The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048367	Escherichia coli strain 163 chromosome, complete genome	4892242	1154201	1167384	4892242		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1154201_1154963_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1154956_1155583_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1155722_1156862_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1156924_1157917_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1158010_1159375_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1159463_1160240_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1160244_1160883_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1160879_1162142_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847984.1|1162138_1163047_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_001300386.1|1163242_1164010_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1164060_1164717_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_039023140.1|1164822_1167384_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP048367	Escherichia coli strain 163 chromosome, complete genome	4892242	1522277	1596261	4892242	tRNA,head,transposase,protease,portal,terminase,integrase,capsid,holin,tail	Klebsiella_phage(36.73%)	86	1507909:1507925	1542429:1542445
1507909:1507925	attL	CGTTCGTTAGCCTGTGC	NA	NA	NA	NA
WP_032412858.1|1522277_1523447_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.6	8.1e-201
WP_032412855.1|1523477_1524338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077254201.1|1524435_1524621_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	63.0	1.2e-13
WP_106466477.1|1524628_1525186_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	86.6	1.3e-44
WP_032412852.1|1525178_1525523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106466476.1|1525650_1526436_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	6.4e-61
WP_101984339.1|1526435_1526735_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	43.8	9.4e-13
WP_032408726.1|1527281_1527929_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
WP_016530206.1|1528033_1528231_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_004213338.1|1528256_1528718_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_001208720.1|1528955_1529135_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_106466475.1|1529124_1530108_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	65.3	8.8e-84
WP_106466474.1|1530104_1530914_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	1.6e-110
WP_094354718.1|1530923_1531301_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	74.4	1.8e-48
WP_094354717.1|1531313_1532294_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.5	5.8e-136
WP_040088784.1|1532308_1532671_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	95.0	9.5e-60
WP_040088785.1|1532693_1533137_-	hypothetical protein	NA	A5LH78	Enterobacteria_phage	70.1	4.6e-48
WP_053067521.1|1533140_1533854_-	hypothetical protein	NA	A5LH79	Enterobacteria_phage	90.7	7.7e-122
WP_024176410.1|1534404_1534704_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_024623189.1|1534700_1535240_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	1.5e-101
WP_024623188.1|1535236_1535584_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	82.6	2.1e-40
WP_040200652.1|1535580_1535856_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	91.2	2.2e-08
WP_040200649.1|1535997_1536291_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	71.1	4.4e-31
WP_023159445.1|1536625_1536871_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	100.0	8.4e-36
WP_106466473.1|1536968_1537166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106466472.1|1537220_1537454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074446651.1|1537441_1537792_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	79.1	1.0e-50
WP_025108056.1|1537948_1538446_+|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	73.3	2.2e-62
WP_106466471.1|1538449_1540201_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.5	3.0e-252
WP_016530191.1|1540197_1540359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016530190.1|1540348_1541575_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	3.2e-208
WP_000999827.1|1541567_1542167_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_004104235.1|1542176_1543415_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
1542429:1542445	attR	GCACAGGCTAACGAACG	NA	NA	NA	NA
WP_004104233.1|1543492_1543810_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.0	1.2e-21
WP_004216816.1|1543879_1544077_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	98.5	6.4e-26
WP_004184710.1|1544078_1544411_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
WP_004216814.1|1544403_1544943_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	99.4	3.0e-94
WP_106466470.1|1544939_1545305_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	93.4	6.0e-62
WP_004104226.1|1545362_1545854_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	99.4	2.5e-87
WP_004104225.1|1545897_1546281_+|tail	phage tail assembly protein	tail	A0A286S1N4	Klebsiella_phage	94.0	9.4e-58
WP_064188264.1|1546283_1546547_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	90.7	6.7e-39
WP_125305341.1|1546605_1546983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106466469.1|1547031_1549566_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	75.0	0.0e+00
WP_106466468.1|1549565_1550045_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	97.5	6.6e-93
WP_106466467.1|1550031_1550514_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	97.5	4.3e-84
WP_004152651.1|1550523_1550904_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_106466466.1|1550900_1553969_+	kinase	NA	A0A286S259	Klebsiella_phage	94.2	0.0e+00
WP_106466478.1|1554659_1558082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162664774.1|1558514_1560002_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	33.8	3.2e-29
WP_101999787.1|1560293_1560512_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	88.7	2.4e-26
WP_106466465.1|1560589_1561012_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_048334555.1|1561424_1561664_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	54.4	2.6e-21
WP_106466464.1|1561666_1561993_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	1.4e-25
WP_142675888.1|1562057_1562444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050849656.1|1562425_1562671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106466463.1|1562691_1562988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032330131.1|1563401_1564334_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.4e-166
WP_000776768.1|1564627_1565383_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000937792.1|1565564_1566623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039023277.1|1566776_1567973_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001295701.1|1568438_1569779_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_001296261.1|1570150_1570435_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_000531952.1|1570615_1571926_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000426176.1|1571925_1574070_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195819.1|1574272_1574758_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000033316.1|1575438_1576002_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001112832.1|1576083_1578729_+	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_001281606.1|1578748_1579501_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001311011.1|1579500_1580013_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001232541.1|1580009_1580498_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001043398.1|1580494_1581034_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000698745.1|1581035_1581857_+	YfcO family protein	NA	NA	NA	NA	NA
WP_000730806.1|1581927_1582479_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_162664776.1|1582644_1583577_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001333535.1|1583611_1584697_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
WP_001043825.1|1584700_1585525_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|1585524_1586334_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089222.1|1586333_1586882_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|1586915_1587194_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000683799.1|1587314_1589321_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|1589479_1590700_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127781.1|1590964_1592143_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615834.1|1592139_1593135_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000699145.1|1593233_1594370_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.9e-23
WP_001289167.1|1594435_1595449_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283585.1|1595448_1596261_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP048367	Escherichia coli strain 163 chromosome, complete genome	4892242	1811509	1820952	4892242		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569343.1|1811509_1812436_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783134.1|1812440_1813172_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1813152_1813260_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1813319_1814051_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|1814272_1815958_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001308766.1|1815954_1816674_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001551352.1|1816720_1817191_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001295429.1|1817232_1817694_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001551351.1|1817818_1819819_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001551350.1|1819815_1820952_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
>prophage 4
NZ_CP048367	Escherichia coli strain 163 chromosome, complete genome	4892242	1915002	1921430	4892242		Enterobacteria_phage(33.33%)	6	NA	NA
WP_042047335.1|1915002_1916409_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	2.8e-38
WP_032736000.1|1916630_1917695_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.0e-105
WP_042047338.1|1917721_1918591_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	2.9e-110
WP_042047340.1|1918622_1919513_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.2	2.1e-28
WP_023297948.1|1919527_1920082_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	5.0e-52
WP_042047343.1|1920263_1921430_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.5	1.6e-111
>prophage 5
NZ_CP048367	Escherichia coli strain 163 chromosome, complete genome	4892242	2780934	2839563	4892242	head,transposase,integrase,portal,terminase,tRNA,tail,capsid,holin	Escherichia_phage(44.68%)	65	2789126:2789140	2839665:2839679
WP_001297484.1|2780934_2782041_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2782076_2782718_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|2782721_2784092_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265471.1|2784260_2784932_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2784931_2786392_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|2786467_2787589_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359434.1|2787637_2788864_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2789113_2790250_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2789126:2789140	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|2790233_2791097_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000241001.1|2791651_2792320_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_042047081.1|2792557_2793088_-	chaperone of endosialidase	NA	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_001189123.1|2794501_2796010_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001233546.1|2799963_2800563_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_162664791.1|2800630_2804110_-	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_000090843.1|2804170_2804779_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_001333568.1|2804715_2805459_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_001152457.1|2805464_2806163_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001330090.1|2806162_2806519_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224003.1|2806496_2809724_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_077253127.1|2809770_2810031_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
WP_000164661.1|2810072_2810444_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000097535.1|2810458_2811163_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_001206700.1|2811223_2811568_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000968644.1|2811564_2812014_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|2812010_2812349_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719064.1|2812357_2812675_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_000766109.1|2812751_2813969_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000923134.1|2814574_2815801_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_000811487.1|2815790_2815952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140892.1|2815948_2817706_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|2817705_2818188_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001135104.1|2818335_2818686_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_000738421.1|2819211_2819505_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|2819595_2819778_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992097.1|2819994_2820528_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_000193264.1|2820591_2820942_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|2820946_2821162_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_001333561.1|2821311_2821473_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
WP_000874243.1|2821469_2821658_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333560.1|2821918_2822254_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_001333559.1|2822324_2822537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106104550.1|2823025_2823112_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_002431311.1|2824222_2825764_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_001016257.1|2825778_2826525_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000139999.1|2826911_2827292_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_001221526.1|2827292_2828351_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_032155008.1|2828352_2828631_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001013636.1|2828798_2829011_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_011076332.1|2829213_2829432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000753060.1|2829876_2830053_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_001224662.1|2830045_2830228_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000761441.1|2830321_2830735_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	2.0e-58
WP_001151150.1|2830735_2831158_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|2831198_2832269_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693850.1|2832340_2832766_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|2832749_2832992_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001420344.1|2833383_2833722_+	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_042046576.1|2834075_2834375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|2834446_2834665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517906.1|2834629_2834833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2835233_2835422_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|2835418_2835610_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|2835703_2838145_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_000003742.1|2838206_2838476_+	excisionase	NA	NA	NA	NA	NA
WP_000074971.1|2838444_2839563_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
2839665:2839679	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 6
NZ_CP048367	Escherichia coli strain 163 chromosome, complete genome	4892242	3770456	3824653	4892242	lysis,head,transposase,portal,terminase,integrase,capsid,holin,tail	Enterobacteria_phage(35.85%)	61	3772983:3773030	3820750:3820797
WP_000654804.1|3770456_3771425_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.0e-185
WP_000772656.1|3771612_3772821_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.7e-130
3772983:3773030	attL	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001619161.1|3773777_3774623_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	38.0	5.0e-35
WP_060581740.1|3774615_3775014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957441.1|3775013_3775679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060581741.1|3776609_3778499_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_139371347.1|3779046_3780259_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001619155.1|3780540_3780774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032316.1|3780754_3781165_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.3	2.2e-20
WP_001233083.1|3784258_3784858_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.0	6.3e-109
WP_108084474.1|3784928_3788426_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.3	0.0e+00
WP_000090917.1|3788486_3789119_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_045154394.1|3789055_3789799_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.3e-148
WP_001152639.1|3789804_3790503_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|3790502_3790832_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_021548553.1|3790828_3793408_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	86.7	0.0e+00
WP_000459458.1|3793400_3793835_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_021548554.1|3793816_3794239_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	86.4	5.9e-61
WP_021548555.1|3794254_3794995_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	94.3	7.8e-125
WP_021548556.1|3795002_3795398_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	5.0e-70
WP_001518407.1|3795394_3795973_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_029395143.1|3795984_3796338_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
WP_001468354.1|3796349_3796745_-	DNA packaging FI family protein	NA	A0A2R9YJP4	Escherichia_phage	93.9	3.1e-56
WP_029395141.1|3796786_3797812_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	2.9e-186
WP_012304872.1|3797867_3798200_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	96.4	4.6e-53
WP_029395138.1|3798209_3799529_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.2e-232
WP_057077926.1|3799509_3801111_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	5.5e-309
WP_000198149.1|3801107_3801314_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027321.1|3801310_3803236_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453587.1|3803210_3803756_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001663509.1|3804144_3804378_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079508.1|3804434_3804845_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|3805195_3805348_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001446997.1|3805335_3805773_-|lysis	lysis protein	lysis	Q716B4	Shigella_phage	95.9	3.0e-68
WP_060581801.1|3805769_3806246_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	1.9e-84
WP_001120496.1|3806249_3806576_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_000907077.1|3806976_3807726_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_125282403.1|3807741_3808086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000069422.1|3808089_3808704_+	hypothetical protein	NA	A0A2D1GNI4	Pseudomonas_phage	36.4	9.9e-33
WP_001205456.1|3808729_3809074_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	89.4	7.2e-57
WP_001433852.1|3809092_3810082_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	1.9e-195
WP_060581690.1|3810089_3810887_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.9	9.8e-150
WP_000767113.1|3810906_3811296_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210164.1|3811292_3811619_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_060581688.1|3811615_3812269_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.1	2.8e-126
WP_072199996.1|3812268_3812763_-	PerC family transcriptional regulator	NA	S5FUZ7	Shigella_phage	99.4	4.7e-86
WP_000104977.1|3812759_3813701_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	2.2e-140
WP_001250269.1|3813690_3813870_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001434539.1|3814045_3814597_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_000205494.1|3814634_3814835_-	cell division protein	NA	NA	NA	NA	NA
WP_000450735.1|3814932_3815559_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000559916.1|3815786_3816302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|3816772_3817135_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_057077927.1|3817200_3818025_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
WP_000008200.1|3818152_3818689_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|3818679_3819042_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206734.1|3819041_3819347_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	2.6e-50
WP_057077906.1|3819573_3820737_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	7.0e-229
WP_000893278.1|3820941_3822195_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3820750:3820797	attR	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3822206_3823310_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_039023169.1|3823597_3824653_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
>prophage 7
NZ_CP048367	Escherichia coli strain 163 chromosome, complete genome	4892242	3834787	3900601	4892242	plate,transposase,tRNA	uncultured_Caudovirales_phage(20.0%)	56	NA	NA
WP_000006255.1|3834787_3835285_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000056849.1|3835460_3836210_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000729703.1|3836419_3836680_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615983.1|3836682_3836961_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|3837116_3837857_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|3837827_3838595_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3838800_3839379_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973083.1|3839618_3842063_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|3842105_3842579_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118036.1|3842732_3843503_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000420818.1|3843543_3844680_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001101839.1|3845110_3845503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039023185.1|3845480_3849713_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_032329316.1|3849788_3851930_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|3852139_3852658_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|3853352_3853853_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3853887_3854112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|3854162_3855638_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|3855644_3856058_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|3856061_3857912_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3857875_3858958_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113709.1|3858982_3860263_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3860259_3860784_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246443.1|3860786_3862118_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343289.1|3862122_3862884_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614325.1|3862892_3865658_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000088852.1|3865654_3866398_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240525.1|3866402_3867815_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122545204.1|3867923_3871358_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087741.1|3871368_3872721_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|3872744_3873227_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908066.1|3873270_3874185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236653.1|3874194_3874674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086141.1|3874810_3875596_-	lipoprotein	NA	NA	NA	NA	NA
WP_001340895.1|3876132_3876864_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_000917883.1|3876928_3877396_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001326702.1|3877392_3878115_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|3878148_3878904_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3878975_3880334_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001230983.1|3881008_3881809_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|3882049_3882964_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|3882960_3883764_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140187.1|3889523_3890099_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594006.1|3890286_3891318_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001294600.1|3891310_3891964_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|3892003_3892819_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|3892936_3893341_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|3893337_3894045_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|3894156_3895875_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001336393.1|3895928_3896753_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239163.1|3896952_3897663_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635537.1|3897676_3898099_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|3898095_3898641_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3898806_3899007_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|3898993_3899254_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176549.1|3899302_3900601_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP048367	Escherichia coli strain 163 chromosome, complete genome	4892242	4589336	4696643	4892242	integrase,transposase,protease,tRNA,tail	Escherichia_phage(45.71%)	104	4599036:4599071	4678941:4678976
WP_000187022.1|4589336_4590437_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|4590476_4590836_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|4590835_4591486_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120810.1|4591816_4593217_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|4593199_4594117_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_001230087.1|4594383_4595757_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001352356.1|4595817_4596594_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935370.1|4596601_4597606_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001298964.1|4597759_4598911_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
4599036:4599071	attL	CCGTAGGCCGGATAAGGCGCTCGCGCCGCATCCGGC	NA	NA	NA	NA
WP_001005586.1|4599508_4602160_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_000556306.1|4602341_4604075_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274643.1|4604289_4605141_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000323841.1|4605127_4605469_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000204105.1|4605470_4606349_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000184811.1|4606314_4608612_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|4608662_4608983_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|4608997_4610077_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_039023143.1|4610385_4612887_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	7.9e-12
WP_000424840.1|4612898_4613561_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_000374004.1|4613571_4614675_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647894.1|4614949_4615567_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001271242.1|4615593_4616499_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_001295695.1|4616591_4618772_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007529.1|4619100_4619991_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|4620339_4622772_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_001295694.1|4622774_4623935_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|4624211_4624529_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000797353.1|4624712_4625321_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000710769.1|4625381_4625594_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001333520.1|4625796_4627995_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|4628150_4629176_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068828.1|4629267_4630227_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|4630319_4630850_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|4630859_4632191_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4632257_4633184_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4633276_4633762_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4633846_4634092_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4634516_4635362_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|4635384_4636893_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_162664806.1|4637027_4638038_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796332.1|4638134_4638881_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323547.1|4638885_4639314_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655989.1|4639340_4639640_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|4639851_4640292_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802214.1|4640392_4640992_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216327.1|4641099_4641867_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001326656.1|4641921_4642677_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045683.1|4642783_4643773_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000591795.1|4644092_4645055_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|4645235_4646138_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000416606.1|4646345_4646987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947770.1|4647131_4648501_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000468308.1|4648573_4648792_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882940.1|4648873_4650037_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000978889.1|4650036_4650516_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069960.1|4650530_4652978_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.2	0.0e+00
WP_000785970.1|4652970_4653090_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|4653122_4653398_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|4653454_4653973_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286718.1|4653985_4655176_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_062914736.1|4655235_4655838_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.3	3.5e-99
WP_001333339.1|4655845_4657381_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_000612626.1|4657429_4657777_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|4657773_4658178_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001333405.1|4658319_4658835_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.8	5.0e-46
WP_024176421.1|4658849_4659452_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	75.5	2.5e-81
WP_001016257.1|4659865_4660612_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_002431311.1|4660626_4662168_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_165737238.1|4662282_4663653_-	replication endonuclease	NA	A0A0F7LA09	Escherichia_phage	99.5	1.3e-255
WP_000027659.1|4663642_4663918_-	DUF5405 family protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_001113270.1|4663914_4664139_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277952.1|4664138_4664441_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_000557703.1|4664440_4664665_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|4664728_4665229_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|4665398_4665671_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|4665807_4666101_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|4666170_4667151_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001223800.1|4667337_4667838_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|4667987_4668686_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4668682_4670056_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|4670161_4670836_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|4670984_4671968_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000122641.1|4672227_4672848_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
WP_000063517.1|4673132_4674167_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000863142.1|4674163_4675102_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000217137.1|4675085_4675922_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000144073.1|4676209_4677679_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_001311268.1|4677675_4678935_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_001179741.1|4679385_4680210_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
4678941:4678976	attR	GCCGGATGCGGCGCGAGCGCCTTATCCGGCCTACGG	NA	NA	NA	NA
WP_000619493.1|4680219_4680534_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000729595.1|4680834_4681281_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000446015.1|4681291_4682743_+	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001019486.1|4682732_4683803_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000931299.1|4683802_4685551_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001295677.1|4685600_4686656_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000753617.1|4686808_4687642_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_077248221.1|4687835_4690886_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000331377.1|4690898_4691801_+	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_000829013.1|4691797_4692433_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000027703.1|4692429_4693359_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_001086388.1|4693688_4693931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295676.1|4694148_4694367_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297068.1|4695219_4696161_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_000560983.1|4696205_4696643_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP048368	Escherichia coli strain 163 plasmid pC-F-164_A-OXA140, complete sequence	132482	1796	56391	132482	transposase,protease,integrase	Escherichia_phage(26.67%)	50	NA	NA
WP_000616807.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|2542_2800_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|2732_3134_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001553819.1|3270_6168_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509965.1|6262_6868_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_162664822.1|7469_8171_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	96.2	9.0e-131
WP_063840321.1|8313_8868_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|8998_9829_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_050011420.1|11153_11516_+|transposase	IS1380 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	3.8e-40
WP_000239590.1|11771_12647_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|12693_13026_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001083725.1|17117_17615_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_071523897.1|17771_18017_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|18022_18814_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|18977_19325_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|19318_20158_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|20562_22104_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_004201169.1|22416_23448_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201168.1|23458_24097_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|24101_24467_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_023408309.1|24470_25283_-	subclass B1 metallo-beta-lactamase NDM-5	NA	NA	NA	NA	NA
WP_001067855.1|25841_26546_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014342205.1|26739_27117_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	58.1	8.2e-22
WP_014342204.1|27152_27701_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_012372818.1|27781_28537_-	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_000027057.1|28706_29567_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|29749_30307_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001389365.1|30608_31373_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|31865_32450_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|32449_33688_-	MFS transporter	NA	NA	NA	NA	NA
WP_023063803.1|33684_34599_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|34720_35425_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000874189.1|38938_39424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267176.1|39448_39934_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|39920_40616_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729219.1|40620_41751_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|41740_43024_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|43026_44406_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|44509_45037_-	iron transporter	NA	NA	NA	NA	NA
WP_000118029.1|45077_46964_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|47310_48126_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000949452.1|48308_48815_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_000449408.1|48804_48963_-	copper-sensitivity suppressor C	NA	NA	NA	NA	NA
WP_000361402.1|51208_52231_-	helicase UvrD	NA	NA	NA	NA	NA
WP_001128474.1|52215_53781_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001034044.1|53855_54272_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261286.1|54268_54499_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000813630.1|55058_55277_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159871.1|55278_55584_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016970.1|55584_56391_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
