.1|46127_46583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157894757.1|46826_47201_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_047927763.1|47221_47485_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080963666.1|47866_48106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876259.1|47976_48993_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_027243195.1|49318_50365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|50730_51705_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_017375692.1|51848_52082_+	hypothetical protein	NA	Q7Y5W4	Haemophilus_phage	42.6	1.3e-06
WP_017375691.1|52105_52807_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	37.6	9.6e-32
WP_036773107.1|52790_53108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162039110.1|53395_54370_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	9.8e-27
WP_048876214.1|55141_55870_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_017377521.1|56378_56732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|57659_58388_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_157894750.1|59030_62315_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_162039111.1|62623_63514_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275473.1|64752_64929_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_027243191.1|65045_65753_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_048876212.1|65706_66585_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027243193.1|66615_67158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|67429_68134_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036772541.1|68145_68874_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|68903_69293_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|69315_70044_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|70046_70655_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
WP_155046641.1|70835_71000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157894755.1|71113_71251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243184.1|71243_71582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133264.1|71595_72000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375840.1|72044_72263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157894754.1|73249_74344_+	RepB family plasmid replication initiator protein	NA	A0A218MNI2	uncultured_virus	29.8	3.6e-25
WP_017377655.1|74685_74931_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|74927_75314_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|75401_76130_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|76108_76729_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|77074_77761_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|78710_79073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|79075_80815_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|81216_81369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929558.1|81396_82080_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_036771347.1|82161_83139_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|83214_83385_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|83425_84154_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_036771293.1|84699_84966_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772437.1|85261_87160_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|87581_88310_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_144420842.1|88371_88530_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046630.1|88946_89111_+	hypothetical protein	NA	NA	NA	NA	NA
88719:89008	attR	CCGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGGCCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTAGTGGAGTGTGCCGCTTCAAGGCACGTAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGT	NA	NA	NA	NA
WP_017375754.1|89131_90418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771359.1|90600_91329_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_036771347.1|91456_92434_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_144420843.1|93515_95399_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|96139_97117_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_162039112.1|97032_97707_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	41.3	9.2e-32
WP_053093683.1|97864_98077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|99077_100055_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_027243212.1|100549_100837_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_027243211.1|100826_101081_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_155046636.1|101298_101460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|101474_102452_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|102932_103910_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_144420849.1|104375_105356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|105587_106097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242596.1|106136_106499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275482.1|106812_107787_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_017377509.1|107880_108609_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_157894750.1|108789_112074_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_144420848.1|112137_112323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876202.1|113701_114415_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_036771649.1|114461_115196_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_087910668.1|115233_115620_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_157894751.1|115706_116063_-	hypothetical protein	NA	A0A1X9I6B3	Streptococcus_phage	49.6	2.6e-25
WP_048876205.1|116345_117677_-|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_027242928.1|117679_118153_-|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	7.9e-14
WP_027242929.1|118248_118632_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
>prophage 2
NZ_CP048060	Piscirickettsia salmonis strain Ps-8942B plasmid Ps8942B-p4, complete sequence	208102	128130	192204	208102	portal,integrase,transposase	Streptococcus_phage(45.16%)	63	156028:156087	196540:197460
WP_048876229.1|128130_129102_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046634.1|129020_129221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771279.1|129290_130019_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375850.1|130379_131156_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_162039113.1|131572_131929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|133314_133458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771289.1|134351_134822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876208.1|135675_136503_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_157894752.1|136915_137095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|137367_138339_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|138908_139637_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036772441.1|139712_139985_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_032126795.1|139988_140249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036775032.1|142880_143696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375909.1|143743_144433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|144721_145450_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036771347.1|145663_146641_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_162039114.1|147407_147566_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0N9RU54	Staphylococcus_phage	60.0	6.5e-05
WP_036771347.1|147593_148571_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_047927782.1|148715_149105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420843.1|149900_151784_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_162039115.1|151902_152361_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|152435_153413_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_162039116.1|153440_154307_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	9.0e-40
156028:156087	attL	TTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTA	NA	NA	NA	NA
WP_027243215.1|157298_158321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774350.1|158803_159532_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_048876194.1|160771_161305_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_080963665.1|161485_161827_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_080963664.1|162007_162274_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_162039117.1|162346_162919_-	ATP-binding domain-containing protein	NA	A0A023NGQ0	Nitrincola_phage	51.9	2.3e-07
WP_162039118.1|163302_164211_-	ATP-dependent helicase	NA	V5K3E8	Pseudomonas_phage	36.4	1.1e-43
WP_146619416.1|164516_164663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|165006_165735_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046637.1|165816_166308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162039119.1|167040_167484_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.0e-26
WP_017377694.1|167582_168311_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_048876190.1|168340_168670_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876191.1|168662_169091_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036772867.1|169713_170001_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.8e-06
WP_162039120.1|170060_170441_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377694.1|170470_171199_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|171210_171360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|171606_172335_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036774388.1|173712_174675_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027242592.1|174698_175028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|175094_176135_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_144420833.1|176148_176340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774378.1|176544_177114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774316.1|177156_177456_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155046638.1|177452_177917_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774373.1|178190_178919_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_048876188.1|179092_179866_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_027243202.1|180579_181515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|181789_182518_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046639.1|182683_182887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929623.1|182986_186328_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_036772541.1|186485_187214_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_144420834.1|187507_187903_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036815648.1|187955_188684_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|189167_189896_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|190066_190636_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_087910667.1|190640_191324_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_036772541.1|191475_192204_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
196540:197460	attR	TTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGCGCACAAGAAAAACGAGCTAACGCTAAGCAAGGACAAGCTTTTCAACAAATTTCAGAAGAGGAAAAAATGTTGATTCATCAGCGGTTAAGCACTCATACATCCCCCGATGTTATCAGTCAAGAACTTATACGTGAGCATAATATTCAGGTGAGTGAGAGCACGATTTACCGTTATATTTATGATGATAGAGAGCGGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCAGGAAAACCTTATAAGAAGAAGGTGAGTCGTGGTGATCAAACAAAAATACCTAATCGCGTTGGTATTGAACAACGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGTGACCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACTTCTGACAACGGAACAGAGTTTGCCGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAACACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACGGATTTTAATGAAGTTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATCGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCGT	NA	NA	NA	NA
>prophage 1
NZ_CP048061	Piscirickettsia salmonis strain Ps-8942B plasmid Ps8942B-p5, complete sequence	114110	5134	54525	114110	tail,capsid,transposase,head,integrase,terminase	unidentified_phage(39.29%)	57	27411:27470	62089:63202
WP_017375779.1|5134_5560_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375778.1|5556_5868_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_162039131.1|6848_7301_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.5	5.4e-28
WP_162039132.1|7246_7399_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_162039124.1|8868_9624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162039125.1|9734_10748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162039126.1|10824_11145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162038671.1|11872_12826_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.7	4.8e-26
WP_027243194.1|13082_13430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375691.1|13413_14115_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	37.6	9.6e-32
WP_017375692.1|14138_14372_-	hypothetical protein	NA	Q7Y5W4	Haemophilus_phage	42.6	1.3e-06
WP_036773116.1|14515_15490_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_027243195.1|15855_16902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876259.1|17227_18244_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080963666.1|18114_18354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876258.1|20665_21460_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_036817087.1|21772_22141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876257.1|22522_23317_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_162038713.1|23461_24253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377663.1|24525_24855_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	44.9	6.1e-13
WP_017377662.1|24865_25180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275453.1|25267_26242_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.4	2.9e-26
WP_048876255.1|26484_27486_+	hypothetical protein	NA	NA	NA	NA	NA
27411:27470	attL	GGCTTTGTTGCATAGCTCAAAAAGTGATCAATTCTGGAGGTTTGCCTACCCTGCTGCTAC	NA	NA	NA	NA
WP_036771347.1|27504_28482_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771332.1|28630_29605_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	2.2e-26
WP_146619546.1|30172_30325_-	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|30703_31678_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_155046645.1|31697_31859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242941.1|31858_32512_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_048876242.1|32523_32901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|33385_34360_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_027242942.1|34379_35057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062365785.1|35056_36112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876241.1|36256_38233_-	host specificity protein J	NA	C7BGD4	Burkholderia_phage	37.8	3.7e-89
WP_027242943.1|38503_38920_-	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
WP_027242944.1|38916_39474_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242945.1|39819_40335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420855.1|41138_41354_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_036771330.1|41427_42402_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242946.1|42782_43364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275490.1|43399_43792_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_036771330.1|43888_44863_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242948.1|44882_45068_-	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_027242949.1|45070_45553_-|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242950.1|45639_46023_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242951.1|46235_47102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162039123.1|47355_47496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|47727_48702_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242952.1|48799_49147_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.6e-16
WP_027242953.1|49139_49394_-	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_027242954.1|49538_49904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971681.1|50436_51411_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_016211078.1|51587_51941_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_027242955.1|51933_52194_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016212329.1|52424_53015_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_075278739.1|53080_53437_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|53550_54525_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
62089:63202	attR	GGCTTTGTTGCATAGCTCAAAAAGTGATCAATTCTGGAGGTTTGCCTACCCTGCTGCTACATTAACATCAAACTAATAGTTGTGATGAGTTGCAGTGCCATATAAATATCCAAAAGGAAAAGGGTGGGATATCCCTAAACAAAAATATGGCGTTACAAACTGGGCAAAGTACACCGATAGCCTGCGTAATCGTGGCCGTATTGATGTTTGGATTTCAGAGAAAGCCATTGAAGGTTGGTACAAAAAAGACCGAGTTTATGATGGTACAGGCACGCCGTTTCTATACTCAGACCTGGCGATCATCACCTGTCATGAAATTCGTAAAGTGTTTAAACAGCCATTACGCCAGACTCAGGGCCTAATTGATTCCTTCTTTGAATCCCAAGGACTGCCGATCAAATGCCCTGACTATACGGTGTTATCAAAAAGGTTAGCGGAGCTCGATATTAAGGTCCCACGCTATCGCAAAACAGATAAGCCAGATGATGATATTGCGGGAATAGCCATTGATTCTACAGGCCTTAAGCGTTTTGGCCGTGACGAGTGGCACCAAGAAAAATACAAGATATCAGCAAAGCGCAGCTGGCGTAAACTTCATGTGGCCGTTGATGATGATCACTATATTCAAGCCGCACTCATCACCGATCGCTATGAAGCAGATGAGGAGGTTGTGGATGAGCTACTGGAGCAAATTGATGAGCCGTTTGATCGCTTCACTGCAGACGGAGCCTACGATAGCCATGATGTTTACGATTCCGTTTTAAACCACTCACCTAATGCTGATGTTGTTATCCCTCCTCCTAAAAATGCCGTATTTGATGAAAATAACCACGCGATTAGAAACATAAATTTTAATGAGATTAAAGATCATGGTAGAATGCACTGGCAAAAGACACGACAATACGGCAAGCGTAATTATTCTGAGTTGGCGATTCAGCGTTACAAACGCATTTTGGGCAACACGATGCAGTCCAGAGAGATATCGCGTCAGAAAAATGAAGGACTAATTGGCGCGGGTATTTTAAATAAGATGACCAGTCTCGGCATGCCGGATAGTTTTAGACGCAGCTGAATTGTGCCTGGAATATGGGACCAGAGGTTACGCAACAACGCC	NA	NA	NA	NA
>prophage 2
NZ_CP048061	Piscirickettsia salmonis strain Ps-8942B plasmid Ps8942B-p5, complete sequence	114110	80304	94100	114110	transposase,tail,capsid,head	Moraxella_phage(18.18%)	18	NA	NA
WP_036771347.1|80304_81282_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017375652.1|81309_81738_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242568.1|81796_84487_-	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375789.1|84483_85041_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_144420832.1|85030_85816_-	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375787.1|85745_86417_-|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_017375786.1|86413_86755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771950.1|86747_88826_-|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375784.1|88829_89096_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_017375783.1|89152_89476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375782.1|89477_89900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375781.1|89899_90250_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375780.1|90246_90642_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375779.1|90820_91246_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375778.1|91242_91554_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_027242598.1|91938_92523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275454.1|92536_93076_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_036771639.1|93125_94100_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
>prophage 1
NZ_CP048063	Piscirickettsia salmonis strain Ps-8942B plasmid Ps8942B-p7, complete sequence	24152	5307	14220	24152	transposase	Staphylococcus_phage(25.0%)	15	NA	NA
WP_075275473.1|5307_5484_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_027243191.1|5600_6308_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_162039145.1|6261_7047_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027243193.1|7169_7712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|7983_8688_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036772541.1|8699_9428_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|9457_9847_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|9869_10598_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|10600_11209_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
WP_155046641.1|11389_11554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157894755.1|11667_11805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243184.1|11797_12136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133264.1|12149_12554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375840.1|12598_12817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162039146.1|13803_14220_+	replication initiation protein	NA	A0A218MNI2	uncultured_virus	36.9	3.0e-09
