The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048304	Escherichia coli strain 9 chromosome, complete genome	4959978	1271115	1312068	4959978	protease,transposase	Stx2-converting_phage(27.27%)	28	NA	NA
WP_000997995.1|1271115_1272654_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
WP_000624646.1|1273781_1274132_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
WP_000435655.1|1274128_1274554_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
WP_085949591.1|1274925_1275063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001149834.1|1275214_1276132_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000629094.1|1276165_1277041_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000376547.1|1277089_1278562_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_000948500.1|1278565_1279396_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001296386.1|1279441_1280152_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_000865295.1|1280164_1281274_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001030790.1|1281335_1282259_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001282578.1|1282294_1283029_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000274668.1|1283128_1284115_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
WP_103103189.1|1284266_1285494_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
WP_001223344.1|1285994_1288085_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001305021.1|1288916_1289189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001529396.1|1289479_1289848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|1289851_1290067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032212789.1|1293944_1294799_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	1.2e-68
WP_001254932.1|1294847_1295999_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001034083.1|1296595_1300483_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_000973516.1|1301426_1303628_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_001576313.1|1303709_1304987_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015715.1|1304983_1306726_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287500.1|1306725_1307673_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001296374.1|1307673_1309398_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000074472.1|1309533_1310727_+	MFS transporter	NA	NA	NA	NA	NA
WP_103103190.1|1310839_1312068_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.2e-170
>prophage 2
NZ_CP048304	Escherichia coli strain 9 chromosome, complete genome	4959978	1584835	1591975	4959978		Escherichia_phage(83.33%)	6	NA	NA
WP_001279001.1|1584835_1585474_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
WP_000590418.1|1585470_1586733_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847998.1|1586729_1587638_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	5.1e-118
WP_001272544.1|1587803_1588601_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	5.0e-69
WP_001141289.1|1588651_1589308_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	45.2	2.8e-49
WP_000103863.1|1589413_1591975_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 3
NZ_CP048304	Escherichia coli strain 9 chromosome, complete genome	4959978	1922913	1935864	4959978	integrase	Escherichia_phage(83.33%)	6	1917874:1917887	1925012:1925025
1917874:1917887	attL	GCGTATTTATTTTA	NA	NA	NA	NA
WP_001224626.1|1922913_1923483_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	7.0e-49
WP_001181152.1|1924230_1924860_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	99.0	1.6e-118
WP_000243056.1|1925177_1925798_+	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	99.0	5.9e-118
1925012:1925025	attR	TAAAATAAATACGC	NA	NA	NA	NA
WP_001617156.1|1925822_1933766_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	99.3	0.0e+00
WP_000100043.1|1933813_1934344_+	OmpH family outer membrane protein	NA	A0A2L1IV11	Escherichia_phage	99.4	5.1e-86
WP_000368121.1|1934931_1935864_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	4.6e-167
>prophage 4
NZ_CP048304	Escherichia coli strain 9 chromosome, complete genome	4959978	2183949	2193394	4959978		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569381.1|2183949_2184876_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783150.1|2184880_2185612_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|2185592_2185700_-	protein YohO	NA	NA	NA	NA	NA
WP_001240404.1|2185759_2186491_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001295431.1|2186712_2188398_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|2188394_2189114_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|2189160_2189631_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|2189671_2190133_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001327380.1|2190257_2192261_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.1	0.0e+00
WP_001305166.1|2192257_2193394_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	3.8e-163
>prophage 5
NZ_CP048304	Escherichia coli strain 9 chromosome, complete genome	4959978	3248416	3350214	4959978	protease,terminase,holin,portal,tail,capsid,tRNA,integrase,head,lysis	Enterobacteria_phage(46.9%)	139	3250610:3250623	3294012:3294025
WP_000654167.1|3248416_3248695_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
WP_000290543.1|3248691_3250752_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
3250610:3250623	attL	CGTCCGGCTTCATC	NA	NA	NA	NA
WP_000515327.1|3250810_3254293_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_000090917.1|3254353_3254986_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000140699.1|3254922_3255666_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_001152660.1|3255671_3256370_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000847405.1|3256369_3256699_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_000840269.1|3256695_3259257_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.5	0.0e+00
WP_000459474.1|3259249_3259684_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.0	9.0e-57
WP_000479129.1|3259665_3260088_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_001351266.1|3260103_3260844_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_000683101.1|3260851_3261247_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	5.5e-69
WP_000975062.1|3261243_3261822_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_001204540.1|3261833_3262187_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000201530.1|3262179_3262554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522648.1|3262605_3263634_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	5.9e-115
WP_021528532.1|3263691_3264039_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	4.4e-22
WP_021527086.1|3264075_3265581_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	1.0e-99
WP_000831761.1|3265570_3267163_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_000258997.1|3267159_3267366_-|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001335577.1|3267349_3269278_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	2.5e-260
WP_000867568.1|3269249_3269798_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000881610.1|3270360_3270543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|3270749_3271076_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_033551444.1|3271556_3271850_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|3271940_3272123_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135277.1|3272339_3272837_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839596.1|3272836_3273052_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|3273640_3274723_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204776.1|3274911_3275295_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000971053.1|3275380_3275521_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001099712.1|3275517_3275880_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000950951.1|3275899_3276094_-	protein ninF	NA	NA	NA	NA	NA
WP_000386643.1|3276086_3276428_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001254243.1|3276430_3276607_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000153286.1|3276603_3277131_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_000736913.1|3277127_3277568_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145927.1|3277641_3277932_-	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000788872.1|3277928_3278630_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000185431.1|3278626_3279526_-	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000442609.1|3279558_3279855_-	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000067727.1|3279996_3280212_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|3280287_3280983_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001062368.1|3281022_3281580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968518.1|3281576_3282329_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000438342.1|3282605_3282788_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000088199.1|3282765_3283038_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_001066176.1|3283054_3283636_-	superinfection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.2	5.2e-92
WP_000213979.1|3283849_3284050_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_000065374.1|3284232_3284601_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198860.1|3284673_3284838_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372923.1|3284806_3284950_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_000995434.1|3285025_3285322_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000100847.1|3285327_3286113_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186790.1|3286109_3286790_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	5.1e-131
WP_000149544.1|3286786_3286969_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|3286941_3287133_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001360114.1|3287143_3287425_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763378.1|3287523_3287745_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.3	8.4e-35
WP_001289890.1|3287741_3288506_+	ead/Ea22-like family protein	NA	K7PKG8	Enterobacteria_phage	94.8	3.6e-56
WP_001518554.1|3288507_3288762_+	hypothetical protein	NA	A5LH60	Enterobacteria_phage	91.1	1.7e-34
WP_001327280.1|3288779_3289313_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	82.1	2.5e-64
WP_000951713.1|3289314_3289524_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.2	1.3e-32
WP_000208010.1|3289520_3290261_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	67.1	6.5e-47
WP_001304460.1|3290253_3290538_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	89.4	4.0e-45
WP_000490215.1|3290563_3290803_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	93.7	8.8e-38
WP_000088653.1|3290942_3291179_+	excisionase	NA	NA	NA	NA	NA
WP_000741334.1|3291168_3292311_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	99.7	1.1e-205
WP_000444487.1|3292424_3293675_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_021566796.1|3293846_3294500_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3294012:3294025	attR	GATGAAGCCGGACG	NA	NA	NA	NA
WP_000476093.1|3294509_3294971_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001443105.1|3295024_3296131_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001295971.1|3296166_3296808_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|3296811_3298182_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265481.1|3298351_3299023_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000734671.1|3299022_3300483_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|3300558_3301680_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3301728_3302955_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3303204_3304341_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799413.1|3304324_3305188_+	spermidine/putrescine ABC transporter permease PotB	NA	NA	NA	NA	NA
WP_000937496.1|3305419_3305686_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.3	2.3e-18
WP_000742376.1|3305754_3306411_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_071586406.1|3306465_3306564_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_000355700.1|3306603_3306897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204582.1|3306906_3307185_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	1.0e-21
WP_021566795.1|3307181_3309245_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	62.5	1.1e-147
WP_001228261.1|3309396_3309996_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.5	4.4e-102
WP_000514735.1|3310063_3313756_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.8	0.0e+00
WP_072258937.1|3314099_3314732_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	92.3	1.7e-96
WP_001576728.1|3314677_3315421_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.4	8.3e-143
WP_001327694.1|3315426_3316125_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	7.6e-130
WP_000847298.1|3316124_3316454_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082402.1|3316450_3319012_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	90.0	0.0e+00
WP_000533402.1|3318992_3319406_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001299690.1|3319432_3319864_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000235037.1|3319882_3320629_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	8.7e-124
WP_000683079.1|3320636_3321032_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974995.1|3321028_3321562_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.1	1.2e-55
WP_001204571.1|3321577_3321931_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.1e-41
WP_000201498.1|3321923_3322307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522583.1|3322358_3323387_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	8.6e-114
WP_000256835.1|3323444_3323792_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
WP_001253953.1|3323828_3325334_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	2.7e-100
WP_001537684.1|3325323_3326916_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	2.9e-185
WP_000258993.1|3326912_3327119_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_021566794.1|3327102_3329031_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.0e-261
WP_000235436.1|3329002_3329512_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000881610.1|3330081_3330264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|3330470_3330797_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_032142285.1|3331107_3331575_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
WP_001280932.1|3331577_3331709_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_001446668.1|3331723_3331906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092866.1|3332062_3332596_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_001037014.1|3332632_3333523_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.9	2.1e-108
WP_000284506.1|3333527_3333743_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001538590.1|3333819_3334065_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	92.6	8.8e-17
WP_023143432.1|3334102_3334285_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	85.0	5.1e-22
WP_001550966.1|3334421_3336383_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.1	5.6e-239
WP_001336019.1|3336643_3336979_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.7	1.4e-44
WP_000562553.1|3337259_3337391_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_001545909.1|3338286_3339108_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.8e-77
WP_000139998.1|3339122_3339485_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	9.6e-36
WP_001550965.1|3339485_3340544_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	1.7e-88
WP_023141427.1|3340545_3340818_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_000813254.1|3340985_3341141_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_011076332.1|3341399_3341618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001550964.1|3342231_3342414_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	2.4e-27
WP_000761441.1|3342507_3342921_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	2.0e-58
WP_001151150.1|3342921_3343344_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|3343384_3344455_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693850.1|3344526_3344952_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|3344935_3345178_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001420344.1|3345569_3345908_+	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_000379575.1|3346200_3346356_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171946.1|3346515_3346734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517906.1|3346698_3346902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|3347302_3347491_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070259.1|3347487_3347679_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|3347772_3350214_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
>prophage 6
NZ_CP048304	Escherichia coli strain 9 chromosome, complete genome	4959978	3583693	3648764	4959978	protease,transposase,tRNA	Pseudomonas_phage(22.22%)	56	NA	NA
WP_001241667.1|3583693_3584398_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3584682_3584901_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001304477.1|3585407_3586235_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000772027.1|3586319_3586517_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001054232.1|3586536_3587025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854739.1|3587021_3587402_-	toxin	NA	NA	NA	NA	NA
WP_001285481.1|3587448_3587823_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_001617449.1|3587872_3588517_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.0	3.0e-24
WP_000692312.1|3588535_3588757_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_001186170.1|3588819_3589296_-	RadC family protein	NA	NA	NA	NA	NA
WP_001313575.1|3589311_3589785_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.2	4.3e-12
WP_001234710.1|3590047_3590869_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.7	2.2e-43
WP_000902034.1|3590969_3591203_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000581502.1|3591281_3591737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021533825.1|3591812_3594329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038356109.1|3594449_3597575_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069772.1|3597899_3598772_-	GTPase family protein	NA	NA	NA	NA	NA
WP_001304575.1|3600443_3600803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997076.1|3601741_3602284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000516335.1|3602319_3603456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001327488.1|3604406_3605606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977398.1|3605869_3606661_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001445605.1|3606679_3608650_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011076310.1|3611177_3611540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000526115.1|3612720_3613179_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
WP_000805228.1|3613356_3613656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001221122.1|3614193_3615309_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_106408132.1|3615322_3619108_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	29.8	3.7e-45
WP_000933673.1|3619211_3620441_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_000271272.1|3620525_3621482_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_001222189.1|3621526_3623704_-	siderophore salmochelin receptor IroN	NA	NA	NA	NA	NA
WP_063611012.1|3623933_3624971_+|transposase	IS630-like element ISEc40 family transposase	transposase	NA	NA	NA	NA
WP_128888113.1|3625296_3625797_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000012016.1|3625994_3626735_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_085949152.1|3627785_3629058_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_000767894.1|3629335_3629839_-	F1C fimbria minor subunit FocG	NA	NA	NA	NA	NA
WP_000237770.1|3629860_3630388_-	S/F1C fimbrial adhesin minor pilin SfaG/FocF	NA	NA	NA	NA	NA
WP_001443207.1|3630400_3633031_-	S/F1C fimbrial biogenesis usher protein SfaF/FocD	NA	NA	NA	NA	NA
WP_000975445.1|3633100_3633796_-	sfa/F1C fimbrial biogenesis chaperone	NA	NA	NA	NA	NA
WP_011076308.1|3633836_3634361_-	S/F1C fimbrial minor subunit SfaD	NA	NA	NA	NA	NA
WP_000768217.1|3634446_3634989_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000046975.1|3635360_3635690_-	S/F1C fimbrial major subunit operon transcriptional regulator	NA	NA	NA	NA	NA
WP_011076307.1|3636045_3636330_+	S/F1C fimbrial major subunit operon transcriptional regulator	NA	NA	NA	NA	NA
WP_001443206.1|3636604_3637174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167423.1|3637415_3637928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001528902.1|3638385_3638844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000426105.1|3638943_3639630_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001318125.1|3639804_3640083_-	microcin McmA	NA	NA	NA	NA	NA
WP_001183592.1|3640336_3642451_-	microcin export transporter peptidase/ATP-binding subunit MchF	NA	F2Y165	Organic_Lake_phycodnavirus	24.4	4.2e-14
WP_001327747.1|3642425_3643667_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000120459.1|3643852_3644305_-	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_000019322.1|3644330_3645881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001375214.1|3646152_3646380_-	microcin H47	NA	NA	NA	NA	NA
WP_000120662.1|3646396_3646606_-	microcin H47 immunity protein MchI	NA	NA	NA	NA	NA
WP_000165817.1|3647614_3647839_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878259.1|3647909_3648764_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	40.5	2.8e-49
>prophage 7
NZ_CP048304	Escherichia coli strain 9 chromosome, complete genome	4959978	4780660	4840599	4959978	integrase,transposase	Enterobacteria_phage(22.22%)	47	4839160:4839174	4841469:4841483
WP_021515317.1|4780660_4782046_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	1.3e-258
WP_000823243.1|4782284_4783643_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555341.1|4784393_4784651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|4785568_4786090_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|4786086_4787040_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188248.1|4787126_4789451_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879153.1|4789495_4790398_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125175.1|4790394_4791393_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|4791389_4792346_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4792346_4793114_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|4793671_4793929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160371899.1|4795393_4796236_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001388979.1|4796238_4797327_+	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_001387303.1|4797331_4798282_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_021566757.1|4798346_4799291_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_016245226.1|4799471_4800611_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
WP_001293435.1|4800764_4802762_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000625669.1|4802824_4804102_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000145474.1|4804347_4805004_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001422798.1|4805184_4805313_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_001387298.1|4806411_4806510_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_162655261.1|4806511_4807294_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|4807599_4808520_+	ribokinase	NA	NA	NA	NA	NA
WP_000998353.1|4808547_4809864_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107474.1|4809875_4810889_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_001327567.1|4811310_4811565_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
WP_000345347.1|4811811_4813068_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000705930.1|4813080_4813368_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_042092416.1|4813383_4813827_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000416151.1|4814097_4815129_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	1.4e-18
WP_001215044.1|4817098_4817263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000859648.1|4817374_4818064_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_001351184.1|4818063_4819620_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001114712.1|4819785_4820610_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000729465.1|4821520_4822150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104341.1|4822200_4823277_-	Fic family protein	NA	NA	NA	NA	NA
WP_001099275.1|4823906_4824203_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085949152.1|4824796_4826069_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_068879494.1|4826414_4827083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063611012.1|4827066_4828104_-|transposase	IS630-like element ISEc40 family transposase	transposase	NA	NA	NA	NA
WP_125079971.1|4828113_4828638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000643690.1|4828910_4830107_+	DNA cytosine methyltransferase	NA	A0A191SAU1	Nostoc_phage	30.8	2.2e-36
WP_000886597.1|4833161_4834985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000202281.1|4835229_4836102_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001143292.1|4836469_4836763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223819.1|4838063_4839683_+	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
4839160:4839174	attL	CACAACAGCGGCCCG	NA	NA	NA	NA
WP_000142493.1|4839672_4840599_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000142493.1|4839672_4840599_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4841469:4841483	attR	CGGGCCGCTGTTGTG	NA	NA	NA	NA
>prophage 1
NZ_CP048305	Escherichia coli strain 9 plasmid p009_A, complete sequence	159959	100725	119973	159959	integrase,transposase	Salmonella_phage(33.33%)	17	99784:99798	107393:107407
99784:99798	attL	GTCAGCGAACGTGCT	NA	NA	NA	NA
WP_000427619.1|100725_101730_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|101808_104781_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|104783_105341_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_002075255.1|105646_106660_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_013263789.1|106826_107627_+	subclass B1 metallo-beta-lactamase VIM-1	NA	NA	NA	NA	NA
107393:107407	attR	GTCAGCGAACGTGCT	NA	NA	NA	NA
WP_013263788.1|107720_108179_+	aminoglycoside N-acetyltransferase AAC(6')-Il	NA	NA	NA	NA	NA
WP_000777555.1|108321_108795_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
WP_032491400.1|109677_109995_+	multidrug efflux SMR transporter Smr	NA	NA	NA	NA	NA
WP_032492010.1|110273_111317_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000679427.1|111539_111887_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|111880_112720_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|113124_114666_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012579084.1|114929_115586_+	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
WP_004193231.1|115771_116647_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025999322.1|116650_117016_-	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_000376623.1|118201_118702_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|119208_119973_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 1
NZ_CP048306	Escherichia coli strain 9 plasmid p009_B, complete sequence	110182	0	109861	110182	tail,tRNA,portal,terminase,integrase	Salmonella_phage(83.93%)	123	1455:1474	110061:110080
1455:1474	attL	GTATGCTGCCAGCGGTAATT	NA	NA	NA	NA
WP_059244869.1|1674_1887_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	2.6e-33
WP_000644408.1|1886_2222_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	6.6e-39
WP_001265407.1|2437_2713_-	hypothetical protein	NA	J9Q738	Salmonella_phage	75.8	4.0e-34
WP_059277879.1|2768_3194_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	76.1	1.0e-60
WP_053904505.1|3257_3647_-	hypothetical protein	NA	K7PJK0	Enterobacteria_phage	85.7	1.1e-58
WP_059277878.1|3667_4408_-	hypothetical protein	NA	G4KK93	Yersinia_phage	32.2	7.5e-27
WP_052904267.1|4453_5278_-	hypothetical protein	NA	A0A0U4IID7	Pseudomonas_phage	25.3	5.4e-18
WP_000715581.1|5373_6204_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
WP_048959223.1|6207_6408_-	membrane protein	NA	J9Q6J0	Salmonella_phage	60.6	1.9e-09
WP_162655276.1|6500_7529_-	recombinase	NA	J9Q736	Salmonella_phage	93.9	9.0e-188
WP_053900130.1|7576_7843_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	79.5	4.7e-32
WP_053900129.1|7842_8787_-	exonuclease	NA	J9Q7S6	Salmonella_phage	88.5	3.5e-162
WP_059277874.1|8847_9870_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	83.8	1.0e-138
WP_048959212.1|9987_10419_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	86.0	2.6e-64
WP_162655270.1|10544_14063_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	94.4	0.0e+00
WP_048959206.1|14243_15479_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	81.0	8.8e-198
WP_162655271.1|15574_17683_-	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	66.3	8.2e-228
WP_029305696.1|17781_17994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282577.1|18245_18632_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_048959201.1|18626_19730_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
WP_000156433.1|19941_20187_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	4.5e-13
WP_101917689.1|20361_21624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059277870.1|23610_23901_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	78.1	2.6e-36
WP_012640723.1|24046_24262_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.1	2.2e-19
WP_016607331.1|24245_24425_-	hypothetical protein	NA	J9Q729	Salmonella_phage	70.7	8.4e-17
WP_000733193.1|24421_25744_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	91.4	5.3e-241
WP_021533203.1|25740_25998_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	57.8	1.9e-14
WP_059277869.1|26279_27056_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	41.1	1.4e-52
WP_021533205.1|27131_28247_-	hypothetical protein	NA	J9Q720	Salmonella_phage	93.2	6.5e-208
WP_049076695.1|28394_29735_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.5	2.6e-235
WP_001717320.1|29778_30519_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.6	2.2e-127
WP_072249143.1|30699_31110_-	hypothetical protein	NA	J9Q6F2	Salmonella_phage	44.1	3.3e-24
WP_059277867.1|31102_31843_-	hypothetical protein	NA	J9Q719	Salmonella_phage	46.2	1.8e-17
WP_160378290.1|31876_32230_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_059277866.1|32235_32904_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	92.3	2.6e-111
WP_059277865.1|33080_33833_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	30.3	8.4e-18
WP_000931258.1|33817_34201_-	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	47.1	8.4e-14
WP_032203358.1|34529_34781_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	79.5	2.5e-27
WP_059277864.1|34782_35475_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	93.9	1.8e-123
WP_001717323.1|35488_35812_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	89.7	5.9e-45
WP_032328862.1|36134_36743_-	hypothetical protein	NA	J9Q7G0	Salmonella_phage	73.8	4.5e-78
WP_048959172.1|36742_36997_-	hypothetical protein	NA	J9Q7R5	Salmonella_phage	69.0	7.9e-29
WP_077791784.1|37087_39253_-|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	52.6	4.8e-66
WP_059277730.1|40707_45432_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	74.8	0.0e+00
WP_059277731.1|45449_46043_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	91.9	3.7e-101
WP_000526939.1|46030_46828_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	93.6	1.3e-154
WP_000511445.1|46820_47519_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	96.6	1.5e-133
WP_053900116.1|47601_47937_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	1.8e-52
WP_101917700.1|47979_52545_-	tape measure protein	NA	J9Q712	Salmonella_phage	82.3	0.0e+00
WP_000952686.1|52552_52777_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.6	8.8e-32
WP_059277733.1|52902_53220_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	95.2	1.1e-48
WP_059277734.1|53275_54022_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	91.9	4.0e-121
WP_059277735.1|54096_54480_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	81.9	8.0e-57
WP_000523628.1|54481_54955_-	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
WP_059277736.1|54945_55290_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	94.7	1.1e-54
WP_000057118.1|55369_56203_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.1	1.3e-141
WP_000801187.1|56202_56637_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	82.6	1.1e-59
WP_059277737.1|56681_57602_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	83.6	1.4e-131
WP_053904528.1|57675_58551_-	hypothetical protein	NA	J9Q710	Salmonella_phage	94.5	5.0e-155
WP_001055285.1|58576_59464_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	89.3	7.1e-133
WP_001717193.1|59485_61060_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	93.1	2.2e-286
WP_001007299.1|61086_62343_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.4	7.5e-245
WP_059277738.1|62342_62975_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	84.3	4.8e-91
WP_000176292.1|63171_63438_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_000129633.1|63447_64338_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.6	2.6e-167
WP_059277739.1|64334_65000_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	2.4e-109
WP_000161986.1|64996_65665_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
WP_000382660.1|65664_66345_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	88.1	2.7e-108
WP_059277740.1|66427_67987_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.5	1.1e-277
WP_001291061.1|67989_68268_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	58.2	4.6e-22
WP_059277741.1|68300_68900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053886743.1|69045_69534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053886744.1|69549_70149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049076843.1|70145_70670_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	79.7	1.2e-66
WP_029305755.1|70965_71616_+	hypothetical protein	NA	J9Q754	Salmonella_phage	84.7	1.1e-98
WP_000255469.1|71665_71869_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	91.0	5.9e-27
WP_059277742.1|71889_72117_+	hypothetical protein	NA	A0A1S6KV93	Providencia_phage	41.3	2.5e-05
WP_059277743.1|72734_73217_-	hypothetical protein	NA	J9Q805	Salmonella_phage	66.0	1.2e-57
WP_059277744.1|73422_74121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059277745.1|74235_74631_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	53.8	1.6e-31
WP_000749407.1|74757_75069_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	5.7e-29
WP_162655272.1|75223_75553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001405018.1|77126_77348_-	hypothetical protein	NA	J9Q750	Salmonella_phage	52.2	8.7e-16
WP_072249128.1|77609_78305_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	67.6	2.7e-79
WP_001755492.1|78457_80491_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
WP_000004356.1|80648_81749_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_000506720.1|81786_82176_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	93.0	8.6e-67
WP_032203392.1|82348_82873_-	toprim domain-containing protein	NA	A0A2D2W4T4	Escherichia_phage	48.5	3.8e-33
WP_072249129.1|82886_83741_-	hypothetical protein	NA	A0A0F6TJ66	Escherichia_coli_O157_typing_phage	94.8	1.5e-23
WP_059277747.1|83737_83944_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.5	6.3e-08
WP_162655273.1|83936_84545_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	96.8	2.7e-51
WP_059277748.1|84546_84969_-	hypothetical protein	NA	A0A076GCP4	Escherichia_phage	62.9	1.1e-27
WP_021547926.1|84968_85154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059277749.1|85150_85696_-	ead/Ea22-like family protein	NA	A0A222YWM9	Escherichia_phage	59.5	2.7e-42
WP_032203388.1|85692_86148_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	58.2	1.3e-18
WP_059277750.1|86147_86690_-	hypothetical protein	NA	J9Q748	Salmonella_phage	87.4	2.5e-88
WP_059277751.1|86686_87328_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	87.3	8.3e-99
WP_059277752.1|87447_87828_-	hypothetical protein	NA	J9Q801	Salmonella_phage	69.8	2.7e-28
WP_059277753.1|87827_88532_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	75.9	1.6e-87
WP_162655274.1|88593_90279_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	92.0	0.0e+00
WP_059277754.1|90420_90987_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	65.2	1.6e-58
WP_072249130.1|91126_91285_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_025670506.1|91284_91710_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	79.4	3.4e-56
WP_014962274.1|91803_91992_-	hypothetical protein	NA	J9Q800	Salmonella_phage	51.6	9.4e-11
WP_072249131.1|92001_92496_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	51.2	4.5e-28
WP_162655275.1|92644_93289_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	78.9	8.6e-96
WP_048959260.1|93817_94048_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	86.8	5.3e-32
WP_052904282.1|94233_94827_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	3.8e-98
WP_059277756.1|95009_95819_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.6	3.1e-66
WP_021520508.1|95979_96537_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	83.6	3.3e-88
WP_001755506.1|96546_96966_-	hypothetical protein	NA	J9Q743	Salmonella_phage	70.5	2.1e-50
WP_000386470.1|97027_97672_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	81.8	4.6e-97
WP_160378288.1|97671_98142_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	90.4	2.8e-80
WP_021512290.1|98144_98558_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	86.9	5.6e-64
WP_059277757.1|98559_99663_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	87.2	1.7e-192
WP_021512292.1|99834_100704_-	hypothetical protein	NA	J9Q742	Salmonella_phage	81.0	2.4e-133
WP_000122502.1|100781_101924_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
WP_059277758.1|102029_104345_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.2	0.0e+00
WP_059277759.1|104418_104988_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.2	9.6e-91
WP_059277760.1|104997_105741_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	47.4	8.8e-52
WP_137647971.1|105730_107647_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	73.2	3.8e-248
WP_000174804.1|107876_108962_-	exonuclease	NA	J9Q7S9	Salmonella_phage	87.3	6.8e-186
WP_000364573.1|109216_109861_-	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
110061:110080	attR	GTATGCTGCCAGCGGTAATT	NA	NA	NA	NA
