The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048310	Escherichia coli strain 32-4 chromosome, complete genome	4853092	1128685	1135825	4853092		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1128685_1129324_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001521147.1|1129320_1130583_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847993.1|1130579_1131488_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_001272546.1|1131653_1132451_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	4.5e-70
WP_001141345.1|1132501_1133158_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001272917.1|1133263_1135825_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
>prophage 2
NZ_CP048310	Escherichia coli strain 32-4 chromosome, complete genome	4853092	1864072	1870501	4853092		Enterobacteria_phage(33.33%)	6	NA	NA
WP_029487813.1|1864072_1865479_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	1.1e-37
WP_029487815.1|1865702_1866767_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.1	1.2e-102
WP_023297950.1|1866793_1867663_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_029487820.1|1867694_1868585_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.9	1.8e-27
WP_023297948.1|1868599_1869154_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	5.0e-52
WP_029487822.1|1869334_1870501_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	9.1e-112
>prophage 3
NZ_CP048310	Escherichia coli strain 32-4 chromosome, complete genome	4853092	2779877	2833007	4853092	terminase,tail,holin,head,protease,integrase,portal,transposase,tRNA,capsid	Escherichia_phage(43.18%)	62	2788069:2788083	2833109:2833123
WP_001297484.1|2779877_2780984_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2781019_2781661_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|2781664_2783035_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265471.1|2783203_2783875_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2783874_2785335_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|2785410_2786532_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359434.1|2786580_2787807_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2788056_2789193_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2788069:2788083	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_162676377.1|2789176_2790040_+	spermidine/putrescine ABC transporter permease PotB	NA	NA	NA	NA	NA
WP_000241001.1|2790594_2791263_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_085948620.1|2791389_2792602_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_001233546.1|2795993_2796593_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_000515345.1|2796660_2800140_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_000090843.1|2800200_2800809_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_001333568.1|2800745_2801489_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_001152457.1|2801494_2802193_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001330090.1|2802192_2802549_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224003.1|2802526_2805754_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_077253127.1|2805800_2806061_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
WP_001324129.1|2806102_2806489_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_162676378.1|2806488_2807193_-|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	92.3	5.5e-112
WP_001206700.1|2807253_2807598_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000968644.1|2807594_2808044_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|2808040_2808379_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719064.1|2808387_2808705_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_000766109.1|2808781_2809999_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000999828.1|2810013_2810613_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923134.1|2810605_2811832_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_001140892.1|2811979_2813737_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|2813736_2814219_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001135104.1|2814366_2814717_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_000738421.1|2815242_2815536_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|2815626_2815809_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992097.1|2816025_2816559_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_000193264.1|2816622_2816973_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|2816977_2817193_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_001333561.1|2817342_2817504_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
WP_000874243.1|2817500_2817689_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333560.1|2817949_2818285_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_001333559.1|2818355_2818568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106104550.1|2819056_2819143_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000762879.1|2819537_2820359_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_000139999.1|2820355_2820736_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_001221526.1|2820736_2821795_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_032155008.1|2821796_2822075_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001013636.1|2822242_2822455_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_011076332.1|2822657_2822876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224662.1|2823489_2823672_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000761441.1|2823765_2824179_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	2.0e-58
WP_001151150.1|2824179_2824602_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|2824642_2825713_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693850.1|2825784_2826210_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|2826193_2826436_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001420344.1|2826827_2827166_+	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_001092153.1|2827597_2827798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|2827890_2828109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517906.1|2828073_2828277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2828677_2828866_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|2828862_2829054_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|2829147_2831589_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_000003742.1|2831650_2831920_+	excisionase	NA	NA	NA	NA	NA
WP_000074971.1|2831888_2833007_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
2833109:2833123	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 4
NZ_CP048310	Escherichia coli strain 32-4 chromosome, complete genome	4853092	2999752	3127803	4853092	terminase,tail,holin,lysis,head,protease,integrase,plate,portal,transposase,tRNA,capsid	Escherichia_phage(36.07%)	117	3011691:3011711	3114534:3114554
WP_000152888.1|2999752_3001513_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227927.1|3001581_3002100_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000828648.1|3002169_3002337_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759120.1|3002592_3003156_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000445533.1|3003152_3004793_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333176.1|3004797_3006051_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053099.1|3006180_3008088_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
WP_001086539.1|3008099_3010208_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000212422.1|3010451_3011561_+	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_001295353.1|3011557_3012100_-	cell division protein ZapC	NA	NA	NA	NA	NA
3011691:3011711	attL	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
WP_001295352.1|3012273_3013284_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001111465.1|3013394_3014132_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000919497.1|3014097_3014613_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000730614.1|3014620_3015163_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001165668.1|3015174_3016245_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000286312.1|3016235_3018836_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001295349.1|3018860_3019562_-	molecular chaperone	NA	NA	NA	NA	NA
WP_000750293.1|3019644_3020184_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001263933.1|3020539_3021115_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_001244308.1|3021107_3022067_+	aliphatic sulfonate ABC transporter substrate-binding protein SsuA	NA	NA	NA	NA	NA
WP_000056006.1|3022063_3023209_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_000235203.1|3023219_3024011_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_001090506.1|3024007_3024775_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193841.1|3024817_3027430_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001307697.1|3027695_3028898_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|3029066_3030467_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|3031069_3032158_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|3032342_3033533_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109486.1|3033754_3034402_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|3034428_3034977_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925985.1|3035157_3037005_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572633.1|3037265_3041726_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001295347.1|3041725_3042430_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288850.1|3042410_3043733_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001298300.1|3043729_3044515_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|3044650_3045430_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436932.1|3045406_3046300_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011620.1|3046453_3047200_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|3047196_3047379_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056538.1|3047430_3048663_-	winged helix DNA-binding protein YcaQ	NA	NA	NA	NA	NA
WP_000570539.1|3048699_3049686_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|3049682_3051431_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705764.1|3051467_3053732_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3053939_3054224_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3054383_3056057_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|3056167_3056851_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001295345.1|3057023_3057788_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000445231.1|3057956_3059240_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057138.1|3059310_3060399_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000642849.1|3060597_3061290_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_047149115.1|3061419_3063180_+	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_000642546.1|3063585_3064443_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|3064497_3066780_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000468308.1|3067098_3067317_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882940.1|3067398_3068562_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000978889.1|3068561_3069041_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_162676400.1|3069055_3071473_-|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	96.3	0.0e+00
WP_096058015.1|3071483_3072757_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.3e-177
WP_000785970.1|3072831_3072951_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|3072983_3073259_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|3073315_3073834_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_049066944.1|3073846_3075037_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	6.2e-225
WP_049066942.1|3075096_3075690_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	3.0e-103
WP_108084477.1|3075720_3076227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086707776.1|3076229_3076646_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.8	1.2e-21
WP_032330348.1|3076617_3077211_-|tail	tail fiber assembly protein	tail	K7PMC4	Enterobacterial_phage	50.8	4.9e-53
WP_108084468.1|3077210_3078494_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	64.5	2.0e-160
WP_048236796.1|3078490_3079102_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.0	1.1e-116
WP_048236794.1|3079094_3080003_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	2.2e-161
WP_000127163.1|3080007_3080355_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_049066887.1|3080351_3080987_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	6.5e-112
WP_001001784.1|3081053_3081506_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	2.4e-76
WP_049066890.1|3081498_3081966_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	1.9e-81
WP_001440152.1|3081928_3082102_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_049066892.1|3082073_3082499_-|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	97.2	5.5e-67
WP_001712252.1|3082486_3082912_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	96.5	8.6e-60
WP_001144101.1|3082926_3083424_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|3083423_3083705_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846414.1|3083708_3083912_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	2.6e-30
WP_000988633.1|3083911_3084421_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_029397143.1|3084520_3085264_-|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	97.6	7.3e-123
WP_016237184.1|3085267_3086341_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.7	5.1e-202
WP_001085948.1|3086399_3087254_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_000156851.1|3087427_3089200_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_000038161.1|3089199_3090234_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_016242008.1|3090568_3092383_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_016242007.1|3092369_3093617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049066900.1|3093819_3095940_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	96.0	0.0e+00
WP_001565038.1|3095929_3096205_-	DUF5405 family protein	NA	Q858T5	Yersinia_virus	98.9	6.6e-45
WP_049066902.1|3096201_3096426_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	98.6	8.5e-35
WP_021540633.1|3096425_3096728_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	97.0	2.5e-45
WP_000557703.1|3096727_3096952_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217679.1|3097015_3097516_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_001389237.1|3097693_3098050_-	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
WP_001389238.1|3098158_3098458_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
WP_000023391.1|3098551_3099547_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000067977.1|3099578_3100376_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_001190363.1|3100457_3101048_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_001242684.1|3101147_3102056_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000918506.1|3102056_3103487_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109259.1|3103696_3104845_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165879.1|3105158_3105785_+	hydrolase	NA	NA	NA	NA	NA
WP_000534637.1|3105819_3106683_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213098.1|3106684_3107302_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850303.1|3107312_3109757_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|3109995_3111288_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3111378_3112722_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3112732_3113344_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077038.1|3113502_3117492_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
3114534:3114554	attR	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
WP_000228473.1|3117626_3118121_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3118665_3119631_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043592.1|3119753_3121520_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	1.8e-23
WP_001202175.1|3121520_3123242_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001241678.1|3123283_3123988_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3124272_3124491_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3125175_3127452_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3127482_3127803_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 5
NZ_CP048310	Escherichia coli strain 32-4 chromosome, complete genome	4853092	3755039	3828484	4853092	terminase,tail,holin,head,integrase,portal,transposase,lysis,capsid	Enterobacteria_phage(29.51%)	89	3767495:3767542	3813949:3813996
WP_000246955.1|3755039_3756359_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	44.2	2.4e-36
WP_000909177.1|3756358_3757036_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
WP_000420671.1|3757029_3757491_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	71.5	2.9e-61
WP_001244111.1|3758253_3761010_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.2	5.2e-299
WP_001208877.1|3760996_3761368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628966.1|3761360_3761702_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_042091166.1|3761712_3762315_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	35.7	5.7e-25
WP_000181940.1|3762307_3762529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024679.1|3762525_3762789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065661.1|3762785_3762980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000958749.1|3762972_3764040_-	ash family protein	NA	NA	NA	NA	NA
WP_000476150.1|3764033_3764216_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_042091168.1|3764208_3765042_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	46.7	2.6e-20
WP_000412531.1|3765054_3765486_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	2.3e-28
WP_000035054.1|3765485_3765689_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_000772643.1|3766116_3767331_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
3767495:3767542	attL	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001619161.1|3768289_3769135_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	38.0	5.0e-35
WP_060581740.1|3769127_3769526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957441.1|3769525_3770191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060581741.1|3771121_3773011_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_108084473.1|3773263_3773770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032316.1|3773772_3774183_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.3	2.2e-20
WP_001619155.1|3774163_3774397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233083.1|3777457_3778057_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.0	6.3e-109
WP_162676384.1|3778127_3781625_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.4	0.0e+00
WP_000090917.1|3781685_3782318_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_045154394.1|3782254_3782998_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.3e-148
WP_162676385.1|3783003_3783702_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	8.6e-134
WP_000847379.1|3783701_3784031_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_021548553.1|3784027_3786607_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	86.7	0.0e+00
WP_000459458.1|3786599_3787034_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_021548554.1|3787015_3787438_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	86.4	5.9e-61
WP_021548555.1|3787453_3788194_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	94.3	7.8e-125
WP_021548556.1|3788201_3788597_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	5.0e-70
WP_001518407.1|3788593_3789172_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_029395143.1|3789183_3789537_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
WP_001468354.1|3789548_3789944_-	DNA packaging FI family protein	NA	A0A2R9YJP4	Escherichia_phage	93.9	3.1e-56
WP_029395141.1|3789985_3791011_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	2.9e-186
WP_012304872.1|3791066_3791399_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	96.4	4.6e-53
WP_029395138.1|3791408_3792728_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.2e-232
WP_057077926.1|3792708_3794310_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	5.5e-309
WP_000198149.1|3794306_3794513_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027321.1|3794509_3796435_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453587.1|3796409_3796955_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001663509.1|3797343_3797577_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079508.1|3797633_3798044_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|3798394_3798547_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001446997.1|3798534_3798972_-|lysis	lysis protein	lysis	Q716B4	Shigella_phage	95.9	3.0e-68
WP_060581801.1|3798968_3799445_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	1.9e-84
WP_001120496.1|3799448_3799775_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_000907077.1|3800175_3800925_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_125282403.1|3800940_3801285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000069422.1|3801288_3801903_+	hypothetical protein	NA	A0A2D1GNI4	Pseudomonas_phage	36.4	9.9e-33
WP_001205456.1|3801928_3802273_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	89.4	7.2e-57
WP_001433852.1|3802291_3803281_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	1.9e-195
WP_060581690.1|3803288_3804086_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.9	9.8e-150
WP_000767113.1|3804105_3804495_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210164.1|3804491_3804818_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_060581688.1|3804814_3805468_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.1	2.8e-126
WP_072199996.1|3805467_3805962_-	PerC family transcriptional regulator	NA	S5FUZ7	Shigella_phage	99.4	4.7e-86
WP_000104977.1|3805958_3806900_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	2.2e-140
WP_001250269.1|3806889_3807069_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001434539.1|3807244_3807796_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_000205494.1|3807833_3808034_-	cell division protein	NA	NA	NA	NA	NA
WP_000450735.1|3808131_3808758_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000559916.1|3808985_3809501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|3809971_3810334_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_057077927.1|3810399_3811224_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
WP_000008200.1|3811351_3811888_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|3811878_3812241_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206734.1|3812240_3812546_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	2.6e-50
WP_000433939.1|3812545_3812896_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_057077906.1|3812772_3813936_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	7.0e-229
WP_000893278.1|3814140_3815394_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3813949:3813996	attR	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3815405_3816509_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749867.1|3816796_3817852_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	1.6e-118
WP_000174677.1|3817890_3818292_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189532.1|3818349_3819594_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3819685_3820144_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|3820404_3821862_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001326471.1|3821918_3822455_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001295202.1|3822387_3822654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059892.1|3822959_3823412_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263489.1|3823421_3823820_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554758.1|3823822_3824116_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|3824167_3825223_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207552.1|3825293_3826079_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001334802.1|3826023_3827763_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|3827986_3828484_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP048310	Escherichia coli strain 32-4 chromosome, complete genome	4853092	3836742	3909586	4853092	protease,transposase,plate,tRNA	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
WP_000420818.1|3836742_3837879_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001101839.1|3838309_3838702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000508724.1|3838679_3842912_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_032329316.1|3842987_3845129_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|3845338_3845857_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|3846551_3847052_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3847086_3847311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|3847361_3848837_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|3848843_3849257_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_162676386.1|3849260_3851111_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3851074_3852157_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113709.1|3852181_3853462_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3853458_3853983_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246443.1|3853985_3855317_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343289.1|3855321_3856083_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614325.1|3856091_3858857_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000088852.1|3858853_3859597_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240525.1|3859601_3861014_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122545204.1|3861122_3864557_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087741.1|3864567_3865920_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|3865943_3866426_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908066.1|3866469_3867384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236653.1|3867393_3867873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086141.1|3868009_3868795_-	lipoprotein	NA	NA	NA	NA	NA
WP_001340895.1|3869331_3870063_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_000917883.1|3870127_3870595_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_162676387.1|3870591_3871314_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|3871347_3872103_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3872174_3873533_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000016007.1|3873580_3874204_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001230983.1|3874207_3875008_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|3875248_3876163_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|3876159_3876963_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140187.1|3882723_3883299_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594006.1|3883486_3884518_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001294600.1|3884510_3885164_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_162676388.1|3885203_3886019_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|3886136_3886541_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|3886537_3887245_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|3887356_3889075_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001336393.1|3889128_3889953_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239163.1|3890152_3890863_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635537.1|3890876_3891299_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|3891295_3891841_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3892006_3892207_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|3892193_3892454_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176549.1|3892502_3893801_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901099.1|3893865_3894255_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|3894311_3896453_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|3896551_3897511_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|3897523_3901006_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|3901042_3901639_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139654.1|3901635_3902784_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|3902783_3903572_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3903575_3904031_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|3904135_3905161_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|3905164_3905650_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|3905771_3908204_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|3908233_3909586_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 7
NZ_CP048310	Escherichia coli strain 32-4 chromosome, complete genome	4853092	4187381	4220712	4853092	transposase	Stx2-converting_phage(25.0%)	28	NA	NA
WP_000654804.1|4187381_4188350_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.0e-185
WP_162676401.1|4188393_4189209_+	YjhT family mutarotase	NA	NA	NA	NA	NA
WP_000991431.1|4189273_4190254_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	56.3	1.6e-101
WP_001327357.1|4190261_4190384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333468.1|4191429_4191810_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612637.1|4191806_4192154_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	6.3e-61
WP_000998013.1|4192203_4193589_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	1.9e-257
WP_000823241.1|4193827_4195186_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555341.1|4195936_4196194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|4197944_4198466_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068915.1|4198462_4199416_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188246.1|4199502_4201827_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879153.1|4201871_4202774_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125175.1|4202770_4203769_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|4203765_4204722_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4204722_4205490_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|4206047_4206305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160371899.1|4207769_4208612_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_162676392.1|4208614_4209703_+	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_001333383.1|4209707_4210658_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_000088357.1|4212623_4213763_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
WP_001293435.1|4213916_4215914_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000625669.1|4215976_4217254_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000878218.1|4217533_4218400_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|4218396_4218696_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000145481.1|4218762_4218981_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049828170.1|4219031_4219421_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.9e-61
WP_085948620.1|4219499_4220712_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
>prophage 1
NZ_CP048311	Escherichia coli strain 32-4 plasmid p32-4_A, complete sequence	170395	1796	63462	170395	protease,integrase,transposase	Escherichia_phage(27.27%)	50	NA	NA
WP_000616807.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|2542_2800_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|2732_3134_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_024210412.1|5157_6639_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_013362817.1|7167_7617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013362818.1|8246_8984_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
WP_013362819.1|9109_9205_-	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_110498949.1|10161_11076_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_158192044.1|13327_14023_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.8e-131
WP_049802299.1|14904_15168_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|15160_15547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|15554_16241_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|16218_16842_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|16923_18129_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000428546.1|18241_18835_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_162676402.1|20966_21149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883563.1|21330_21603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|21730_22570_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|22563_22911_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|23116_23905_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|24035_24509_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000845048.1|24666_25680_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_122997045.1|25648_26173_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000239590.1|28189_29065_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|29111_29444_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000449408.1|38484_38643_+	copper-sensitivity suppressor C	NA	NA	NA	NA	NA
WP_000949452.1|38632_39139_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_012372823.1|39321_40137_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000118029.1|40483_42370_+	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_000178050.1|42410_42938_+	iron transporter	NA	NA	NA	NA	NA
WP_162676403.1|43041_44409_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000964653.1|44411_45695_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000729219.1|45684_46815_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000117262.1|46819_47515_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_001267176.1|47501_47987_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000874189.1|48011_48497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021546935.1|49782_50787_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000734115.1|51226_51979_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000090196.1|52220_53093_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000872613.1|53223_54447_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032152933.1|54632_55406_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001194013.1|55471_56173_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_000039982.1|56238_57345_-	alkene reductase	NA	NA	NA	NA	NA
WP_002431133.1|57558_57888_+	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	34.7	1.3e-10
WP_000888080.1|57917_58256_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_162676404.1|58260_58842_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000108589.1|58983_59541_-	OsmC family protein	NA	NA	NA	NA	NA
WP_162676405.1|60302_60962_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.4e-125
WP_162676406.1|60986_61361_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	98.2	2.7e-57
WP_000255956.1|62439_63462_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
