The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048371	Escherichia coli strain 164 chromosome, complete genome	4819649	1118894	1132077	4819649		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1118894_1119656_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1119649_1120276_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1120415_1121555_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1121617_1122610_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1122703_1124068_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1124156_1124933_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1124937_1125576_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1125572_1126835_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847984.1|1126831_1127740_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_001300386.1|1127935_1128703_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1128753_1129410_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_039023140.1|1129515_1132077_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP048371	Escherichia coli strain 164 chromosome, complete genome	4819649	1734960	1744403	4819649		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569343.1|1734960_1735887_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783134.1|1735891_1736623_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1736603_1736711_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1736770_1737502_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|1737723_1739409_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001308766.1|1739405_1740125_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001551352.1|1740171_1740642_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001295429.1|1740683_1741145_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001551351.1|1741269_1743270_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001551350.1|1743266_1744403_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
>prophage 3
NZ_CP048371	Escherichia coli strain 164 chromosome, complete genome	4819649	1810543	1873890	4819649	transposase,integrase	Stx2-converting_phage(26.67%)	55	1806298:1806313	1829170:1829185
1806298:1806313	attL	TCGTTTTCCATTTTTA	NA	NA	NA	NA
WP_039023277.1|1810543_1811740_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001295424.1|1812501_1813143_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|1813234_1813816_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001252306.1|1813837_1815691_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001178345.1|1816142_1818833_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0R6PEZ3	Moraxella_phage	43.5	5.5e-35
WP_024189503.1|1819585_1820476_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	9.6e-45
WP_001254932.1|1821654_1822806_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_160342378.1|1824155_1824278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062914722.1|1824567_1826001_+	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
WP_020801619.1|1826146_1827280_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_020801645.1|1827286_1827718_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_062914721.1|1827736_1829908_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
1829170:1829185	attR	TAAAAATGGAAAACGA	NA	NA	NA	NA
WP_062914720.1|1830767_1831718_+	polysaccharide pyruvyl transferase	NA	NA	NA	NA	NA
WP_020801659.1|1831721_1832888_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_062914719.1|1832898_1834053_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_062914718.1|1834009_1835302_+	O-antigen ligase	NA	NA	NA	NA	NA
WP_062914717.1|1835301_1836390_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_020801633.1|1836401_1837571_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_062914716.1|1837580_1838348_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_062914715.1|1838368_1840117_+	pectate lyase superfamily protein	NA	A0A0A8J9B0	Klebsiella_phage	33.0	7.6e-54
WP_062914714.1|1840124_1841078_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_062914713.1|1841296_1842694_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_062914712.1|1842860_1844267_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	8.0e-38
WP_062914711.1|1844494_1845910_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.6	5.8e-52
WP_049284001.1|1845932_1847303_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.6	9.3e-31
WP_000704906.1|1847466_1848633_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.7	1.8e-112
WP_128552998.1|1849424_1850384_+	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 3-alpha-mannosyltransferase WbdC	NA	NA	NA	NA	NA
WP_000954831.1|1850422_1851031_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_000880176.1|1851024_1851801_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_000586445.1|1851782_1852520_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_001103561.1|1852519_1853110_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_046464156.1|1853109_1854177_-	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_000108945.1|1854176_1855247_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_001446927.1|1855243_1856548_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_032329340.1|1856553_1857453_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
WP_001364200.1|1857598_1857649_-	his operon leader peptide	NA	NA	NA	NA	NA
WP_001259255.1|1857932_1858184_+	YoeB-YefM toxin-antitoxin system antitoxin YefM	NA	NA	NA	NA	NA
WP_000767829.1|1858180_1858435_+	type II toxin-antitoxin system mRNA interferase toxin YoeB	NA	NA	NA	NA	NA
WP_000754749.1|1858517_1859342_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000803351.1|1859387_1860317_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010723108.1|1860531_1860594_+	membrane protein YoeI	NA	NA	NA	NA	NA
WP_000019197.1|1860583_1861942_+	putrescine/proton symporter PlaP	NA	NA	NA	NA	NA
WP_000492321.1|1862120_1863179_+	transport protein YeeE	NA	NA	NA	NA	NA
WP_000985273.1|1863192_1863420_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_000980567.1|1863462_1864890_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_001310935.1|1865098_1866265_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	1.5e-226
WP_000343760.1|1866391_1867612_-|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001105393.1|1867707_1868181_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_057109539.1|1868378_1869437_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|1869608_1869938_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016348.1|1870038_1870221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001445118.1|1870674_1871064_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000839179.1|1871557_1871962_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|1871958_1872306_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333339.1|1872354_1873890_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
>prophage 4
NZ_CP048371	Escherichia coli strain 164 chromosome, complete genome	4819649	2739213	2795255	4819649	tRNA,tail,integrase,head,terminase,capsid,holin,portal	Escherichia_phage(45.65%)	64	2747405:2747419	2795357:2795371
WP_001297484.1|2739213_2740320_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2740355_2740997_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|2741000_2742371_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265471.1|2742539_2743211_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2743210_2744671_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|2744746_2745868_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359434.1|2745916_2747143_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2747392_2748529_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2747405:2747419	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|2748512_2749376_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000241001.1|2749930_2750599_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_042047081.1|2750836_2751367_-	chaperone of endosialidase	NA	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_001189123.1|2752780_2754289_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001233546.1|2758242_2758842_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_000515345.1|2758909_2762389_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_000090843.1|2762449_2763058_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_001333568.1|2762994_2763738_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_001152457.1|2763743_2764442_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001330090.1|2764441_2764798_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224003.1|2764775_2768003_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_077253127.1|2768049_2768310_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
WP_000164661.1|2768351_2768723_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000097535.1|2768737_2769442_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_001206700.1|2769502_2769847_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000968644.1|2769843_2770293_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|2770289_2770628_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719064.1|2770636_2770954_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_000766109.1|2771030_2772248_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000923134.1|2772853_2774080_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_000811487.1|2774069_2774231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140892.1|2774227_2775985_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|2775984_2776467_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001135104.1|2776614_2776965_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_000738421.1|2777490_2777784_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|2777874_2778057_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992097.1|2778273_2778807_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_000193264.1|2778870_2779221_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|2779225_2779441_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_001333561.1|2779590_2779752_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
WP_000874243.1|2779748_2779937_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333560.1|2780197_2780533_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_001333559.1|2780603_2780816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106104550.1|2781304_2781391_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000762879.1|2781785_2782607_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_000139999.1|2782603_2782984_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_001221526.1|2782984_2784043_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_032155008.1|2784044_2784323_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001013636.1|2784490_2784703_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_011076332.1|2784905_2785124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000753060.1|2785568_2785745_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_001224662.1|2785737_2785920_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000761441.1|2786013_2786427_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	2.0e-58
WP_001151150.1|2786427_2786850_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|2786890_2787961_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693850.1|2788032_2788458_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|2788441_2788684_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001420344.1|2789075_2789414_+	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_042046576.1|2789767_2790067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|2790138_2790357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517906.1|2790321_2790525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2790925_2791114_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|2791110_2791302_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|2791395_2793837_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_000003742.1|2793898_2794168_+	excisionase	NA	NA	NA	NA	NA
WP_000074971.1|2794136_2795255_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
2795357:2795371	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 5
NZ_CP048371	Escherichia coli strain 164 chromosome, complete genome	4819649	3712221	3756558	4819649	head,transposase,tail,integrase	Enterobacteria_phage(20.0%)	34	3730174:3730189	3750892:3750907
WP_001254932.1|3712221_3713373_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000747051.1|3713292_3713643_-|transposase	transposase	transposase	Q716C1	Shigella_phage	98.9	1.8e-39
WP_001091149.1|3713712_3714006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072647924.1|3714094_3716965_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_072647923.1|3716967_3718596_-	site-specific DNA-methyltransferase	NA	A0A0K1LNZ9	Escherichia_phage	42.2	2.3e-84
WP_072647922.1|3718605_3720993_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_072647921.1|3721002_3721983_-	ATP-binding protein	NA	A0A1B2RW50	Lymphocystis_disease_virus	30.2	5.5e-17
WP_072647920.1|3722008_3724858_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	39.6	2.9e-183
WP_143190917.1|3726123_3726525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221620.1|3726512_3726947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331566.1|3728831_3730301_+	amino acid permease	NA	NA	NA	NA	NA
3730174:3730189	attL	GGGCAAGAAAAAAAGA	NA	NA	NA	NA
WP_000671170.1|3730405_3732775_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_071526750.1|3732906_3734349_+	amino acid permease	NA	NA	NA	NA	NA
WP_000654804.1|3735498_3736467_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.0e-185
WP_162683824.1|3736488_3737526_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_000132879.1|3737503_3739210_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_072647950.1|3739202_3740411_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_000772656.1|3740652_3741861_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.7e-130
WP_000893278.1|3742214_3743468_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|3743479_3744583_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_039023169.1|3744870_3745926_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_000174677.1|3745964_3746366_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189532.1|3746423_3747668_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3747759_3748218_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|3748478_3749936_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001326471.1|3749992_3750529_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001295202.1|3750461_3750728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059892.1|3751033_3751486_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
3750892:3750907	attR	GGGCAAGAAAAAAAGA	NA	NA	NA	NA
WP_001263489.1|3751495_3751894_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554758.1|3751896_3752190_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|3752241_3753297_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207552.1|3753367_3754153_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001334802.1|3754097_3755837_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|3756060_3756558_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP048371	Escherichia coli strain 164 chromosome, complete genome	4819649	3764816	3837659	4819649	transposase,protease,plate,tRNA	uncultured_Caudovirales_phage(20.0%)	58	NA	NA
WP_000420818.1|3764816_3765953_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001101839.1|3766383_3766776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039023185.1|3766753_3770986_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_032329316.1|3771061_3773203_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|3773412_3773931_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|3774625_3775126_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3775160_3775385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|3775435_3776911_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|3776917_3777331_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|3777334_3779185_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3779148_3780231_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113709.1|3780255_3781536_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3781532_3782057_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246443.1|3782059_3783391_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343289.1|3783395_3784157_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614325.1|3784165_3786931_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000088852.1|3786927_3787671_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240525.1|3787675_3789088_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122545204.1|3789196_3792631_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087741.1|3792641_3793994_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|3794017_3794500_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908066.1|3794543_3795458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236653.1|3795467_3795947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086141.1|3796083_3796869_-	lipoprotein	NA	NA	NA	NA	NA
WP_001340895.1|3797405_3798137_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_000917883.1|3798201_3798669_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001326702.1|3798665_3799388_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|3799421_3800177_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3800248_3801607_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001230983.1|3802281_3803082_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|3803322_3804237_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|3804233_3805037_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140187.1|3810796_3811372_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594006.1|3811559_3812591_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001294600.1|3812583_3813237_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|3813276_3814092_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|3814209_3814614_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|3814610_3815318_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|3815429_3817148_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001336393.1|3817201_3818026_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239163.1|3818225_3818936_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635537.1|3818949_3819372_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|3819368_3819914_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3820079_3820280_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|3820266_3820527_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176549.1|3820575_3821874_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901099.1|3821938_3822328_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|3822384_3824526_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|3824624_3825584_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|3825596_3829079_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|3829115_3829712_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139654.1|3829708_3830857_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|3830856_3831645_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3831648_3832104_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|3832208_3833234_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|3833237_3833723_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|3833844_3836277_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|3836306_3837659_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 7
NZ_CP048371	Escherichia coli strain 164 chromosome, complete genome	4819649	4511416	4623997	4819649	tRNA,tail,protease,integrase,plate,transposase	Escherichia_phage(47.73%)	113	4521116:4521151	4606295:4606330
WP_000187022.1|4511416_4512517_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|4512556_4512916_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|4512915_4513566_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120810.1|4513896_4515297_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|4515279_4516197_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_001230087.1|4516463_4517837_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001352356.1|4517897_4518674_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935370.1|4518681_4519686_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001298964.1|4519839_4520991_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
4521116:4521151	attL	CCGTAGGCCGGATAAGGCGCTCGCGCCGCATCCGGC	NA	NA	NA	NA
WP_001005586.1|4521588_4524240_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_000556306.1|4524421_4526155_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274643.1|4526369_4527221_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000323841.1|4527207_4527549_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000204105.1|4527550_4528429_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000184811.1|4528394_4530692_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|4530742_4531063_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|4531077_4532157_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_039023143.1|4532465_4534967_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	7.9e-12
WP_000424840.1|4534978_4535641_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_000374004.1|4535651_4536755_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647894.1|4537029_4537647_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001271242.1|4537673_4538579_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_001295695.1|4538671_4540852_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007529.1|4541180_4542071_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|4542419_4544852_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_001295694.1|4544854_4546015_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|4546291_4546609_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000797353.1|4546792_4547401_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000710769.1|4547461_4547674_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001333520.1|4547876_4550075_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|4550230_4551256_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068828.1|4551347_4552307_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|4552399_4552930_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|4552939_4554271_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4554337_4555264_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4555356_4555842_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4555926_4556172_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4556596_4557442_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|4557464_4558973_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|4559107_4560118_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796332.1|4560214_4560961_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323547.1|4560965_4561394_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655989.1|4561420_4561720_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|4561931_4562372_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802214.1|4562472_4563072_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216327.1|4563179_4563947_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001326656.1|4564001_4564757_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045683.1|4564863_4565853_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000591795.1|4566172_4567135_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|4567315_4568218_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000416606.1|4568425_4569067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947770.1|4569211_4570581_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000468308.1|4570653_4570872_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882940.1|4570953_4572117_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000978889.1|4572116_4572596_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069960.1|4572610_4575058_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.2	0.0e+00
WP_000785970.1|4575050_4575170_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|4575202_4575478_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|4575534_4576053_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286718.1|4576065_4577256_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_062914736.1|4577315_4577918_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.3	3.5e-99
WP_001333339.1|4577925_4579461_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_000612626.1|4579509_4579857_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|4579853_4580258_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001333405.1|4580399_4580915_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.8	5.0e-46
WP_024176421.1|4580929_4581532_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	75.5	2.5e-81
WP_001032315.1|4581503_4581920_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.0	3.4e-21
WP_000216970.1|4581922_4583218_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	96.8	1.6e-141
WP_001285346.1|4583214_4583826_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.4e-116
WP_001121501.1|4583818_4584727_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	3.7e-161
WP_000127167.1|4584731_4585079_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
WP_001093698.1|4585075_4585711_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.5e-111
WP_001001770.1|4585777_4586230_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	4.5e-75
WP_000917160.1|4586222_4586690_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	3.3e-81
WP_001440152.1|4586652_4586826_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_001016257.1|4587219_4587966_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_002431311.1|4587980_4589522_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_165737238.1|4589636_4591007_-	replication endonuclease	NA	A0A0F7LA09	Escherichia_phage	99.5	1.3e-255
WP_000027659.1|4590996_4591272_-	DUF5405 family protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_001113270.1|4591268_4591493_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277952.1|4591492_4591795_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_000557703.1|4591794_4592019_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|4592082_4592583_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|4592752_4593025_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|4593161_4593455_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|4593524_4594505_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001223800.1|4594691_4595192_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|4595341_4596040_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4596036_4597410_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|4597515_4598190_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|4598338_4599322_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000122641.1|4599581_4600202_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
WP_000063517.1|4600486_4601521_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000863142.1|4601517_4602456_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000217137.1|4602439_4603276_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000144073.1|4603563_4605033_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_001311268.1|4605029_4606289_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_001179741.1|4606739_4607564_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
4606295:4606330	attR	GCCGGATGCGGCGCGAGCGCCTTATCCGGCCTACGG	NA	NA	NA	NA
WP_000619493.1|4607573_4607888_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000729595.1|4608188_4608635_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000446015.1|4608645_4610097_+	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001019486.1|4610086_4611157_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000931299.1|4611156_4612905_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001295677.1|4612954_4614010_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000753617.1|4614162_4614996_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_077248221.1|4615189_4618240_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000331377.1|4618252_4619155_+	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_000829013.1|4619151_4619787_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000027703.1|4619783_4620713_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_001086388.1|4621042_4621285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295676.1|4621502_4621721_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297068.1|4622573_4623515_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_000560983.1|4623559_4623997_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP048372	Escherichia coli strain 164 plasmid pC-F-163_A, complete sequence	90244	67011	86234	90244	transposase,protease	Escherichia_phage(42.86%)	22	NA	NA
WP_002431311.1|67011_68553_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_001016257.1|68567_69314_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
WP_096790757.1|69409_69838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059120.1|70947_71409_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	36.4	9.4e-20
WP_001333231.1|71454_71664_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766816.1|71701_72292_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000083830.1|72531_72786_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|73023_73098_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130647.1|73090_73948_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|74886_75540_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|75632_75890_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|75822_76224_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|76519_77224_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_024210412.1|77235_78717_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_013362817.1|79245_79695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013362818.1|80324_81062_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
WP_013362819.1|81187_81283_-	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001067855.1|81417_82122_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023063803.1|82243_83158_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|83154_84393_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|84392_84977_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|85469_86234_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
