The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048337	Escherichia coli strain 142 chromosome, complete genome	5073188	852729	858281	5073188	transposase	Stx2-converting_phage(42.86%)	9	NA	NA
WP_015674870.1|852729_853173_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	35.2	1.2e-19
WP_016231182.1|853392_853614_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	47.9	8.5e-11
WP_001186774.1|853676_854153_-	RadC family protein	NA	NA	NA	NA	NA
WP_000849596.1|854168_854654_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_023909039.1|854708_855527_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.9	2.0e-44
WP_001119719.1|855626_855860_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_016231180.1|855945_856350_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	8.7e-70
WP_000612617.1|856346_856694_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	7.5e-62
WP_001554465.1|856742_858281_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.2	5.0e-291
>prophage 2
NZ_CP048337	Escherichia coli strain 142 chromosome, complete genome	5073188	1811361	1820803	5073188		Enterobacteria_phage(85.71%)	10	NA	NA
WP_022645872.1|1811361_1812288_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.2e-23
WP_022645871.1|1812292_1813024_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1813004_1813112_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1813171_1813903_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001334139.1|1814124_1815810_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
WP_012311742.1|1815806_1816526_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1816572_1817043_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1817083_1817545_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_022645869.1|1817669_1819670_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001329822.1|1819666_1820803_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
>prophage 3
NZ_CP048337	Escherichia coli strain 142 chromosome, complete genome	5073188	2398490	2467464	5073188	integrase,lysis,tail,protease,terminase,portal	Enterobacteria_phage(41.51%)	82	2406066:2406082	2436807:2436823
WP_001260849.1|2398490_2399312_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2399411_2399495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743943.1|2399587_2399923_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2400319_2401573_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2401679_2402573_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225257.1|2402707_2403928_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|2404052_2404748_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071586384.1|2404700_2405993_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2406066:2406082	attL	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_021516105.1|2406151_2406766_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	6.6e-29
WP_000526500.1|2406808_2407663_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2407664_2408282_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_072146081.1|2408292_2410716_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	2.2e-208
WP_022645727.1|2410776_2413203_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
WP_001295396.1|2413401_2413707_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_033864672.1|2413814_2414525_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2414527_2415088_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2415122_2415464_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001304355.1|2415598_2415925_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
WP_001295394.1|2416130_2417345_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836037.1|2417356_2418376_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001389342.1|2418433_2418562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876976.1|2418563_2419844_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
WP_001296941.1|2419878_2420115_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_024946566.1|2420202_2422674_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_001090200.1|2422766_2422958_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2422954_2423143_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000159335.1|2423645_2423846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001320327.1|2423814_2424180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379591.1|2424191_2424344_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001003381.1|2424536_2424944_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|2425021_2425249_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|2425232_2425754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054505.1|2425734_2426700_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	2.9e-55
WP_001151189.1|2426740_2427142_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_022645725.1|2427341_2428364_+	hypothetical protein	NA	Q858S2	Enterobacteria_phage	62.4	2.5e-105
WP_001546200.1|2429226_2429334_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_000887491.1|2429378_2429591_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000980999.1|2429807_2430059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032140164.1|2430125_2430404_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_097337534.1|2430405_2431455_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	7.2e-108
WP_000904111.1|2431467_2431824_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_000762886.1|2431838_2432660_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.1e-78
WP_000562553.1|2433555_2433687_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_022645723.1|2434053_2434482_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|2434653_2435028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839562.1|2435279_2435495_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_000196128.1|2435499_2435811_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	1.5e-24
WP_001092966.1|2435807_2436341_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_001071776.1|2436337_2436835_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
2436807:2436823	attR	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_000066495.1|2437197_2437410_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071526745.1|2437420_2437609_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|2437744_2437900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|2438072_2438246_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|2438541_2438748_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_000373425.1|2439300_2439795_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_162646415.1|2439794_2441897_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.0	0.0e+00
WP_001072975.1|2441893_2442106_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985958.1|2442105_2443614_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	6.6e-288
WP_001136588.1|2443558_2445586_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097050.1|2445671_2445995_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|2445987_2446263_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677123.1|2446274_2446865_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	1.6e-80
WP_001079398.1|2446861_2447263_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_022645720.1|2447273_2448017_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.4	7.3e-131
WP_001370402.1|2448077_2448464_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
WP_001161009.1|2448472_2448802_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_162646416.1|2448773_2451839_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.5	0.0e+00
WP_000447253.1|2451838_2452168_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152382.1|2452177_2452876_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.3e-134
WP_024946565.1|2452881_2453625_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	9.2e-150
WP_023277304.1|2453522_2454170_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	4.7e-110
WP_162646417.1|2454230_2457710_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_001228249.1|2457777_2458377_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	1.5e-102
WP_032141276.1|2458441_2460814_+|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	47.5	4.1e-103
WP_001546830.1|2460810_2461089_+	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	54.3	3.8e-24
WP_162646418.1|2461099_2462140_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	80.8	1.6e-155
WP_001546828.1|2462182_2462476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086527.1|2462703_2463294_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2463610_2463844_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2463912_2464026_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347484.1|2464630_2465914_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527788.1|2466003_2467464_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	6.6e-43
>prophage 4
NZ_CP048337	Escherichia coli strain 142 chromosome, complete genome	5073188	2723343	2789933	5073188	integrase,holin,tail,lysis,protease,terminase,capsid,head,transposase,portal	Enterobacteria_phage(36.54%)	76	2740688:2740715	2790070:2790097
WP_000422059.1|2723343_2724393_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559277.1|2724612_2725371_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_001278893.1|2725367_2725958_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001000715.1|2726014_2726323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077266175.1|2726332_2727319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001291217.1|2727524_2728400_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_022645614.1|2728610_2730500_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2730527_2731148_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285663.1|2731144_2732026_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2732163_2732208_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_022645613.1|2732299_2733862_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763524.1|2733861_2735457_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001195273.1|2735460_2736819_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_022645612.1|2736830_2738024_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_022645611.1|2738023_2738830_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2739220_2739400_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2739485_2739986_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_071586393.1|2740031_2740109_+	DUF892 family protein	NA	NA	NA	NA	NA
2740688:2740715	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_000937483.1|2741310_2741580_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000240999.1|2741636_2742305_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885578.1|2742359_2742944_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	5.0e-103
WP_000216487.1|2742943_2745970_-	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	54.5	7.0e-55
WP_001228314.1|2746121_2746721_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_023909008.1|2746788_2750262_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
WP_122997661.1|2750605_2751238_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	94.3	1.5e-100
WP_000194723.1|2751183_2751927_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_001335877.1|2751937_2752636_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000847298.1|2752635_2752965_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_023909007.1|2752961_2755535_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.3	0.0e+00
WP_000533402.1|2755515_2755929_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479095.1|2755955_2756387_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000235110.1|2756400_2757153_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683079.1|2757160_2757556_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_001575631.1|2757552_2758128_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	1.1e-49
WP_001204553.1|2758142_2758496_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201501.1|2758488_2758872_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522601.1|2758923_2759952_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.1e-113
WP_000256835.1|2760009_2760357_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
WP_023909006.1|2760393_2761899_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.3	3.6e-100
WP_000831818.1|2761888_2763481_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
WP_000259002.1|2763477_2763684_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000622379.1|2763667_2765596_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	9.7e-260
WP_000867575.1|2765567_2766116_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_023909270.1|2766526_2767594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000654790.1|2767535_2768156_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	53.7	5.1e-53
WP_024946561.1|2768572_2769031_-|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	92.8	7.5e-70
WP_023909004.1|2769027_2769561_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.3	2.5e-101
WP_023909003.1|2769616_2769931_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	98.1	3.1e-51
WP_000284510.1|2769935_2770151_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_023909002.1|2770300_2772154_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	89.2	0.0e+00
WP_000871291.1|2772414_2772750_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000562553.1|2773030_2773162_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000935536.1|2773963_2775013_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
WP_000917767.1|2775163_2775361_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_023909112.1|2775574_2776264_-	antiterminator	NA	I6PDF8	Cronobacter_phage	46.4	1.8e-54
WP_000904174.1|2776260_2776620_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	3.9e-37
WP_162646425.1|2776619_2777681_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	52.9	1.1e-103
WP_032151993.1|2777682_2777961_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_000967408.1|2778127_2778340_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_011076332.1|2778542_2778761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948316.1|2778992_2780265_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_001224662.1|2780710_2780893_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000761441.1|2780986_2781400_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	2.0e-58
WP_001468623.1|2781400_2781823_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	3.3e-64
WP_000095673.1|2781863_2782826_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	1.6e-69
WP_000693906.1|2782848_2783274_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|2783257_2783581_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|2783705_2784182_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001725971.1|2784500_2784653_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.1e-06
WP_016237926.1|2784664_2785039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122991287.1|2785024_2785171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2785571_2785760_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2785756_2785948_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_023909115.1|2786040_2788512_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	2.3e-56
WP_000113189.1|2788576_2788825_+	excisionase	NA	NA	NA	NA	NA
WP_000113696.1|2788802_2789933_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.7	2.0e-103
2790070:2790097	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 5
NZ_CP048337	Escherichia coli strain 142 chromosome, complete genome	5073188	3194457	3283826	5073188	integrase,tail,lysis,protease,terminase,tRNA,plate,capsid,head,portal	Salmonella_phage(60.71%)	90	3249522:3249548	3283901:3283927
WP_000886683.1|3194457_3195750_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067771.1|3195840_3197184_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.0	7.3e-81
WP_001295343.1|3197194_3197806_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_162646428.1|3197964_3201996_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3202130_3202625_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|3203168_3204134_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043590.1|3204256_3206023_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202192.1|3206023_3207745_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
WP_022645453.1|3207786_3208491_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3208775_3208994_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3209741_3212018_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3212048_3212369_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3212691_3212916_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_022645444.1|3212988_3214935_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	6.5e-38
WP_000746460.1|3214931_3216047_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001400542.1|3216197_3217154_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599806.1|3217150_3218809_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_000488716.1|3219234_3219930_+	aquaporin Z	NA	NA	NA	NA	NA
WP_022645441.1|3220387_3221287_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_022645440.1|3221429_3223082_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178691.1|3223093_3224062_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815366.1|3224194_3225913_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	6.8e-31
WP_000566375.1|3225949_3226951_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_022645439.1|3226961_3228392_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001305933.1|3228490_3229504_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255167.1|3229500_3230331_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160731.1|3230327_3230651_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_022645438.1|3230861_3232631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001270657.1|3233278_3233794_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3234011_3234740_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756575.1|3234757_3235489_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001702.1|3235495_3236212_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464489.1|3236211_3236880_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3237105_3237837_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149713.1|3237865_3238993_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|3239033_3239522_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|3239581_3240427_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105436.1|3240423_3241377_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996007.1|3241386_3242520_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126075.1|3242614_3243727_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3244077_3244554_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3244641_3245544_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_024946543.1|3245604_3246327_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_022645436.1|3246310_3246598_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195231.1|3246757_3247015_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_000681108.1|3247044_3247422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|3247691_3249377_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3249522:3249548	attL	GTGGGTTTTTTGTTGCCTGAAATTTAT	NA	NA	NA	NA
WP_000972391.1|3249612_3249831_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_022645435.1|3249921_3251022_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.2	1.0e-176
WP_022645434.1|3251018_3251504_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	79.4	1.6e-65
WP_022645433.1|3251500_3254578_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.3	0.0e+00
WP_000763311.1|3254570_3254690_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_022645432.1|3254704_3255007_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	3.5e-39
WP_001207660.1|3255061_3255577_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046146.1|3255586_3256759_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
WP_022645431.1|3256892_3257495_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	84.4	3.7e-93
WP_022645430.1|3257494_3259036_-|tail	phage tail collar protein	tail	M1TAS6	Escherichia_phage	71.2	7.6e-199
WP_022645429.1|3259032_3259638_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.2e-110
WP_162646429.1|3259630_3260539_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	3.0e-142
WP_000177597.1|3260525_3260885_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_000993764.1|3260881_3261460_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	7.2e-94
WP_022645427.1|3261563_3262370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021522006.1|3262311_3262758_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.2	4.0e-60
WP_001595569.1|3262750_3263182_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	9.9e-72
WP_022645426.1|3263277_3263706_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	1.9e-46
WP_022645425.1|3263702_3264080_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	8.8e-16
WP_022645424.1|3264081_3264594_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.1	2.0e-87
WP_000171568.1|3264574_3264790_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3264793_3264997_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673523.1|3264996_3265461_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_021534472.1|3265556_3266207_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	9.6e-111
WP_000742503.1|3266210_3267269_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	8.4e-181
WP_022645423.1|3267285_3268119_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_022645422.1|3268261_3270028_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_022645421.1|3270027_3271062_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	85.5	2.3e-167
WP_022645420.1|3271098_3272880_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_022645419.1|3273413_3274472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217562.1|3274646_3274880_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_001154434.1|3274890_3275079_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_022645418.1|3275232_3277647_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.6	0.0e+00
WP_000104157.1|3277643_3278501_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.2	4.1e-162
WP_001399246.1|3278497_3278725_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001244228.1|3278724_3278958_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_001311552.1|3279025_3279367_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956182.1|3279330_3279531_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_022645417.1|3279538_3280048_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|3280080_3280302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645416.1|3280397_3280994_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.9	1.4e-39
WP_022645415.1|3281014_3282691_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	66.8	9.8e-83
WP_001595551.1|3282773_3283826_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.8	4.8e-104
3283901:3283927	attR	GTGGGTTTTTTGTTGCCTGAAATTTAT	NA	NA	NA	NA
>prophage 6
NZ_CP048337	Escherichia coli strain 142 chromosome, complete genome	5073188	3899940	3965758	5073188	protease,plate,tRNA,transposase	Shigella_phage(11.11%)	56	NA	NA
WP_085949836.1|3899940_3901153_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_001142958.1|3901340_3901859_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037391.1|3902555_3903056_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_022645217.1|3903090_3903315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645216.1|3903365_3904841_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_022645215.1|3904847_3905261_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_022645214.1|3905264_3907115_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_022645213.1|3907078_3908161_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113710.1|3908185_3909466_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3909462_3909987_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_022645212.1|3909989_3911321_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_022645211.1|3911325_3912087_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_022645210.1|3912095_3914855_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.0	7.2e-83
WP_022645209.1|3914851_3915595_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_022645208.1|3915599_3917015_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122988716.1|3917123_3920558_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_022645206.1|3920568_3921921_+	type VI secretion system protein VasL	NA	NA	NA	NA	NA
WP_022645205.1|3921944_3922427_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_022645204.1|3922470_3923379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645203.1|3923393_3923861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645202.1|3924010_3924796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001308374.1|3925330_3926062_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000917883.1|3926126_3926594_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308373.1|3926590_3927313_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052732.1|3927346_3928102_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3928173_3929532_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211702.1|3929579_3930350_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|3930426_3931227_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648568.1|3931467_3932382_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022645201.1|3932378_3933182_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	2.7e-38
WP_001140178.1|3938944_3939517_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593991.1|3939704_3940736_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|3940728_3941382_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|3941421_3942237_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|3942354_3942759_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094006.1|3942755_3943463_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_022645200.1|3943573_3945292_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_022645199.1|3945344_3946169_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239184.1|3946324_3947035_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635528.1|3947048_3947471_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185283.1|3947467_3948013_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3948178_3948379_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062318.1|3948365_3948626_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_022645198.1|3948674_3949973_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|3950037_3950427_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020966.1|3950483_3952625_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055746.1|3952723_3953683_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|3953695_3957178_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_022645197.1|3957214_3957811_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_022645196.1|3957807_3958956_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|3958955_3959744_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3959747_3960203_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139282.1|3960307_3961333_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|3961336_3961822_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|3961943_3964376_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_022645195.1|3964405_3965758_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 7
NZ_CP048337	Escherichia coli strain 142 chromosome, complete genome	5073188	4148736	4241965	5073188	integrase,tail,lysis,protease,terminase,tRNA,transposase,portal	Enterobacteria_phage(40.0%)	98	4199051:4199066	4245644:4245659
WP_001300563.1|4148736_4149849_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001118476.1|4150111_4151242_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	37.1	1.4e-27
WP_000516135.1|4151330_4153247_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843565.1|4153623_4154028_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102367.1|4154053_4154767_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|4154915_4155482_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001295414.1|4155516_4156104_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130185.1|4156218_4157172_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001112563.1|4157450_4158881_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000906204.1|4158950_4159727_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_000738721.1|4159879_4160176_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000781074.1|4160389_4161676_-	threonine synthase	NA	NA	NA	NA	NA
WP_000241662.1|4161676_4162609_-	homoserine kinase	NA	NA	NA	NA	NA
WP_023908910.1|4162610_4165073_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_001386572.1|4165154_4165220_-	thr operon leader peptide	NA	NA	NA	NA	NA
WP_001223181.1|4165433_4166120_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|4166519_4166660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|4166755_4167472_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920337.1|4167531_4168884_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219614.1|4168941_4170366_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_001188663.1|4170365_4171055_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_000875487.1|4171067_4171541_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|4171751_4172621_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|4172617_4173265_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001341279.1|4173316_4173838_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068679.1|4173922_4174249_-	trp operon repressor	NA	NA	NA	NA	NA
WP_023908909.1|4174338_4176276_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|4176486_4178154_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093813.1|4178460_4179693_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_001029698.1|4179713_4181096_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132956.1|4181144_4182113_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124615.1|4182218_4182863_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105890.1|4182890_4183907_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000566155.1|4183938_4184202_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000224879.1|4184362_4185082_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|4185161_4186385_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477811.1|4186436_4187759_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_001295412.1|4187885_4188665_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143237.1|4188922_4190473_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088378.1|4190444_4191308_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563058.1|4191824_4192607_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001299799.1|4192603_4193677_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|4193798_4193960_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|4194086_4194692_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202564.1|4195084_4196671_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001217535.1|4196890_4197139_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	96.3	3.5e-37
WP_000389073.1|4197585_4198620_+	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	41.8	7.1e-76
WP_000954672.1|4198718_4199477_+	hypothetical protein	NA	NA	NA	NA	NA
4199051:4199066	attL	TGATAATGAATTTGAA	NA	NA	NA	NA
WP_001555785.1|4199780_4200074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001555784.1|4200116_4201157_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.6	2.4e-124
WP_000654148.1|4201166_4201448_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	51.1	2.4e-18
WP_021548541.1|4201447_4203820_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	70.4	1.8e-170
WP_021548540.1|4203880_4207294_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.6	0.0e+00
WP_011478365.1|4207354_4208002_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	4.0e-109
WP_032142951.1|4207899_4208643_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	4.5e-149
WP_001152386.1|4208647_4209346_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.0e-134
WP_000447253.1|4209355_4209685_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000372035.1|4209684_4212741_-|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	99.5	0.0e+00
WP_001161009.1|4212712_4213042_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001298500.1|4213050_4213437_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_000211119.1|4213497_4214241_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	1.4e-129
WP_001079398.1|4214251_4214653_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677123.1|4214649_4215240_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	1.6e-80
WP_001283153.1|4215251_4215527_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|4215519_4215843_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001360054.1|4215928_4217956_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_011478361.1|4217900_4219481_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_001072975.1|4219408_4219621_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934133.1|4219617_4221720_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
WP_000349501.1|4221719_4222211_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	86.6	6.6e-72
WP_001139675.1|4222886_4223039_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_001341210.1|4223026_4223494_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001135250.1|4223490_4223988_-	lysozyme	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|4223987_4224203_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799705.1|4224270_4225323_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.4	6.1e-208
WP_000917723.1|4225473_4225677_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	1.8e-31
WP_001033965.1|4225947_4226394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001577385.1|4226478_4226844_-	antitermination protein Q	NA	Q777W5	Enterobacteria_phage	81.8	7.9e-54
WP_001577384.1|4226861_4227851_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
WP_001061386.1|4227858_4228656_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.5	8.3e-149
WP_000767115.1|4228675_4229065_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	99.2	3.5e-68
WP_000210170.1|4229061_4229388_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000066917.1|4229384_4230038_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000061519.1|4230527_4231346_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_000620696.1|4231342_4231567_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_001087313.1|4231563_4232715_-	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	99.2	1.6e-214
WP_000526665.1|4232711_4233263_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	1.7e-100
WP_001191669.1|4233255_4233516_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001311077.1|4233613_4234306_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_000135680.1|4235028_4235391_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081290.1|4235456_4236281_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.0e-149
WP_000008232.1|4236408_4236945_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_001242727.1|4236935_4237298_+	hypothetical protein	NA	U5P092	Shigella_phage	95.8	1.7e-64
WP_000206713.1|4237297_4237654_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	74.1	7.7e-38
WP_001229296.1|4237655_4238021_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000628710.1|4238017_4238812_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	49.8	2.7e-59
WP_000653746.1|4239379_4240375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001218287.1|4240750_4241965_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.3	1.6e-236
4245644:4245659	attR	TTCAAATTCATTATCA	NA	NA	NA	NA
>prophage 8
NZ_CP048337	Escherichia coli strain 142 chromosome, complete genome	5073188	4594187	4649075	5073188	integrase,holin,tail,lysis,protease,terminase,tRNA,capsid,head,transposase,portal	Escherichia_phage(33.33%)	68	4594749:4594764	4616002:4616017
WP_000918363.1|4594187_4595603_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
4594749:4594764	attL	ACGGATTTTAGTCTGG	NA	NA	NA	NA
WP_022646433.1|4595685_4596669_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891408.1|4596834_4597077_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543825.1|4597210_4598248_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332260.1|4598336_4599434_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	4.0e-210
WP_001217539.1|4599495_4599744_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_022646432.1|4599854_4600142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595444.1|4600152_4600857_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	7.0e-59
WP_022646431.1|4600866_4601148_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_022646430.1|4601144_4603493_-|tail	phage tail fiber protein	tail	A0A0E3M0V5	Enterobacteria_phage	46.3	9.5e-92
WP_001228252.1|4603557_4604157_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_024946503.1|4604224_4607704_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
WP_000741576.1|4607764_4608412_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.6	2.7e-113
WP_032152077.1|4608309_4609053_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	4.4e-152
WP_021543563.1|4609057_4609756_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	98.3	1.8e-131
WP_023908869.1|4609755_4610097_-|tail	tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	66.4	7.9e-40
WP_024946502.1|4610089_4613332_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	88.8	0.0e+00
WP_021543566.1|4613377_4613719_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	64.5	7.6e-35
WP_021543567.1|4613777_4614056_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	80.4	1.5e-33
WP_021543568.1|4614079_4614451_-	hypothetical protein	NA	A0A1B5FP91	Escherichia_phage	90.2	3.1e-58
WP_023908871.1|4614465_4615170_-|tail	tail protein	tail	A0A1B5FP82	Escherichia_phage	90.6	1.8e-110
WP_021543570.1|4615229_4615574_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	94.7	1.9e-54
WP_021543571.1|4615570_4616020_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	78.5	1.3e-61
4616002:4616017	attR	CCAGACTAAAATCCGT	NA	NA	NA	NA
WP_021543572.1|4616016_4616355_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	84.8	4.6e-48
WP_021543573.1|4616364_4616670_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	87.1	3.9e-38
WP_023908872.1|4616681_4616870_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	93.5	8.8e-25
WP_023908873.1|4616919_4618125_-|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	99.0	1.7e-222
WP_001193633.1|4618139_4618790_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	7.3e-119
WP_023908874.1|4618767_4620009_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.0	2.9e-241
WP_000605605.1|4620008_4620191_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	3.8e-25
WP_065312442.1|4620202_4621699_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	1.7e-299
WP_000929184.1|4621932_4622427_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	100.0	2.3e-88
WP_024946501.1|4622553_4622904_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	1.2e-62
WP_000699783.1|4622969_4623173_-	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	52.9	4.9e-13
WP_021543580.1|4623290_4623665_-	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	96.0	1.8e-61
WP_023908876.1|4623703_4624147_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	94.6	2.3e-71
WP_021543581.1|4624143_4624620_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.3	6.2e-83
WP_024946499.1|4624623_4624959_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	93.7	2.5e-54
WP_001181554.1|4625088_4625292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023908878.1|4625484_4626237_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	97.2	4.2e-134
WP_024946498.1|4626250_4627240_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	6.2e-194
WP_023908880.1|4627247_4628057_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	99.6	8.2e-152
WP_000767133.1|4628076_4628466_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	1.6e-68
WP_000210154.1|4628462_4628789_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_000066917.1|4628785_4629439_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_023908881.1|4629438_4629927_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	93.2	8.6e-80
WP_023908882.1|4629923_4630865_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	92.3	3.2e-139
WP_071789194.1|4630854_4631034_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	4.6e-15
WP_024946496.1|4631209_4631767_-	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	93.5	1.0e-92
WP_021527487.1|4631810_4632011_-	phage transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.3e-31
WP_021530636.1|4632101_4632776_+	LexA family transcriptional regulator	NA	Q8SBF6	Shigella_phage	100.0	3.5e-132
WP_000135680.1|4633443_4633806_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_023908886.1|4633871_4634696_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	3.0e-149
WP_023908887.1|4634884_4635667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093916.1|4635703_4635985_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_014640052.1|4636245_4636632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077249875.1|4636661_4637207_-	SocA family protein	NA	NA	NA	NA	NA
WP_001300034.1|4637469_4637592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022646425.1|4637953_4638958_-	DUF2713 family protein	NA	NA	NA	NA	NA
WP_000416263.1|4639275_4639791_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001296638.1|4639832_4640042_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001134727.1|4640157_4641537_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646078.1|4641555_4642164_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002907.1|4642273_4642642_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017354.1|4642812_4645236_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455227.1|4645390_4646263_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_001308201.1|4646275_4646773_-	chorismate lyase	NA	NA	NA	NA	NA
WP_085948316.1|4647802_4649075_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
>prophage 9
NZ_CP048337	Escherichia coli strain 142 chromosome, complete genome	5073188	4666787	4683308	5073188	tail,plate	Burkholderia_phage(33.33%)	22	NA	NA
WP_000619864.1|4666787_4667135_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
WP_022646418.1|4667672_4667960_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.6	3.9e-16
WP_000266448.1|4667962_4668568_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.1	3.3e-57
WP_000777272.1|4668580_4668895_+	membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
WP_022646417.1|4669039_4669495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875310.1|4669491_4669689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022646416.1|4669678_4671103_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.2	7.0e-191
WP_000907502.1|4671102_4671627_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
WP_022646415.1|4671677_4671995_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_015674804.1|4671954_4672083_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_022646414.1|4672184_4674560_+	hypothetical protein	NA	A4JWL0	Burkholderia_virus	26.0	1.0e-56
WP_022646413.1|4674559_4675513_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	50.8	3.3e-35
WP_001269711.1|4675512_4675722_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	1.3e-16
WP_022646412.1|4675709_4676750_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.1	2.0e-73
WP_000679403.1|4676759_4677461_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	6.4e-12
WP_022646411.1|4677559_4677919_+	hypothetical protein	NA	Q6QIA0	Burkholderia_phage	64.2	1.1e-34
WP_022646410.1|4677909_4679025_+	hypothetical protein	NA	Q6QI99	Burkholderia_phage	51.7	2.0e-100
WP_022646409.1|4679017_4679734_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	3.1e-22
WP_022646408.1|4679736_4681347_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	39.1	3.8e-84
WP_022646407.1|4681343_4682051_+	DUF4376 domain-containing protein	NA	A0A0E3JQ06	Enterobacteria_phage	42.4	5.3e-14
WP_022646406.1|4682047_4682503_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	42.7	6.6e-26
WP_022646405.1|4682516_4683308_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	2.0e-46
>prophage 1
NZ_CP048338	Escherichia coli strain 142 plasmid p142_A-OXA181, complete sequence	155486	1262	64054	155486	transposase,protease,integrase	Escherichia_phage(50.0%)	58	NA	NA
WP_001066953.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_023141670.1|2123_2249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072355.1|3448_4618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105060.1|4813_5107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421272.1|5212_5488_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001387467.1|5487_5772_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000562172.1|6376_7129_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001022265.1|7174_8140_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_024946717.1|8172_8553_-	endoribonuclease	NA	NA	NA	NA	NA
WP_001077068.1|8577_9468_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_000796505.1|9700_9895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338039.1|10439_11318_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_001271561.1|11307_12195_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_000922702.1|12205_13030_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_000950177.1|13035_14109_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	2.6e-28
WP_000476108.1|14101_15412_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_162646445.1|17330_18032_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	97.4	1.0e-134
WP_000205718.1|21688_22435_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
WP_000139341.1|22489_23050_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_013023861.1|23180_23393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023144756.1|24263_24398_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001323403.1|24873_25653_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000255944.1|25652_26675_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_072258247.1|26755_26908_+	replication protein A	NA	NA	NA	NA	NA
WP_031943482.1|27144_27219_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130640.1|27211_28069_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|29008_29662_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|29754_30012_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|29944_30346_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_015060052.1|36482_37280_+	OXA-48 family carbapenem-hydrolyzing class D beta-lactamase OXA-181	NA	NA	NA	NA	NA
WP_064764860.1|38214_39180_+	replicase	NA	NA	NA	NA	NA
WP_014839878.1|39143_40535_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|40571_41144_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|41280_41871_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_014839983.1|42305_42920_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	47.4	8.1e-35
WP_001516695.1|43238_43895_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001067855.1|44974_45679_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389366.1|46203_46677_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_001067855.1|47579_48284_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_017900990.1|48688_49333_-	quinolone resistance pentapeptide repeat protein QnrB4	NA	NA	NA	NA	NA
WP_004193248.1|49415_50390_-	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_003020532.1|50560_51229_+	phage shock protein PspA	NA	NA	NA	NA	NA
WP_004193245.1|51283_51508_+	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_004193243.1|51507_51867_+	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_004193241.1|51875_52106_+	phage shock protein PspD	NA	NA	NA	NA	NA
WP_004236386.1|53456_54596_-	class C beta-lactamase DHA-1	NA	NA	NA	NA	NA
WP_004193231.1|54706_55582_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025999322.1|55585_55951_-	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_052238321.1|55843_56179_+	ethidium bromide resistance protein	NA	NA	NA	NA	NA
WP_000259031.1|56172_57012_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|57139_57343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|57498_58704_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|58714_59020_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|59246_60011_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|60503_61088_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|61087_62326_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|62322_63228_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|63349_64054_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP048340	Escherichia coli strain 142 plasmid p142_C, complete sequence	47545	9244	44051	47545	plate,portal,terminase,protease,capsid,tail,head,holin	Vibrio_phage(44.83%)	43	NA	NA
WP_001270825.1|9244_9577_+	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	39.8	2.9e-15
WP_001250512.1|9580_9958_+	hypothetical protein	NA	A0A2I7R3L8	Vibrio_phage	35.1	6.3e-06
WP_001705004.1|10127_11195_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000823235.1|11272_11554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004105278.1|11550_11916_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	55.9	3.1e-10
WP_001706266.1|11945_12104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004105282.1|12100_12712_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	45.9	5.2e-42
WP_001705006.1|12714_13059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023908961.1|13051_13768_+	ead/Ea22-like family protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	92.6	1.5e-69
WP_001271967.1|14146_14542_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	82.3	6.1e-52
WP_000254764.1|14528_14825_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	63.7	2.3e-27
WP_024180651.1|14808_15354_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	84.0	3.0e-89
WP_023908959.1|15350_15629_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	51.7	1.2e-17
WP_000867916.1|17004_17274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001222808.1|17273_17471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033550356.1|17545_17845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023908957.1|18877_19501_+	ParB N-terminal domain-containing protein	NA	A0A0E3JS81	Verrucomicrobia_phage	43.8	2.4e-34
WP_004105305.1|19500_20874_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001705017.1|20914_21610_+	hypothetical protein	NA	A0A1W6JTE1	Pseudomonas_phage	33.8	1.3e-28
WP_001185429.1|22167_22758_+	ParB N-terminal domain-containing protein	NA	A0A067ZI74	Vibrio_phage	58.5	1.6e-40
WP_001019009.1|22757_23309_+	hypothetical protein	NA	K4ICN8	Acidithiobacillus_phage	29.4	1.7e-07
WP_001406385.1|23314_25171_+|terminase	phage terminase large subunit family protein	terminase	A0A059WKL6	Vibrio_phage	62.7	8.5e-237
WP_001058287.1|25182_25422_+	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	52.0	6.8e-14
WP_001022885.1|25418_26993_+|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	65.7	1.2e-191
WP_032150711.1|26982_28050_+|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	48.2	1.3e-77
WP_004105317.1|28059_28443_+|head	bacteriophage lambda head decoration D family protein	head	NA	NA	NA	NA
WP_004105318.1|28463_29507_+|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	47.9	4.0e-74
WP_001523066.1|29507_29900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004105322.1|29899_30244_+	ATP-binding sugar transporter from pro-phage family protein	NA	NA	NA	NA	NA
WP_000609134.1|30240_30726_+	hypothetical protein	NA	A0A067ZIL8	Vibrio_phage	37.4	3.0e-16
WP_001284546.1|30726_31017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115786624.1|31016_32480_+|tail	phage tail sheath family protein	tail	A0A059WKP9	Vibrio_phage	53.4	1.6e-145
WP_004105328.1|32496_33018_+|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	57.8	1.2e-50
WP_000450805.1|33027_33309_+	hypothetical protein	NA	A0A0C5AEP1	Bacteriophage	37.4	1.0e-05
WP_064717798.1|34123_36256_+|tail	phage tail tape measure protein	tail	A0A097P6S4	Vibrio_phage	39.6	3.7e-18
WP_004105332.1|36456_37458_+	phage late control D family protein	NA	A0A067ZG47	Vibrio_phage	42.5	1.3e-69
WP_001523073.1|37460_38081_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	51.6	1.0e-29
WP_000635200.1|38077_38545_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_001523074.1|38541_38862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001705026.1|38858_39983_+|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	44.2	4.9e-86
WP_023908964.1|39975_40557_+|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	40.0	3.6e-16
WP_039052398.1|40587_43434_+|tail	phage tail fiber protein	tail	Q858V4	Yersinia_virus	46.6	3.3e-171
WP_001523080.1|43433_44051_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.9	3.5e-86
