The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048330	Escherichia coli strain 10 chromosome, complete genome	4891237	1038045	1051228	4891237		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1038045_1038807_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1038800_1039427_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1039566_1040706_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1040768_1041761_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1041854_1043219_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1043307_1044084_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1044088_1044727_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1044723_1045986_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|1045982_1046891_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272547.1|1047056_1047854_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_001141322.1|1047904_1048561_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272928.1|1048666_1051228_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP048330	Escherichia coli strain 10 chromosome, complete genome	4891237	1086309	1173638	4891237	integrase,lysis,tRNA,head,plate,capsid,portal,tail,terminase	Erwinia_phage(22.92%)	91	1084922:1084938	1165336:1165352
1084922:1084938	attL	AGCAGGCACTGGAAATC	NA	NA	NA	NA
WP_000047184.1|1086309_1088940_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|1089174_1089360_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273290.1|1090817_1091384_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287454.1|1091380_1091809_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611804.1|1091881_1093438_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130211.1|1093587_1094103_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001295176.1|1094166_1095705_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001326681.1|1095721_1096894_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378447.1|1097020_1097551_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_048265082.1|1097521_1097623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119763.1|1097641_1097977_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445651.1|1097966_1098704_-	L-valine exporter subunit YgaZ	NA	NA	NA	NA	NA
WP_000165680.1|1098827_1100012_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216525.1|1100203_1101196_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774988.1|1101253_1102318_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985494.1|1102310_1103513_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777969.1|1103866_1104826_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000246527.1|1104835_1106980_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
WP_000080947.1|1106952_1107363_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|1107359_1107605_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001295174.1|1107852_1108182_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|1108333_1108678_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492656.1|1108714_1109164_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115383.1|1109832_1110237_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229442.1|1110283_1110808_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000137280.1|1110817_1111117_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|1111299_1111458_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522415.1|1111541_1111991_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|1111991_1112654_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001333601.1|1112680_1114081_-	GABA permease	NA	NA	NA	NA	NA
WP_001087611.1|1114318_1115599_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
WP_000772833.1|1115612_1117061_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271909.1|1117083_1118352_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000993126.1|1118371_1119349_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_001333598.1|1121604_1121937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023223216.1|1122729_1122948_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	86.1	4.6e-33
WP_053920611.1|1122987_1124181_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	79.4	1.1e-168
WP_023252154.1|1124183_1124648_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	75.5	5.9e-62
WP_053881138.1|1124659_1127089_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	69.5	1.7e-277
WP_000763326.1|1127081_1127201_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	3.7e-13
WP_053881139.1|1127233_1127515_-|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	77.3	3.6e-30
WP_053881140.1|1127577_1128096_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.0	7.7e-71
WP_053881141.1|1128108_1129296_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	82.3	5.5e-189
WP_053881142.1|1129427_1129841_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.5	8.1e-23
WP_053881143.1|1131009_1131621_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	83.1	9.0e-95
WP_053881144.1|1131613_1132522_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	81.5	4.6e-135
WP_053881145.1|1132526_1132874_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	70.4	2.1e-40
WP_053881146.1|1132870_1133512_-|plate	phage baseplate assembly protein V	plate	O80314	Escherichia_phage	78.4	5.4e-90
WP_053881147.1|1133597_1134311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053881148.1|1134579_1135656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053881149.1|1135669_1136122_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.0	2.1e-48
WP_053881150.1|1136114_1136582_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.0	1.3e-56
WP_053881151.1|1136689_1137103_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	59.1	9.3e-35
WP_024150039.1|1137099_1137609_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
WP_000524754.1|1137592_1137814_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_001100637.1|1137804_1138008_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
WP_053881152.1|1138007_1138508_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	5.0e-59
WP_053881153.1|1138605_1139364_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	67.1	6.0e-80
WP_053881154.1|1139367_1140528_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	63.1	1.6e-129
WP_053881155.1|1140549_1141413_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	66.2	8.3e-102
WP_053881156.1|1141577_1143347_+|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	80.8	9.4e-286
WP_053881157.1|1143346_1144384_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	80.8	1.3e-162
WP_053881158.1|1144851_1146069_-	acyltransferase	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	29.6	9.7e-32
WP_071940803.1|1146362_1146545_-	Tum protein	NA	A0A218M4I0	Erwinia_phage	75.9	3.2e-16
WP_053881159.1|1146688_1148929_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	93.1	0.0e+00
WP_071940768.1|1148942_1149251_-	DUF3850 domain-containing protein	NA	A0A1S6KVH3	Escherichia_phage	43.2	1.6e-07
WP_052935633.1|1149247_1149475_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	70.7	4.8e-25
WP_052935634.1|1149474_1149702_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	90.7	2.3e-27
WP_052935635.1|1149771_1149972_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	89.4	1.1e-28
WP_052935636.1|1149958_1150186_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	92.0	1.6e-33
WP_052935637.1|1150193_1150703_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	98.8	1.2e-89
WP_001630878.1|1150733_1150997_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
WP_053881160.1|1151129_1151705_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	65.4	1.2e-67
WP_052935639.1|1151704_1152709_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	97.6	2.2e-191
WP_052935640.1|1152719_1154183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072097107.1|1156960_1157170_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	68.1	1.3e-08
WP_001120794.1|1157324_1157444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001581967.1|1157508_1162089_+	adhesin-like autotransporter YpjA/EhaD	NA	NA	NA	NA	NA
WP_000162574.1|1162831_1163314_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600189.1|1163445_1163922_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|1163911_1164202_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1164263_1164605_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|1164753_1166415_-	DNA repair protein RecN	NA	NA	NA	NA	NA
1165336:1165352	attR	GATTTCCAGTGCCTGCT	NA	NA	NA	NA
WP_001059169.1|1166500_1167379_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1167501_1168095_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|1168149_1169436_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001189257.1|1169456_1170323_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1170414_1171776_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1172024_1172273_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1172291_1172840_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1172870_1173638_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP048330	Escherichia coli strain 10 chromosome, complete genome	4891237	1684502	1693943	4891237		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569315.1|1684502_1685429_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1685433_1686165_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1686145_1686253_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1686312_1687044_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1687265_1688951_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1688947_1689667_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1689713_1690184_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1690223_1690685_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001375261.1|1690809_1692810_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001333512.1|1692806_1693943_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 4
NZ_CP048330	Escherichia coli strain 10 chromosome, complete genome	4891237	1751616	1761921	4891237	transposase,integrase	Catovirus(16.67%)	7	1736474:1736487	1758858:1758871
1736474:1736487	attL	TTCTGGTGACGCAC	NA	NA	NA	NA
WP_001295424.1|1751616_1752258_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234777.1|1752349_1752931_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001518066.1|1752952_1754806_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_016230728.1|1755257_1757948_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0R6PEZ3	Moraxella_phage	43.1	9.3e-35
WP_024192426.1|1758700_1759591_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	1.6e-44
1758858:1758871	attR	TTCTGGTGACGCAC	NA	NA	NA	NA
WP_162656948.1|1759866_1760721_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.9e-68
WP_001254928.1|1760769_1761921_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	2.2e-41
>prophage 5
NZ_CP048330	Escherichia coli strain 10 chromosome, complete genome	4891237	2245550	2330228	4891237	protease,integrase,transposase,lysis,head,capsid,portal,tail,terminase	Enterobacteria_phage(39.66%)	103	2266423:2266442	2305930:2305949
WP_001260849.1|2245550_2246372_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2246471_2246555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2246647_2246983_-	acid shock protein	NA	NA	NA	NA	NA
WP_001310555.1|2247301_2248318_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_000091840.1|2248578_2249832_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|2249938_2250832_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|2250966_2252187_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2252311_2253007_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2252959_2254252_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2254410_2255025_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|2255067_2255922_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2255923_2256541_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_137590995.1|2256551_2258975_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041675.1|2259035_2261462_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001300836.1|2261660_2261966_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2262073_2262784_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2262786_2263347_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2263381_2263723_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2263857_2264184_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2264389_2265604_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836066.1|2265615_2266635_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
2266423:2266442	attL	CAAGGAATTACCGGAAAAGA	NA	NA	NA	NA
WP_001360138.1|2266692_2266803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876958.1|2266822_2268103_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
WP_001296941.1|2268137_2268374_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_162656855.1|2268461_2270933_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_162656857.1|2271026_2271218_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854559.1|2271214_2271403_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2271803_2271968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|2271971_2272190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2272349_2272505_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|2272671_2273079_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2273162_2273393_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705358.1|2273376_2273898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054512.1|2273878_2274844_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_001151262.1|2274884_2275307_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_001310834.1|2275303_2275660_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_001333339.1|2276179_2277715_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_162656859.1|2277774_2277894_-	PapI protein	NA	A0A0N7BTS3	Escherichia_phage	75.0	5.2e-07
WP_085948620.1|2277859_2279073_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_039720394.1|2279124_2279424_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	5.4e-53
WP_000839179.1|2279420_2279825_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_072096395.1|2280549_2280768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000955178.1|2280742_2280925_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_162656861.1|2281102_2282416_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001301033.1|2282852_2283185_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2283387_2283693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2283717_2283957_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2283956_2284244_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2284315_2284471_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2284687_2284939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2285005_2285284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265199.1|2285285_2286335_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_001047135.1|2286348_2287101_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2287378_2287468_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2287522_2287735_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2288035_2288251_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2289004_2289220_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2289224_2289536_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2289532_2290066_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2290062_2290560_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2290922_2291135_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2291145_2291334_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2291336_2291402_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2291481_2291637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2291808_2291982_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2292910_2293321_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2293378_2293612_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_162656864.1|2294000_2294546_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_109550238.1|2294520_2296446_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198149.1|2296442_2296649_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_032241081.1|2296645_2298247_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	4.9e-310
WP_000123218.1|2298227_2299547_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	9.6e-235
WP_001295978.1|2299556_2299889_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_001365132.1|2299951_2300221_+|capsid	capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	100.0	5.3e-39
WP_094308187.1|2300353_2301589_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	45.2	1.1e-99
WP_000737990.1|2301590_2301821_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_016247984.1|2301837_2302659_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_000872983.1|2302790_2303147_-	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_024164959.1|2303174_2303366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061182184.1|2303376_2303709_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920681.1|2303701_2303887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001156310.1|2303886_2304078_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	59.3	1.1e-11
WP_001091146.1|2304078_2304300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113975552.1|2304317_2304617_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_094308185.1|2304613_2306365_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	41.1	1.3e-93
2305930:2305949	attR	CAAGGAATTACCGGAAAAGA	NA	NA	NA	NA
WP_001356810.1|2306654_2306912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001710062.1|2306908_2307358_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001710063.1|2307574_2308615_+|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.4	2.0e-65
WP_000190773.1|2308624_2308966_+|head	head decoration protein	head	NA	NA	NA	NA
WP_001178671.1|2308977_2309361_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_053902557.1|2310286_2311222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087604858.1|2311375_2312140_+|capsid	major capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	99.6	1.0e-140
WP_000158905.1|2312181_2312580_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
WP_001297108.1|2313945_2314665_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	1.9e-128
WP_000847379.1|2318065_2318395_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152640.1|2318394_2319093_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	1.5e-133
WP_000194783.1|2319098_2319842_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_000090895.1|2319778_2320411_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_162656866.1|2320471_2323969_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	98.0	0.0e+00
WP_061182196.1|2324039_2324639_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	95.0	1.7e-106
WP_162656868.1|2324703_2328240_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	7.2e-11
WP_162656870.1|2328239_2328824_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	3.0e-103
WP_162656872.1|2328896_2330228_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	8.5e-21
>prophage 6
NZ_CP048330	Escherichia coli strain 10 chromosome, complete genome	4891237	2844538	2904384	4891237	protease,integrase,transposase,tail,lysis,head,capsid,portal,holin,terminase	Escherichia_phage(28.81%)	80	2855075:2855091	2871209:2871225
WP_113975553.1|2844538_2845669_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	2.6e-103
WP_000113189.1|2845646_2845895_-	excisionase	NA	NA	NA	NA	NA
WP_162656894.1|2845959_2848431_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.0	2.5e-58
WP_001612869.1|2848524_2848716_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854564.1|2848712_2848901_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2849301_2849466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|2849469_2849688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072171742.1|2849847_2850003_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_000362155.1|2850263_2850683_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|2850783_2851065_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693850.1|2851048_2851474_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262390.1|2851545_2852616_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_001151150.1|2852656_2853079_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000761441.1|2853079_2853493_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	2.0e-58
WP_001224662.1|2853586_2853769_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_011076332.1|2854382_2854601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013636.1|2854803_2855016_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
2855075:2855091	attL	ACCCGCACGTAACCCGC	NA	NA	NA	NA
WP_032155008.1|2855183_2855462_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001221526.1|2855463_2856522_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_000139999.1|2856522_2856903_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_000762879.1|2856899_2857721_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_106104550.1|2858115_2858202_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_113975547.1|2858690_2858903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333560.1|2858973_2859309_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_072147991.1|2859555_2859759_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	5.9e-27
WP_072617254.1|2859755_2859917_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	4.6e-14
WP_000372595.1|2860066_2860282_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193264.1|2860286_2860637_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_032358753.1|2860700_2861234_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	95.5	4.0e-99
WP_001228695.1|2861450_2861633_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738421.1|2861723_2862017_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001135103.1|2862542_2862893_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	4.7e-64
WP_086732185.1|2863040_2863523_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	1.9e-84
WP_001140906.1|2863522_2864716_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.7	2.5e-197
WP_113975546.1|2864721_2865945_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	46.3	3.9e-97
WP_032166742.1|2865922_2866144_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_021530547.1|2866207_2866486_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_113975545.1|2866543_2867125_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	60.7	1.5e-51
WP_077763494.1|2867081_2868038_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_113975544.1|2868030_2868267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097314938.1|2868259_2868472_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	44.1	1.8e-05
WP_072033963.1|2868461_2868680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097314936.1|2868686_2869001_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_113975543.1|2868997_2871121_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	53.8	1.6e-175
WP_113975542.1|2871331_2871757_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
2871209:2871225	attR	ACCCGCACGTAACCCGC	NA	NA	NA	NA
WP_105472039.1|2871772_2872069_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_113975541.1|2872101_2872350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053661.1|2872386_2872893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024226530.1|2873179_2874349_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	76.0	7.9e-164
WP_021557929.1|2874403_2874964_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.4	3.7e-87
WP_021557928.1|2874965_2876189_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	87.6	1.5e-213
WP_058101044.1|2876185_2876524_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	71.4	1.6e-37
WP_021557926.1|2876520_2876817_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.6	1.6e-41
WP_029593913.1|2876816_2877257_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.7	2.4e-65
WP_072248979.1|2877240_2877426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|2877545_2877902_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_113975539.1|2877885_2879547_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.3	1.0e-278
WP_000923129.1|2880946_2882173_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.1	1.1e-203
WP_000999828.1|2882165_2882765_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000766109.1|2882779_2883997_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000719065.1|2884073_2884391_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	1.8e-22
WP_001147814.1|2884399_2884738_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000968644.1|2884734_2885184_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001206306.1|2885180_2885525_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
WP_000839179.1|2886180_2886585_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|2886581_2886929_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333339.1|2886977_2888513_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_001324129.1|2888751_2889138_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_077628067.1|2889179_2889440_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.5	1.7e-39
WP_113975537.1|2889485_2892713_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	94.9	0.0e+00
WP_001330090.1|2892690_2893047_+|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_001672796.1|2893046_2893745_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.4	2.8e-132
WP_038347027.1|2893750_2894494_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	5.2e-145
WP_162656896.1|2894430_2895063_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	88.6	6.1e-94
WP_162656898.1|2895123_2898621_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	98.1	0.0e+00
WP_061182196.1|2898691_2899291_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	95.0	1.7e-106
WP_162656900.1|2899355_2902814_+	hypothetical protein	NA	K7PGT9	Enterobacteria_phage	97.5	1.6e-58
WP_000946030.1|2902885_2903125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069067742.1|2903124_2903442_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.9	2.1e-23
WP_162656903.1|2903799_2904384_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.9	3.2e-105
>prophage 7
NZ_CP048330	Escherichia coli strain 10 chromosome, complete genome	4891237	3148096	3238546	4891237	integrase,transposase,terminase,head,lysis,capsid,tail,portal	Enterobacteria_phage(51.52%)	102	3141682:3141697	3238877:3238892
3141682:3141697	attL	CTGCAGCGTGGAATCC	NA	NA	NA	NA
WP_085947917.1|3148096_3149370_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000876763.1|3149495_3150026_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001125439.1|3152040_3153363_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001301023.1|3153362_3153629_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_001083595.1|3153851_3155252_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	4.0e-106
WP_000113108.1|3159803_3161396_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_000154342.1|3161474_3162428_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194860.1|3162676_3164212_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	23.6	7.2e-16
WP_000911186.1|3164205_3165234_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222721.1|3165233_3166226_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172465.1|3166237_3167260_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774165.1|3167286_3168162_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558527.1|3168185_3168476_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001286597.1|3168532_3169291_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_001313828.1|3169294_3170209_-	bestrophin family inner membrane protein	NA	NA	NA	NA	NA
WP_000854633.1|3170415_3171867_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000878968.1|3172093_3173041_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	29.6	7.3e-19
WP_001191027.1|3173152_3173512_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|3173511_3174438_-	glutaminase B	NA	NA	NA	NA	NA
WP_000156615.1|3174501_3175890_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366501.1|3175990_3176872_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162656907.1|3176949_3178065_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|3178214_3179405_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|3179429_3180095_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000843414.1|3180306_3180741_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|3180760_3181144_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803657.1|3181175_3181394_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_001375197.1|3181504_3182323_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054183.1|3182517_3183705_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|3183831_3183927_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592801.1|3185549_3185813_-	diguanylate cyclase DgcZ	NA	NA	NA	NA	NA
WP_000671737.1|3186067_3186460_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024746.1|3186735_3187254_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000210373.1|3187297_3189343_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|3189479_3190226_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|3190314_3191001_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214712.1|3191177_3191381_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527809.1|3191415_3192876_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_000347482.1|3192964_3194248_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|3194852_3194966_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|3195034_3195268_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|3195584_3196175_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|3196272_3196848_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000279080.1|3196847_3199922_-	hypothetical protein	NA	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_001230375.1|3199986_3200586_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_162656909.1|3200655_3204153_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.2	0.0e+00
WP_000090891.1|3204212_3204845_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_032200299.1|3204781_3205525_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	4.3e-147
WP_162656911.1|3205530_3206229_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	3.1e-131
WP_000847332.1|3206228_3206558_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	5.6e-59
WP_053276142.1|3206554_3209134_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.2	0.0e+00
WP_001347435.1|3209126_3209516_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.0	5.3e-56
WP_021553622.1|3209542_3209965_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	82.9	3.6e-58
WP_053276150.1|3209980_3210721_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	1.5e-128
WP_000683125.1|3210728_3211124_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	6.5e-70
WP_000975086.1|3211120_3211699_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	3.9e-79
WP_000752996.1|3211710_3212064_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_162656914.1|3212075_3212471_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	6.3e-57
WP_023156389.1|3212512_3213538_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	1.5e-187
WP_001549228.1|3213593_3213926_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_112823835.1|3213935_3215255_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.9	2.8e-234
WP_162656916.1|3215235_3216837_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	4.2e-309
WP_000198149.1|3216833_3217040_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001549229.1|3217036_3218962_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_162656864.1|3218936_3219482_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001421937.1|3219870_3220065_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|3220229_3220436_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001403557.1|3220721_3221132_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	99.3	9.4e-72
WP_000738492.1|3221422_3221716_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_012738274.1|3221806_3221989_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_001547121.1|3222205_3222703_-	lysozyme	NA	A5LH83	Enterobacteria_phage	98.2	1.9e-90
WP_000839596.1|3222702_3222918_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737263.1|3223489_3224572_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_001204780.1|3224760_3225144_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000971055.1|3225229_3225370_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3225366_3225729_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_047082235.1|3225725_3226016_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	2.1e-46
WP_000224914.1|3226008_3226179_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001010743.1|3226178_3226634_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.7e-61
WP_072841938.1|3226630_3226732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520499.1|3226855_3227257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038620.1|3227235_3227652_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_001224618.1|3228116_3228611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145941.1|3228757_3228931_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	90.9	9.2e-21
WP_000788885.1|3228927_3229629_-	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.7	1.1e-128
WP_162656957.1|3229625_3230555_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	1.2e-109
WP_001182903.1|3230641_3231181_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001067458.1|3231250_3231481_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000259990.1|3231519_3232275_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_000233576.1|3232870_3233077_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|3233152_3233449_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3233454_3234240_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_162656918.1|3234236_3234917_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	2.3e-131
WP_000682305.1|3234913_3235096_+	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	98.3	2.8e-28
WP_000548514.1|3235068_3235260_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_097480736.1|3235270_3235552_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	96.8	2.3e-45
WP_000763363.1|3235650_3235872_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_001289872.1|3235868_3236240_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	91.4	9.2e-34
WP_000103023.1|3236236_3236890_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	48.5	4.8e-62
WP_001277770.1|3236986_3237166_+	Eag protein	NA	K7PL40	Enterobacteria_phage	98.3	7.3e-29
WP_001303849.1|3237279_3237498_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3237475_3238546_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3238877:3238892	attR	CTGCAGCGTGGAATCC	NA	NA	NA	NA
>prophage 8
NZ_CP048330	Escherichia coli strain 10 chromosome, complete genome	4891237	3748415	3775746	4891237	transposase,plate	Clostridioides_phage(25.0%)	24	NA	NA
WP_000006255.1|3748415_3748913_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000056849.1|3749088_3749838_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000729703.1|3750047_3750308_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615983.1|3750310_3750589_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|3750744_3751485_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_162656926.1|3751455_3752223_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3752428_3753007_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973083.1|3753246_3755691_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|3755733_3756207_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118036.1|3756360_3757131_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000420818.1|3757171_3758308_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001101839.1|3758738_3759131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000508724.1|3759108_3763341_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_032329316.1|3763416_3765558_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|3765767_3766286_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|3766980_3767481_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3767515_3767740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|3767790_3769266_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|3769272_3769686_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|3769689_3771540_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3771503_3772586_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113713.1|3772610_3773891_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3773887_3774412_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246443.1|3774414_3775746_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 9
NZ_CP048330	Escherichia coli strain 10 chromosome, complete genome	4891237	4135445	4174893	4891237	transposase,integrase	Enterobacteria_phage(30.0%)	32	4162163:4162179	4183574:4183590
WP_001254928.1|4135445_4136597_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	2.2e-41
WP_160370960.1|4136645_4137500_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.7e-68
WP_001293435.1|4137653_4139651_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_001375347.1|4139713_4140991_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000145475.1|4141238_4141895_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001390362.1|4141952_4142057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296706.1|4142075_4142204_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_001387298.1|4143302_4143401_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_001295538.1|4143402_4144185_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|4144490_4145411_+	ribokinase	NA	NA	NA	NA	NA
WP_000998347.1|4145438_4146755_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107480.1|4146766_4147780_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_085947917.1|4147924_4149197_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001446914.1|4149583_4149823_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.0	1.5e-13
WP_000345346.1|4150033_4151290_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000705931.1|4151302_4151590_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000916805.1|4151605_4152049_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000416153.1|4152319_4153351_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
WP_001375333.1|4154701_4155136_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_001352291.1|4156044_4156371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000228394.1|4156580_4156925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000981734.1|4157279_4158629_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102863.1|4158649_4159567_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_001041752.1|4159578_4160775_-	CoA transferase	NA	NA	NA	NA	NA
WP_000018562.1|4161011_4162925_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
4162163:4162179	attL	TCCGGAAACCCTGCTGG	NA	NA	NA	NA
WP_162656931.1|4164980_4165760_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	1.0e-138
WP_085948620.1|4166522_4167735_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_001254928.1|4168263_4169415_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	2.2e-41
WP_001352287.1|4170007_4170910_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_001352286.1|4171027_4173208_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_001446910.1|4173210_4173585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772679.1|4173627_4174893_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.5	4.8e-74
4183574:4183590	attR	TCCGGAAACCCTGCTGG	NA	NA	NA	NA
>prophage 1
NZ_CP048331	Escherichia coli strain 10 plasmid p010_A, complete sequence	129675	1262	47977	129675	transposase,integrase	Escherichia_phage(31.25%)	47	NA	NA
WP_001066953.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_023141670.1|2123_2249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072355.1|3448_4618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105060.1|4813_5107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421272.1|5212_5488_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001387467.1|5487_5772_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000562172.1|6376_7129_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001022265.1|7174_8140_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000710783.1|8172_8553_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_001077068.1|8577_9468_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_000796505.1|9700_9895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338039.1|10439_11318_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_001271561.1|11307_12195_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_000922702.1|12205_13030_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_000950177.1|13035_14109_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	2.6e-28
WP_000476108.1|14101_15412_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001067855.1|17331_18036_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000874189.1|18745_19231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267177.1|19255_19741_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|19727_20423_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729220.1|20427_21558_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|21547_22831_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|22833_24213_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|24316_24844_-	iron transporter	NA	NA	NA	NA	NA
WP_000118029.1|24884_26771_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|27117_27933_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_001067855.1|29891_30596_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001553864.1|30486_30816_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	55.6	6.9e-09
WP_000454193.1|30941_31292_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|31494_32508_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|32665_33139_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|33269_34058_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|34263_34611_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|34604_35444_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|35571_35775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|35930_37136_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|37146_37452_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|37678_38443_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|38935_39520_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|39519_40758_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|40754_41660_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|41781_42486_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000978817.1|42856_43318_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	3.6e-19
WP_100134641.1|43610_44939_-	methyl-accepting chemotaxis protein	NA	A0A1B0VAH3	Salmonella_phage	100.0	1.6e-51
WP_001067855.1|44989_45694_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001235713.1|46376_46934_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|47116_47977_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
