The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048275	Morganella morganii strain N18-00103 chromosome, complete genome	3942451	135560	144407	3942451		Escherichia_phage(66.67%)	8	NA	NA
WP_087825497.1|135560_138014_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.7	9.9e-217
WP_004237907.1|138025_138643_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	8.0e-75
WP_087825498.1|138644_139505_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.7	6.7e-27
WP_087825499.1|139590_140202_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.7	6.4e-24
WP_004237910.1|140269_140560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015422349.1|140687_141374_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004237912.1|141462_142083_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	55.5	3.0e-61
WP_024474702.1|142451_144407_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.0	7.4e-82
>prophage 2
NZ_CP048275	Morganella morganii strain N18-00103 chromosome, complete genome	3942451	1234208	1276702	3942451	integrase,holin,terminase,head	Cronobacter_phage(26.67%)	63	1234149:1234207	1278256:1278314
1234149:1234207	attL	TTCGTAATGAAAAGGTCACCAGTTCGAATCCGGTATCCGGCACCATTACTTATCAAAGA	NA	NA	NA	NA
WP_162675961.1|1234208_1235372_-|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	69.8	4.4e-167
WP_162675962.1|1235977_1236349_-	DUF2591 domain-containing protein	NA	E9NID9	Enterobacter_phage	44.9	8.6e-16
WP_162675963.1|1236332_1236557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162675964.1|1236712_1237075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162675965.1|1237074_1237212_-	hypothetical protein	NA	A0A1P8DTH4	Proteus_phage	66.7	1.9e-08
WP_162675966.1|1237214_1237706_-	ASCH domain-containing protein	NA	A0A0U1SZL2	Pseudomonas_phage	29.8	2.8e-14
WP_162675967.1|1237765_1238464_-	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	59.1	3.1e-75
WP_112544338.1|1238463_1239387_-	recombinase RecT	NA	F1C5B8	Cronobacter_phage	67.2	5.0e-113
WP_162675968.1|1239383_1239629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162675969.1|1239625_1239889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115072119.1|1240120_1240315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115072120.1|1240354_1240621_-	hypothetical protein	NA	A0A2I7RQ39	Vibrio_phage	42.4	1.1e-09
WP_115072121.1|1240825_1241065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162675970.1|1241146_1241446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115072123.1|1241953_1243108_-	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	28.6	2.3e-35
WP_052927997.1|1243116_1243803_-	helix-turn-helix transcriptional regulator	NA	M9NZE3	Enterobacteria_phage	55.8	3.6e-68
WP_062772828.1|1243905_1244112_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	65.6	4.0e-15
WP_025154244.1|1244238_1244565_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	91.7	6.1e-50
WP_162675971.1|1244589_1245384_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	55.1	1.4e-68
WP_162676048.1|1245929_1246331_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	57.3	2.7e-39
WP_162675972.1|1246327_1247023_+	DNA replication protein	NA	A0A077KCC8	Edwardsiella_phage	48.7	8.5e-57
WP_162675973.1|1247047_1247254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162675974.1|1247243_1247468_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162675975.1|1247454_1247643_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_162675976.1|1247642_1247822_+	DUF1187 family protein	NA	NA	NA	NA	NA
WP_162675977.1|1247825_1248182_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	57.1	2.2e-24
WP_162675978.1|1248182_1248629_+	DUF1367 family protein	NA	A0A096XEN2	Escherichia_phage	65.1	1.2e-51
WP_162675979.1|1248639_1249056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162675980.1|1249015_1249708_+	serine/threonine-protein phosphatase	NA	A0A2D1GLI5	Escherichia_phage	63.3	7.4e-77
WP_162675981.1|1249843_1249981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162675982.1|1249989_1250583_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	78.5	2.1e-72
WP_162675983.1|1250572_1250773_+	NinH	NA	A0A088CC23	Shigella_phage	49.1	3.7e-05
WP_162675984.1|1250769_1251900_+	DUF1133 family protein	NA	I7HBD4	Xanthomonas_virus	40.9	4.5e-23
WP_162675985.1|1252317_1252554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036423476.1|1253080_1253470_+	membrane protein	NA	S4TRS4	Salmonella_phage	41.3	2.2e-14
WP_036423474.1|1253466_1253751_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	35.7	9.6e-07
WP_036423472.1|1253743_1254226_+	TIGR02594 family protein	NA	A0A1U9ZAE8	Proteus_phage	70.5	3.9e-61
WP_162675986.1|1254227_1254605_+	hypothetical protein	NA	A0A1W6JNV2	Morganella_phage	51.9	6.5e-19
WP_162675987.1|1254576_1254750_+	Rz1 lytic protein	NA	A0A1W6JP52	Morganella_phage	77.8	3.1e-16
WP_162675988.1|1254746_1254926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162676049.1|1255140_1255377_-	ATP-dependent RNA helicase HrpA	NA	NA	NA	NA	NA
WP_162675989.1|1255424_1255607_-	DUF2158 domain-containing protein	NA	M1F284	Cronobacter_phage	44.2	5.7e-05
WP_162675990.1|1255633_1256161_+|terminase	terminase small subunit	terminase	A0A1W6JNT5	Morganella_phage	73.7	1.9e-69
WP_162675991.1|1256162_1257644_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	97.9	3.2e-287
WP_162675992.1|1257643_1259101_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	49.2	7.1e-122
WP_162675993.1|1259054_1260050_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	62.1	2.4e-105
WP_162675994.1|1260066_1261470_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	64.2	1.6e-155
WP_162675995.1|1261476_1261914_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	59.3	9.1e-41
WP_046024087.1|1261924_1263001_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	67.4	9.2e-135
WP_025154868.1|1263306_1263678_+	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	46.3	7.6e-20
WP_143971432.1|1263674_1264016_+	hypothetical protein	NA	R9TRK0	Aeromonas_phage	43.4	4.5e-19
WP_036423416.1|1264017_1264458_+	hypothetical protein	NA	H6WRT9	Salmonella_phage	50.3	4.6e-32
WP_036423413.1|1264454_1264823_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	33.6	6.8e-13
WP_162675996.1|1264887_1265643_+	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	96.4	1.1e-131
WP_162675997.1|1265693_1266389_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	96.9	8.9e-123
WP_162675998.1|1266491_1266758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073970187.1|1266963_1267356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162675999.1|1267421_1270883_+	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	52.6	2.6e-239
WP_162676000.1|1270879_1271356_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	62.7	4.5e-57
WP_062772915.1|1271355_1271826_+	DUF1833 family protein	NA	F1C5F1	Cronobacter_phage	50.0	4.4e-41
WP_062772918.1|1271822_1272215_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	57.9	6.3e-41
WP_162676001.1|1272201_1274673_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	52.1	1.5e-249
WP_162676002.1|1274734_1276702_+	hypothetical protein	NA	E9NII8	Enterobacter_phage	52.0	1.8e-173
1278256:1278314	attR	TTCGTAATGAAAAGGTCACCAGTTCGAATCCGGTATCCGGCACCATTACTTATCAAAGA	NA	NA	NA	NA
>prophage 3
NZ_CP048275	Morganella morganii strain N18-00103 chromosome, complete genome	3942451	1318411	1356490	3942451	integrase,capsid,tRNA,terminase	Pectobacterium_phage(20.51%)	50	1314938:1314953	1340545:1340560
1314938:1314953	attL	CACGCCATCCGGATTA	NA	NA	NA	NA
WP_036423364.1|1318411_1319434_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	63.4	2.4e-124
WP_036415353.1|1319436_1319655_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	50.0	6.8e-13
WP_036423362.1|1319638_1319818_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	49.1	4.6e-07
WP_087825573.1|1320306_1320804_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	65.7	3.2e-50
WP_162676005.1|1320800_1322801_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	38.5	1.9e-125
WP_036423353.1|1322816_1323149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036415342.1|1323406_1323625_+	hypothetical protein	NA	A0A1W6JP23	Morganella_phage	60.6	8.1e-14
WP_125112315.1|1323617_1323932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087825571.1|1324206_1324902_-	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	46.0	4.8e-52
WP_036423348.1|1325007_1325253_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	46.6	2.8e-15
WP_087825570.1|1325296_1325749_+|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	57.0	3.3e-33
WP_049242644.1|1325766_1325991_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	63.5	3.1e-21
WP_087825569.1|1325992_1326844_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	60.5	3.6e-33
WP_087825568.1|1326836_1327409_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	50.3	2.7e-48
WP_087825567.1|1327411_1328782_+	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	45.1	5.5e-100
WP_087825565.1|1328981_1329215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087825588.1|1329253_1329445_+	hypothetical protein	NA	Q8SBE9	Shigella_phage	65.5	2.6e-16
WP_087825564.1|1329553_1330342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087825563.1|1330824_1331691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046024848.1|1331985_1332579_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	58.7	3.4e-62
WP_087825562.1|1332591_1332903_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	70.8	1.8e-35
WP_087825561.1|1332890_1333424_+	DUF1133 family protein	NA	K7PHU3	Enterobacteria_phage	51.0	1.3e-36
WP_087825560.1|1334042_1335038_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_004240322.1|1335545_1335737_+	hypothetical protein	NA	A0A1W6JNY9	Morganella_phage	98.4	1.9e-30
WP_087825559.1|1335729_1336206_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	92.4	6.8e-82
WP_109882379.1|1336342_1336870_+	hypothetical protein	NA	H9C185	Pectobacterium_phage	40.4	3.5e-18
WP_004242385.1|1337167_1337353_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	60.3	1.4e-11
WP_125112381.1|1337410_1338427_+|terminase	terminase small subunit	terminase	Q6J1S5	Burkholderia_virus	35.6	4.3e-33
WP_087825590.1|1338627_1340028_+|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	41.1	1.2e-86
WP_087825591.1|1340029_1341544_+	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	45.0	2.2e-105
1340545:1340560	attR	TAATCCGGATGGCGTG	NA	NA	NA	NA
WP_036415920.1|1341566_1342280_+|capsid	minor capsid protein	capsid	Q6IWU3	Burkholderia_phage	39.1	2.9e-36
WP_004240332.1|1342276_1343557_+	DUF2213 domain-containing protein	NA	A0A2H5BG39	Pseudoalteromonas_phage	41.0	3.0e-39
WP_004240333.1|1343556_1344054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162676006.1|1344053_1345121_+	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	37.6	3.9e-53
WP_087825593.1|1345176_1345530_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	36.8	1.1e-07
WP_087825594.1|1345539_1345968_+	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	30.9	1.0e-07
WP_048822530.1|1345964_1346423_+	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	41.3	2.7e-19
WP_087825595.1|1346422_1346791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048822528.1|1346780_1347296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087825596.1|1347305_1348793_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.1	4.3e-82
WP_087825597.1|1348802_1349255_+	hypothetical protein	NA	A0A2H4P6T4	Pseudomonas_phage	43.5	1.5e-25
WP_087825598.1|1349296_1349758_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.3	2.6e-25
WP_087825599.1|1349840_1351979_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	29.9	2.6e-19
WP_036415267.1|1351975_1352506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046024498.1|1352502_1352796_+	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	34.4	1.1e-08
WP_048822525.1|1352788_1353604_+	hypothetical protein	NA	A0A0H4M7L6	Pseudomonas_phage	28.7	7.5e-20
WP_087825600.1|1353617_1354310_+	hypothetical protein	NA	Q6IWQ1	Burkholderia_phage	42.4	3.1e-35
WP_087825601.1|1354306_1354651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087825602.1|1354643_1355831_+	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	38.9	6.7e-78
WP_087825603.1|1355827_1356490_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.7	7.6e-39
>prophage 4
NZ_CP048275	Morganella morganii strain N18-00103 chromosome, complete genome	3942451	1389405	1430314	3942451	portal,tail,terminase,holin,protease	Morganella_phage(36.36%)	51	NA	NA
WP_032098699.1|1389405_1390632_-	DUF3440 domain-containing protein	NA	L0P6Z6	Lactobacillus_phage	33.7	8.2e-63
WP_087825623.1|1390864_1391338_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_049243403.1|1391585_1392248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123229725.1|1392244_1392676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070578043.1|1392665_1393511_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	36.4	1.2e-31
WP_049243405.1|1393610_1394783_-	recombinase	NA	A0A2D1GN00	Marinobacter_phage	31.1	2.0e-29
WP_053090724.1|1395030_1395354_-	hypothetical protein	NA	A0A248SL53	Klebsiella_phage	39.8	5.0e-20
WP_049243406.1|1395471_1395999_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	96.0	7.3e-93
WP_049243407.1|1396107_1396935_-	YfdQ family protein	NA	U5P439	Shigella_phage	54.2	6.1e-78
WP_025154873.1|1397000_1397363_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	65.5	2.4e-34
WP_049243408.1|1397583_1397796_-	hypothetical protein	NA	A0A1W6JP89	Morganella_phage	77.1	3.2e-23
WP_025154478.1|1397927_1398572_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	61.8	2.4e-74
WP_025154477.1|1398667_1398868_+	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	62.1	9.3e-17
WP_049243409.1|1398897_1399362_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	48.7	2.1e-35
WP_148042439.1|1399425_1399626_+	hypothetical protein	NA	A0A1W6JP45	Morganella_phage	68.2	1.6e-21
WP_049243410.1|1399618_1399810_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	92.1	6.6e-28
WP_049243411.1|1399806_1400691_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	88.1	6.0e-132
WP_049243412.1|1400690_1401086_+	hypothetical protein	NA	A0A1W6JP58	Morganella_phage	37.2	2.7e-15
WP_025154470.1|1401128_1401920_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	85.2	6.6e-122
WP_049243413.1|1401919_1402936_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	88.8	2.0e-179
WP_049243414.1|1402966_1403644_+	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	90.2	1.2e-116
WP_036421164.1|1403874_1404324_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	45.6	1.5e-22
WP_064483823.1|1404594_1404804_+	hypothetical protein	NA	A0A1W6JNU4	Morganella_phage	68.7	2.2e-21
WP_064483824.1|1405215_1405455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036414580.1|1405962_1406238_-	DUF4282 domain-containing protein	NA	NA	NA	NA	NA
WP_064483821.1|1406541_1406733_+|holin	holin	holin	A0A1W6JNY9	Morganella_phage	98.4	4.6e-29
WP_025154467.1|1406725_1407202_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	96.2	1.7e-85
WP_064483820.1|1407338_1407866_+	hypothetical protein	NA	H9C185	Pectobacterium_phage	40.4	2.6e-18
WP_036413632.1|1408163_1408349_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	60.3	1.4e-11
WP_024474667.1|1408739_1409243_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	57.2	2.3e-40
WP_049242717.1|1409239_1411354_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.4	7.8e-295
WP_004242389.1|1411350_1411569_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	58.6	1.1e-15
WP_004242392.1|1411565_1413041_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	67.8	2.9e-187
WP_087825630.1|1413012_1415043_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	66.0	1.1e-256
WP_024474671.1|1415128_1415470_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	56.5	5.7e-22
WP_004242396.1|1415474_1415753_+	ATP-binding sugar transporter-like protein	NA	K7PH43	Enterobacteria_phage	43.2	5.5e-15
WP_024474672.1|1415754_1416318_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	56.1	1.9e-46
WP_004242399.1|1416317_1416716_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	61.7	5.2e-43
WP_004242400.1|1416725_1417253_+|tail	Putative tail component protein	tail	M9NYX0	Enterobacteria_phage	75.5	1.9e-64
WP_004242401.1|1417256_1417655_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	36.4	3.6e-12
WP_036413646.1|1417678_1417987_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	51.5	9.7e-21
WP_087825629.1|1417967_1420895_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	35.6	2.8e-141
WP_004242405.1|1420897_1421227_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	54.1	7.1e-30
WP_004242407.1|1421729_1422512_+	hypothetical protein	NA	Q9MCN2	Enterobacteria_phage	45.0	6.9e-55
WP_004242408.1|1422523_1423222_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	50.9	8.5e-65
WP_004242409.1|1423239_1423968_+	C40 family peptidase	NA	A0A0P0ZE89	Stx2-converting_phage	60.8	2.6e-88
WP_046024959.1|1423871_1424516_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	46.7	3.9e-48
WP_087825628.1|1424528_1427690_+	host specificity protein J	NA	A0A1W6JNW2	Morganella_phage	49.7	3.8e-285
WP_036421959.1|1427683_1428052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036421961.1|1428053_1428668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087825632.1|1429774_1430314_+	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	98.1	4.2e-88
>prophage 5
NZ_CP048275	Morganella morganii strain N18-00103 chromosome, complete genome	3942451	1530587	1533514	3942451		Morganella_phage(83.33%)	6	NA	NA
WP_087825260.1|1530587_1531295_-	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	56.1	4.4e-69
WP_004239822.1|1531660_1532098_+	hypothetical protein	NA	A0A1W6JNY5	Morganella_phage	47.8	1.2e-27
WP_004235068.1|1532170_1532365_+	hypothetical protein	NA	A0A1W6JNY9	Morganella_phage	73.0	2.6e-24
WP_087825261.1|1532354_1532831_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	79.6	5.1e-69
WP_004235070.1|1532967_1533345_+	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	38.4	7.7e-12
WP_036417780.1|1533316_1533514_+	hypothetical protein	NA	A0A1W6JP52	Morganella_phage	67.9	1.1e-12
>prophage 6
NZ_CP048275	Morganella morganii strain N18-00103 chromosome, complete genome	3942451	1736313	1783735	3942451	integrase,plate,head,portal,tail,capsid,terminase,holin	Morganella_phage(17.14%)	66	1734406:1734420	1739789:1739803
1734406:1734420	attL	ACCGGCAGTGGTGTC	NA	NA	NA	NA
WP_061057455.1|1736313_1737537_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	49.9	1.3e-113
WP_004239999.1|1737493_1737700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036425739.1|1737696_1738014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057454.1|1738000_1738777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036421283.1|1738766_1739018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004240826.1|1739014_1739236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105212822.1|1739248_1739821_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	39.5	8.3e-34
1739789:1739803	attR	GACACCACTGCCGGT	NA	NA	NA	NA
WP_004240824.1|1739820_1740048_-	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_081093786.1|1740242_1740710_-	hypothetical protein	NA	A0A286S260	Klebsiella_phage	56.4	8.9e-34
WP_061057450.1|1740946_1741162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057449.1|1741161_1741368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057448.1|1741354_1741702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057446.1|1742384_1742684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057445.1|1742686_1743082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057444.1|1743249_1743438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057443.1|1743439_1743628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081093772.1|1743649_1744111_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PJ00	Moraxella_phage	51.5	4.5e-06
WP_061057441.1|1744202_1744883_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	43.8	1.9e-48
WP_071888194.1|1744989_1745202_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	43.9	2.1e-06
WP_061057440.1|1745170_1745449_+	hypothetical protein	NA	A0A0N7BYT1	Escherichia_phage	47.8	6.5e-16
WP_061057439.1|1745713_1747291_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.6	2.0e-210
WP_061057438.1|1747287_1748274_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	59.9	4.1e-113
WP_061057437.1|1748273_1749053_+	molecular chaperone	NA	A0A1B5FPA5	Escherichia_phage	38.9	5.2e-47
WP_061057436.1|1749265_1749460_+	hypothetical protein	NA	A0A1W6JP28	Morganella_phage	98.4	2.3e-28
WP_162676010.1|1749598_1750651_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	90.7	7.8e-171
WP_061057434.1|1750763_1751351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036422679.1|1751674_1751896_+|holin	holin	holin	H9C183	Pectobacterium_phage	67.7	1.4e-18
WP_061057433.1|1751888_1752365_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	66.0	3.5e-54
WP_061057432.1|1752501_1752879_+	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	75.0	9.0e-45
WP_081093771.1|1752766_1753018_+	hypothetical protein	NA	A0A1W6JNV7	Morganella_phage	75.0	1.3e-15
WP_036424849.1|1753017_1753242_+	hypothetical protein	NA	A0A2I7QSR3	Vibrio_phage	48.4	6.8e-08
WP_061057431.1|1753490_1754150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071888210.1|1755180_1755753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057429.1|1755727_1757701_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	47.0	1.4e-144
WP_061057428.1|1757710_1757962_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_105212821.1|1757961_1759614_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.6	1.3e-92
WP_061057427.1|1759610_1760465_+	S49 family peptidase	NA	A0A1I9KF73	Aeromonas_phage	38.0	1.2e-49
WP_061057426.1|1760467_1761079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057425.1|1761078_1761471_+|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	34.6	8.3e-09
WP_087825957.1|1761543_1762590_+|capsid	major capsid protein	capsid	V5Q8X6	Xylella_phage	33.8	4.9e-48
WP_061057423.1|1762603_1762975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049246046.1|1762964_1763303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057422.1|1763302_1763851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004904824.1|1763853_1764021_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	54.8	4.7e-06
WP_061057421.1|1764017_1765499_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	45.1	4.7e-105
WP_004904816.1|1765508_1765877_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_105212820.1|1765876_1766143_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_162676011.1|1766285_1768175_+	hypothetical protein	NA	A0A0E3GMJ2	Enterobacteria_phage	33.6	1.3e-11
WP_061057419.1|1768290_1768749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057418.1|1768749_1769304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057417.1|1769781_1771182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057416.1|1771178_1772249_+|tail	phage tail protein	tail	A0A2I7S9G1	Vibrio_phage	30.3	2.7e-38
WP_081093770.1|1772248_1772836_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_061057414.1|1772835_1773273_+	hypothetical protein	NA	B5TK74	Pseudomonas_phage	55.2	1.4e-17
WP_061057413.1|1773273_1774413_+|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	33.3	1.3e-38
WP_061057412.1|1774409_1775003_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_087825961.1|1775053_1775980_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	39.3	3.6e-10
WP_080939470.1|1775958_1776339_+	hypothetical protein	NA	E7EKV7	Edwardsiella_phage	39.1	9.8e-15
WP_061057410.1|1776310_1776664_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	45.5	3.0e-10
WP_162676012.1|1776660_1777335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057408.1|1777324_1777879_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	73.3	2.7e-69
WP_061057407.1|1777914_1778196_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061057406.1|1778275_1778560_-	DinI-like family protein	NA	A0A1W6JP10	Morganella_phage	88.8	1.9e-39
WP_087825302.1|1779078_1780128_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	46.6	9.1e-79
WP_004235416.1|1780274_1781138_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_004239083.1|1781356_1783735_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.3	3.4e-174
>prophage 7
NZ_CP048275	Morganella morganii strain N18-00103 chromosome, complete genome	3942451	2116841	2196024	3942451	integrase,plate,head,portal,tail,capsid,terminase,lysis,tRNA	Salmonella_phage(30.95%)	83	2123267:2123286	2179940:2179959
WP_036417553.1|2116841_2117543_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_015422697.1|2117627_2119553_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.2	1.4e-88
WP_004237501.1|2119653_2119998_+	RidA family protein	NA	NA	NA	NA	NA
WP_162676019.1|2120190_2121786_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_046024608.1|2121871_2122822_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_036417557.1|2123131_2124694_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	32.4	1.5e-24
2123267:2123286	attL	AACGGCGCGGGAAAATCCAC	NA	NA	NA	NA
WP_004237497.1|2124687_2125692_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_004237496.1|2125688_2126693_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_004237495.1|2126722_2127751_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_004239422.1|2127816_2128698_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_087825409.1|2128701_2128998_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_080939495.1|2129163_2129985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046024610.1|2130012_2130627_-	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
WP_087825410.1|2130626_2131631_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_049246163.1|2131727_2133104_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_032098300.1|2133100_2133769_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.5	6.3e-33
WP_087825411.1|2133888_2134821_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_087825412.1|2134871_2136065_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_087825413.1|2136120_2137086_-	ribokinase	NA	NA	NA	NA	NA
WP_162676020.1|2137134_2137320_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004237484.1|2137649_2137982_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_004239441.1|2137983_2138373_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_004237480.1|2138881_2140357_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	9.9e-79
WP_004237479.1|2140687_2141536_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004239443.1|2141788_2143231_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_087825415.1|2143695_2144994_-	GTP pyrophosphokinase	NA	NA	NA	NA	NA
WP_087825416.1|2145451_2145712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087825417.1|2145762_2146887_-	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	67.9	1.1e-125
WP_087825418.1|2147038_2148229_+|tail	phage tail protein	tail	A0A0M4S6M1	Salmonella_phage	64.2	3.1e-147
WP_015422692.1|2148232_2148745_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	62.4	1.5e-55
WP_087825419.1|2148806_2149106_+|tail	phage tail protein	tail	A0A0M4RCV2	Salmonella_phage	48.1	1.8e-11
WP_071823271.1|2149129_2149258_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	53.8	1.1e-05
WP_087825420.1|2149254_2152140_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	38.0	4.7e-141
WP_087825421.1|2152145_2152589_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.9	3.3e-46
WP_162676021.1|2152624_2153191_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	72.8	1.3e-68
WP_162676022.1|2153180_2153951_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	42.3	2.9e-21
WP_087826186.1|2153952_2154582_+|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	35.9	7.8e-25
WP_087826187.1|2154553_2154907_-|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	48.7	4.0e-10
WP_087826448.1|2156201_2156810_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	65.7	7.4e-73
WP_087826447.1|2156802_2157711_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	66.2	1.3e-108
WP_087826446.1|2157713_2158052_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	50.5	1.0e-23
WP_087826445.1|2158048_2158678_-|plate	phage baseplate assembly protein V	plate	O80314	Escherichia_phage	57.1	2.6e-57
WP_087826444.1|2158674_2159316_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	48.1	3.5e-41
WP_087826443.1|2159325_2159742_-|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	45.2	1.0e-28
WP_004237260.1|2159741_2159897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162676023.1|2159893_2160403_-|lysis	lysis protein	lysis	A0A1B0VMJ3	Pseudomonas_phage	40.0	8.2e-17
WP_087826441.1|2160392_2160938_-	lysozyme	NA	K7PM52	Enterobacteria_phage	69.9	8.1e-71
WP_064483159.1|2160937_2161198_-	hypothetical protein	NA	A0A1V0E5R8	Salmonella_phage	53.3	9.3e-09
WP_049247083.1|2161200_2161401_-|tail	tail protein	tail	A0A0M4RTN6	Salmonella_phage	59.1	6.1e-16
WP_087826440.1|2161400_2161886_-|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	45.6	5.4e-26
WP_087826439.1|2161981_2162773_-|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	47.2	2.1e-51
WP_087826438.1|2162824_2163880_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	52.6	2.8e-99
WP_087826437.1|2163892_2164738_-|capsid	phage capsid protein	capsid	F1BUR1	Erwinia_phage	34.4	1.5e-26
WP_087826436.1|2164884_2166603_+	oxidoreductase	NA	A0A0M4S6K7	Salmonella_phage	62.5	8.8e-196
WP_162676050.1|2166623_2167640_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	59.7	9.7e-110
WP_087826434.1|2168129_2169902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087826433.1|2170366_2173030_-	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	49.4	8.4e-254
WP_087826432.1|2173108_2173330_-	hypothetical protein	NA	A0A0F7LDI3	Escherichia_phage	47.9	3.2e-10
WP_087826431.1|2173322_2173544_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_087826430.1|2173738_2173924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087826429.1|2173927_2174221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087826427.1|2174441_2174720_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	56.4	2.5e-23
WP_087826451.1|2174823_2175123_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	74.7	6.7e-35
WP_087826426.1|2175189_2176170_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	61.4	2.8e-114
WP_004239444.1|2176297_2177278_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_032098299.1|2177435_2178812_-	murein DD-endopeptidase MepM	NA	A0A2D0ZM66	Rhodococcus_phage	37.9	1.9e-15
WP_087826425.1|2178834_2179749_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_087826424.1|2179825_2180635_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.3	6.5e-16
2179940:2179959	attR	AACGGCGCGGGAAAATCCAC	NA	NA	NA	NA
WP_036414719.1|2180627_2181413_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_087826423.1|2181476_2182229_-	GMP synthase	NA	NA	NA	NA	NA
WP_004237292.1|2182428_2183439_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.3	6.9e-07
WP_004239448.1|2183476_2184091_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_004237294.1|2184190_2184715_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	31.5	3.7e-12
WP_004237295.1|2184793_2185537_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_036407874.1|2185588_2186041_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_015422679.1|2186046_2187816_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	25.7	2.4e-07
WP_004239452.1|2188073_2188472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004237299.1|2188556_2189321_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_087826422.1|2189313_2190288_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_087826421.1|2190414_2192601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004237303.1|2192656_2193409_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_070578672.1|2193570_2194125_-	VOC family protein	NA	NA	NA	NA	NA
WP_004239458.1|2194293_2196024_+|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	34.8	4.1e-84
>prophage 8
NZ_CP048275	Morganella morganii strain N18-00103 chromosome, complete genome	3942451	2302296	2341828	3942451	integrase,portal,head,tail,capsid,terminase,holin,protease	Morganella_phage(87.76%)	52	2303366:2303381	2344689:2344704
WP_087826449.1|2302296_2302815_-	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	93.5	1.3e-81
2303366:2303381	attL	GGGACTGTGGTGGCAA	NA	NA	NA	NA
WP_036414557.1|2303989_2304676_-	hypothetical protein	NA	A0A1W6JNU1	Morganella_phage	100.0	2.4e-136
WP_087826393.1|2304672_2304993_-	hypothetical protein	NA	A0A1W6JNW9	Morganella_phage	97.2	1.7e-60
WP_162676025.1|2304994_2308171_-	host specificity protein J	NA	A0A1W6JNZ7	Morganella_phage	94.8	0.0e+00
WP_064483752.1|2308203_2308806_-|tail	tail assembly protein	tail	A0A1W6JNY8	Morganella_phage	91.5	5.4e-100
WP_064483751.1|2308837_2309539_-	peptidase P60	NA	A0A1W6JP31	Morganella_phage	95.2	1.7e-134
WP_162676026.1|2309541_2310300_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	96.0	4.1e-145
WP_162676027.1|2310296_2310632_-|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	94.6	2.0e-59
WP_162676028.1|2310628_2313889_-|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	94.9	0.0e+00
WP_025154454.1|2313914_2314199_-	DUF4035 domain-containing protein	NA	A0A1W6JP68	Morganella_phage	88.2	3.6e-38
WP_036409321.1|2314210_2314594_-|tail	phage tail protein	tail	A0A1W6JP08	Morganella_phage	94.5	4.8e-62
WP_087826249.1|2314597_2315065_-|tail	phage tail protein	tail	A0A1W6JP06	Morganella_phage	92.3	6.5e-77
WP_162676029.1|2315124_2315460_-	hypothetical protein	NA	A0A1W6JP05	Morganella_phage	93.7	1.6e-56
WP_162676030.1|2315456_2315906_-	HK97 gp10 family phage protein	NA	A0A1W6JP15	Morganella_phage	95.3	3.5e-72
WP_087826132.1|2315898_2316225_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	83.3	1.2e-45
WP_024474653.1|2316235_2316529_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	39.8	8.1e-09
WP_087826133.1|2316570_2317782_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	61.6	3.7e-140
WP_087826134.1|2317791_2318439_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	77.1	1.1e-93
WP_162676031.1|2318431_2319652_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	74.3	2.0e-178
WP_025154461.1|2319651_2319831_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	60.7	9.9e-10
WP_087825456.1|2319840_2321571_-|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	92.4	0.0e+00
WP_015422813.1|2321574_2322045_-|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	90.4	4.5e-78
WP_087825457.1|2322191_2322545_-	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	95.7	1.5e-62
WP_087825458.1|2322589_2322970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087825460.1|2323518_2323896_-	DUF2570 domain-containing protein	NA	A0A1W6JNV2	Morganella_phage	87.2	1.2e-52
WP_087825461.1|2324032_2324509_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	67.9	2.7e-54
WP_087825462.1|2324501_2324693_-|holin	holin	holin	A0A1W6JNY9	Morganella_phage	96.8	1.6e-29
WP_036414512.1|2325174_2325381_-	hypothetical protein	NA	A0A1W6JNU4	Morganella_phage	100.0	1.3e-32
WP_087825463.1|2325549_2325702_-	MbeCy	NA	A0A1W6JNZ9	Morganella_phage	100.0	8.9e-20
WP_036414510.1|2326307_2326742_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_036414508.1|2327010_2327940_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	99.6	5.7e-149
WP_046024440.1|2328165_2328378_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	98.6	5.8e-33
WP_046024441.1|2328752_2329190_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	97.9	1.9e-78
WP_080750192.1|2329479_2330118_-	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	100.0	1.1e-106
WP_036414499.1|2330394_2330823_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	100.0	9.8e-72
WP_046024444.1|2331463_2331907_-	NinB protein	NA	A0A1W6JNZ4	Morganella_phage	100.0	1.1e-81
WP_052927416.1|2332155_2332884_-	ATP-binding protein	NA	A0A1W6JP39	Morganella_phage	99.6	1.0e-132
WP_049240430.1|2332883_2333675_-	replication protein	NA	A0A1W6JNY0	Morganella_phage	99.6	7.5e-134
WP_036414494.1|2333816_2334143_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	100.0	1.8e-54
WP_036414492.1|2334273_2334483_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW6	Morganella_phage	97.8	4.8e-16
WP_036414490.1|2334582_2335230_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNY2	Morganella_phage	100.0	4.0e-117
WP_036414488.1|2335268_2335610_+	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	100.0	1.6e-61
WP_036414486.1|2335761_2335959_-	DUF2767 family protein	NA	A0A1W6JNW1	Morganella_phage	100.0	8.0e-29
WP_036415812.1|2336355_2336664_+	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	100.0	1.3e-49
WP_004240099.1|2336692_2336902_-	hypothetical protein	NA	A0A1W6JP23	Morganella_phage	100.0	5.9e-30
WP_049240425.1|2337247_2337529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087769856.1|2337656_2338205_+	hypothetical protein	NA	A0A1W6JNZ6	Morganella_phage	99.2	1.2e-69
WP_004240098.1|2338411_2338588_+	hypothetical protein	NA	A0A1W6JNY7	Morganella_phage	100.0	6.3e-25
WP_087825465.1|2338745_2339108_+	hypothetical protein	NA	A0A1W6JNZ2	Morganella_phage	86.7	3.7e-56
WP_087825466.1|2339110_2339725_+	ERF family protein	NA	A0A1W6JP21	Morganella_phage	98.5	2.9e-109
WP_087825467.1|2339725_2340127_+	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	98.5	7.8e-71
WP_087825468.1|2340664_2341828_+|integrase	site-specific integrase	integrase	A0A220NQU7	Salmonella_phage	69.8	1.9e-154
2344689:2344704	attR	TTGCCACCACAGTCCC	NA	NA	NA	NA
>prophage 9
NZ_CP048275	Morganella morganii strain N18-00103 chromosome, complete genome	3942451	2718552	2728395	3942451	protease,tRNA	Bacillus_phage(16.67%)	8	NA	NA
WP_087825774.1|2718552_2720322_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.6	2.2e-24
WP_049243174.1|2720324_2722091_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.9	5.8e-17
WP_004241750.1|2722068_2722788_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211347.1|2722938_2723157_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_087825880.1|2723233_2725519_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.6	1.3e-173
WP_015422570.1|2725552_2725873_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.7	2.6e-16
WP_004235798.1|2726131_2726362_+	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	56.7	2.6e-15
WP_087825776.1|2726448_2728395_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-37
>prophage 10
NZ_CP048275	Morganella morganii strain N18-00103 chromosome, complete genome	3942451	2911950	2920004	3942451	tRNA	Mycobacterium_phage(33.33%)	8	NA	NA
WP_004235583.1|2911950_2912160_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	4.5e-22
WP_087825860.1|2912359_2912827_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_032099103.1|2913008_2914091_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_004235580.1|2914399_2914618_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	51.4	2.3e-16
WP_004240863.1|2914639_2915056_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	40.4	8.5e-12
WP_004235574.1|2915086_2917207_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	52.6	3.6e-207
WP_004235573.1|2917231_2918194_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	73.4	2.2e-135
WP_004235572.1|2918798_2920004_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.5	5.5e-27
>prophage 11
NZ_CP048275	Morganella morganii strain N18-00103 chromosome, complete genome	3942451	3552465	3575323	3942451	integrase,transposase	Salmonella_phage(28.57%)	27	3550919:3550933	3574304:3574318
3550919:3550933	attL	AGTAAGTTGGCAGCA	NA	NA	NA	NA
WP_001138064.1|3552465_3555432_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|3555434_3555995_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|3556120_3556471_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|3556673_3557687_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|3557831_3558329_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|3558440_3558731_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|3558736_3559528_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|3559691_3560039_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|3560032_3560872_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376616.1|3560999_3561203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|3561358_3562564_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|3562574_3562880_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|3563106_3563871_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|3564363_3564948_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|3564947_3566186_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|3566182_3567088_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|3567209_3567914_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|3568079_3568940_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|3568952_3569495_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|3569976_3570168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|3570191_3570419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|3570469_3571606_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_014342212.1|3571572_3571722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000971921.1|3571720_3573091_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_014342213.1|3573232_3573358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|3573911_3574772_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
3574304:3574318	attR	TGCTGCCAACTTACT	NA	NA	NA	NA
WP_001387387.1|3574921_3575323_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
