The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048379	Klebsiella variicola strain 118 chromosome, complete genome	5601806	1303629	1357234	5601806	holin,integrase,tRNA,tail,capsid,terminase	Salmonella_phage(40.0%)	59	1316283:1316309	1358469:1358495
WP_061153674.1|1303629_1304904_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_061153675.1|1304938_1305559_+	YfgM family protein	NA	NA	NA	NA	NA
WP_136027310.1|1305569_1306748_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_061153676.1|1306861_1308340_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_162677067.1|1308707_1309400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020317242.1|1309621_1310101_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_162677068.1|1310285_1311323_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004201901.1|1311372_1311591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162677069.1|1311574_1312966_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	4.8e-35
WP_061153681.1|1313124_1314591_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.5e-87
WP_016161630.1|1314658_1316236_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
1316283:1316309	attL	AACCCTCTGTTTTTACAGAGGGTTTTT	NA	NA	NA	NA
WP_162677070.1|1316427_1317678_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.1	8.9e-206
WP_004200579.1|1317694_1317886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110915709.1|1317882_1318476_-	adenine methylase	NA	T1SA14	Salmonella_phage	91.4	2.0e-107
WP_009485472.1|1318472_1319342_-	MmcB family DNA repair protein	NA	A9YWY3	Burkholderia_phage	41.5	1.3e-59
WP_040173672.1|1319338_1319530_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	3.5e-13
WP_009485474.1|1319526_1319685_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	80.8	8.7e-18
WP_004197333.1|1319677_1319971_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	2.3e-32
WP_004144294.1|1320080_1320329_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_040025492.1|1320377_1321313_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	76.7	2.0e-141
WP_162677071.1|1321309_1322131_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	81.7	1.5e-132
WP_162677072.1|1322127_1322427_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	53.5	2.3e-19
WP_162678257.1|1322434_1323466_-	hypothetical protein	NA	A0A059VK18	Pseudomonas_phage	51.0	2.1e-35
WP_004197420.1|1323876_1324458_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	4.6e-64
WP_023285447.1|1324612_1324846_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	1.2e-23
WP_162677073.1|1325192_1325774_+	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	51.5	5.1e-39
WP_004200565.1|1325773_1326544_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	91.7	5.5e-57
WP_087812434.1|1326669_1327014_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	85.1	4.1e-52
WP_162677074.1|1327672_1327819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162677075.1|1329912_1330092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162677076.1|1330091_1330430_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	88.2	1.4e-49
WP_162677077.1|1330504_1330762_+	lF-82	NA	NA	NA	NA	NA
WP_047718678.1|1330839_1331430_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	78.5	1.5e-78
WP_162677078.1|1331426_1332902_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	92.9	8.4e-280
WP_085287815.1|1332945_1333317_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	94.3	4.4e-60
WP_004152472.1|1334209_1334413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162677079.1|1334416_1336096_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	58.9	3.1e-193
WP_004152470.1|1336092_1336398_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_110220416.1|1336679_1337078_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	2.1e-36
WP_162677080.1|1337090_1338098_+|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	93.1	2.5e-182
WP_004152466.1|1338107_1338500_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_025367999.1|1338492_1338771_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	1.1e-20
WP_024622836.1|1338819_1339431_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.5	5.4e-47
WP_162677081.1|1339430_1341908_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	57.2	4.1e-271
WP_110220411.1|1341909_1342380_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	1.1e-44
WP_048293158.1|1342372_1342870_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	43.6	4.0e-24
WP_162677082.1|1342882_1345627_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.9	5.1e-97
WP_162677083.1|1345626_1349016_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	41.8	3.1e-120
WP_101999915.1|1349016_1349457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080842387.1|1349682_1349919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004221292.1|1349955_1350108_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	85.7	1.9e-14
WP_074195329.1|1350201_1350399_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	63.5	3.7e-18
WP_064189924.1|1350402_1350660_-	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
WP_162677084.1|1350752_1351442_-	anti-repressor protein	NA	A0A193GYJ9	Enterobacter_phage	59.0	1.2e-74
WP_162677085.1|1351913_1352765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162677086.1|1352757_1352949_-	hypothetical protein	NA	A0A248XD02	Klebsiella_phage	44.9	7.8e-05
WP_085457687.1|1356146_1356410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004146394.1|1356537_1356942_+	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_023339240.1|1356928_1357234_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
1358469:1358495	attR	AACCCTCTGTTTTTACAGAGGGTTTTT	NA	NA	NA	NA
>prophage 2
NZ_CP048379	Klebsiella variicola strain 118 chromosome, complete genome	5601806	1441699	1504793	5601806	holin,integrase,tRNA,tail,protease,portal,terminase	Enterobacteria_phage(23.26%)	69	1464702:1464725	1510356:1510379
WP_136072334.1|1441699_1443118_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_100698041.1|1443170_1443563_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_061153736.1|1443566_1443920_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_162677107.1|1444540_1446712_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_012540950.1|1446760_1447963_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_061153738.1|1448309_1449551_+	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_061153739.1|1449608_1449968_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_162677108.1|1450098_1451091_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_136028385.1|1451271_1452933_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_061156328.1|1452929_1454165_-	ion channel protein	NA	NA	NA	NA	NA
WP_012540954.1|1454428_1455394_+	glucokinase	NA	NA	NA	NA	NA
WP_162542808.1|1455446_1456199_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.6	2.5e-14
WP_061153743.1|1456195_1457893_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	3.0e-47
WP_162677109.1|1457891_1458008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008803894.1|1458275_1459490_+	alanine transaminase	NA	NA	NA	NA	NA
WP_099119320.1|1459560_1459632_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_162677110.1|1459970_1461167_-	MFS transporter	NA	NA	NA	NA	NA
WP_061153745.1|1461163_1461622_-	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	38.5	4.2e-12
WP_162677111.1|1461754_1462663_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	23.8	1.0e-09
WP_162677112.1|1462693_1463551_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.9e-05
WP_162677113.1|1463917_1464400_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
1464702:1464725	attL	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_162677114.1|1464919_1466089_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.3	2.8e-201
WP_162677115.1|1466123_1466990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077270684.1|1467080_1467266_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	67.3	3.6e-15
WP_162677116.1|1467273_1467792_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	81.6	3.1e-43
WP_080870863.1|1467792_1468047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162678258.1|1468039_1469116_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	73.8	5.6e-148
WP_117052037.1|1469431_1470292_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	52.7	2.0e-71
WP_162677117.1|1470373_1471186_-	DUF2303 family protein	NA	NA	NA	NA	NA
WP_065810205.1|1471229_1471589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162677118.1|1471956_1472484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104456419.1|1474014_1474437_-	hypothetical protein	NA	A4KWV6	Enterobacteria_phage	81.3	2.0e-64
WP_104456418.1|1474436_1474895_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	86.8	3.0e-74
WP_104456417.1|1474887_1475142_-	type II toxin-antitoxin system HicA family toxin	NA	K7PH44	Enterobacterial_phage	89.3	3.2e-38
WP_162677119.1|1475287_1476001_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	57.8	1.2e-61
WP_104456415.1|1476099_1476342_+	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	67.1	6.4e-20
WP_162677120.1|1476367_1476838_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	76.3	1.7e-61
WP_162677121.1|1477313_1477589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115234206.1|1477581_1479111_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.9	6.6e-203
WP_162677122.1|1479107_1480079_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	60.7	2.3e-108
WP_162677123.1|1480048_1480693_+	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	55.0	1.1e-39
WP_162677124.1|1480689_1481331_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	67.0	2.3e-80
WP_162677125.1|1481327_1481906_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	2.9e-50
WP_162677126.1|1482043_1482622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162677127.1|1483035_1483380_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	70.2	8.2e-37
WP_162677128.1|1483382_1483922_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	1.1e-101
WP_162677129.1|1483918_1484266_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	73.0	6.4e-37
WP_064151957.1|1484262_1484532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085843105.1|1484488_1484686_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	83.9	6.8e-20
WP_123806884.1|1485043_1485400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162677130.1|1485520_1485706_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	63.0	4.9e-12
WP_162677131.1|1486027_1486519_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	83.4	1.1e-66
WP_162677132.1|1486518_1488627_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.4	0.0e+00
WP_020317294.1|1488623_1488839_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	77.1	7.7e-25
WP_057729201.1|1488835_1490335_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.4	1.2e-246
WP_162678259.1|1490279_1492295_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.6	0.0e+00
WP_014228572.1|1492375_1492702_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	66.4	1.4e-33
WP_020317349.1|1492694_1492988_+	sugar ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_020317346.1|1492977_1493529_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.9	5.3e-54
WP_020804325.1|1493525_1493924_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
WP_023320798.1|1493931_1494414_+	hypothetical protein	NA	M9NYX0	Enterobacteria_phage	69.2	2.6e-60
WP_162677133.1|1494456_1494852_+|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	28.2	8.3e-09
WP_032420719.1|1494872_1495190_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
WP_162677134.1|1495170_1497867_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	63.0	1.5e-202
WP_029498600.1|1497866_1498331_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	56.7	6.7e-50
WP_162677135.1|1498327_1498810_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	89.4	2.3e-77
WP_161637240.1|1498820_1499201_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	91.3	3.2e-66
WP_162677136.1|1499197_1502266_+	kinase	NA	A0A286S259	Klebsiella_phage	90.2	0.0e+00
WP_162677137.1|1502321_1504793_+	hypothetical protein	NA	J7HXC9	Pseudomonas_phage	33.9	1.5e-15
1510356:1510379	attR	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
>prophage 3
NZ_CP048379	Klebsiella variicola strain 118 chromosome, complete genome	5601806	1630459	1697029	5601806	holin,integrase,tail,capsid,head,protease,portal,terminase,transposase	Salmonella_phage(14.29%)	82	1639526:1639575	1702649:1702698
WP_061153830.1|1630459_1630951_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_008803986.1|1631104_1632214_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_061153831.1|1632548_1632737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004102265.1|1632808_1633018_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_061153832.1|1633351_1634092_+	amino acid ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.4	1.5e-14
WP_061156331.1|1634100_1634799_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_012541007.1|1634808_1635561_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_061153833.1|1635550_1636393_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_008803992.1|1636397_1636937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061153834.1|1637145_1637934_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_061153835.1|1638158_1638518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077274669.1|1638790_1639468_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	47.1	1.4e-48
1639526:1639575	attL	TTTGGTCGGCACGAGAGGATTTGAACCTCCGACCCCCGACACCCCATGAC	NA	NA	NA	NA
WP_114262182.1|1639807_1640089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114262183.1|1640093_1640930_+	hypothetical protein	NA	I6PD67	Cronobacter_phage	35.3	1.6e-33
WP_114262184.1|1641376_1642054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114262185.1|1642046_1643228_-|integrase	site-specific integrase	integrase	A0A2D1GN00	Marinobacter_phage	28.2	4.5e-26
WP_004123007.1|1643230_1643440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114262187.1|1643743_1643962_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	52.1	9.2e-10
WP_162677165.1|1644373_1645060_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	31.7	6.9e-19
WP_114267782.1|1645396_1645777_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	94.4	3.0e-64
WP_162677166.1|1645777_1646263_-	hypothetical protein	NA	G9L661	Escherichia_phage	86.5	2.0e-76
WP_162677167.1|1646262_1646838_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	55.0	2.5e-30
WP_080871641.1|1646850_1647159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162677168.1|1647286_1648072_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	49.8	1.1e-60
WP_162677169.1|1648064_1648265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049181653.1|1648264_1648792_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	70.3	1.0e-62
WP_023343169.1|1648927_1649758_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	81.7	1.2e-126
WP_162677170.1|1649810_1650167_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	80.3	8.2e-48
WP_102017112.1|1651427_1652060_-	helix-turn-helix domain-containing protein	NA	A0A1W6JP50	Morganella_phage	58.3	2.2e-51
WP_102017111.1|1652163_1652367_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	57.6	2.0e-14
WP_162677171.1|1652603_1653074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162677172.1|1653153_1653702_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	68.0	1.3e-65
WP_162677173.1|1653874_1654054_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.1	3.0e-14
WP_038808207.1|1654043_1654955_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	78.4	7.0e-51
WP_162677174.1|1654951_1655410_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162677175.1|1655397_1656780_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	48.4	4.4e-105
WP_162677176.1|1656772_1658755_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.8	3.2e-197
WP_162677177.1|1658751_1659228_+|protease	SOS-response repressor and protease LexA	protease	U5P451	Shigella_phage	60.3	4.7e-14
WP_042934062.1|1659224_1659623_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	70.6	1.2e-44
WP_162677178.1|1659712_1660534_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	64.8	9.0e-90
WP_162677179.1|1660615_1661602_+	DUF968 domain-containing protein	NA	Q8SBE5	Shigella_phage	48.6	1.3e-90
WP_142473448.1|1661620_1662451_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	48.0	1.2e-57
WP_162677180.1|1662661_1662853_+	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	84.1	1.9e-22
WP_142473446.1|1663002_1664052_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	79.6	1.3e-170
WP_142473445.1|1664434_1664875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142473444.1|1664871_1666161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142473443.1|1666384_1666810_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	83.7	2.5e-59
WP_142473442.1|1666806_1666962_+	DUF3927 family protein	NA	A0A0A0YRI9	Escherichia_phage	68.8	3.2e-09
WP_004139418.1|1667256_1667646_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	80.3	2.4e-48
WP_142473441.1|1667635_1667914_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	75.0	2.0e-33
WP_148850111.1|1667913_1668543_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	78.3	3.3e-92
WP_103468741.1|1668545_1668821_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	65.9	6.6e-21
WP_162677181.1|1669060_1669306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162676777.1|1669399_1669753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110203561.1|1669684_1670026_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	76.6	2.1e-48
WP_025713390.1|1670207_1670672_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	3.7e-48
WP_162677182.1|1670625_1672362_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.1	1.7e-138
WP_162677183.1|1672368_1673688_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	58.9	1.3e-138
WP_040241930.1|1673663_1674371_+|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.5	2.9e-68
WP_162677184.1|1674380_1675601_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.8	4.9e-140
WP_100681816.1|1675902_1676235_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	32.5	1.0e-12
WP_100681815.1|1676246_1676585_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	67.0	4.7e-37
WP_162677185.1|1676581_1677031_+	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	81.9	3.3e-62
WP_064174273.1|1677027_1677375_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	3.6e-32
WP_162678261.1|1677431_1678136_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	1.2e-79
WP_162677186.1|1678166_1678571_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	55.4	4.2e-32
WP_040213871.1|1678573_1678879_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	1.4e-27
WP_016530182.1|1678952_1679186_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_162677187.1|1679246_1682636_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	56.9	5.2e-301
WP_162677188.1|1682656_1683130_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	60.8	6.0e-54
WP_080933595.1|1683116_1683602_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.6	1.2e-52
WP_071010321.1|1683611_1683992_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	9.3e-58
WP_162677189.1|1683988_1687072_+	kinase	NA	A0A286S259	Klebsiella_phage	71.6	0.0e+00
WP_072046289.1|1689408_1689813_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	95.5	1.2e-66
WP_021563201.1|1689809_1690157_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	1.3e-61
WP_080783621.1|1690205_1691744_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	93.0	2.0e-276
WP_162677190.1|1691885_1692062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162677191.1|1692061_1692271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162677192.1|1692316_1692580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162677193.1|1692582_1694496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162677194.1|1694634_1695204_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	91.1	2.9e-87
WP_080900191.1|1695808_1697029_+|transposase	ISL3-like element ISCfr12 family transposase	transposase	NA	NA	NA	NA
1702649:1702698	attR	TTTGGTCGGCACGAGAGGATTTGAACCTCCGACCCCCGACACCCCATGAC	NA	NA	NA	NA
>prophage 4
NZ_CP048379	Klebsiella variicola strain 118 chromosome, complete genome	5601806	1806977	1813906	5601806	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_100698113.1|1806977_1807841_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	9.7e-10
WP_100676378.1|1807851_1808625_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	1.0e-26
WP_008804075.1|1808864_1809761_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	3.6e-15
WP_008804076.1|1810003_1811365_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.0e-207
WP_004201558.1|1811684_1812407_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_101856203.1|1812403_1813906_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.9e-29
>prophage 5
NZ_CP048379	Klebsiella variicola strain 118 chromosome, complete genome	5601806	1856055	1873907	5601806		Enterobacteria_phage(28.57%)	17	NA	NA
WP_000043543.1|1856055_1857462_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_012967599.1|1857688_1859104_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	3.1e-53
WP_162677248.1|1859126_1860497_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.0	1.4e-31
WP_043874993.1|1860655_1861720_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	1.7e-104
WP_016161468.1|1861733_1862603_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	9.8e-111
WP_162677249.1|1862634_1863525_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.2	1.4e-27
WP_162677250.1|1863539_1864094_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_000704907.1|1864274_1865441_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_004144151.1|1865865_1865988_-	small membrane protein	NA	NA	NA	NA	NA
WP_162677251.1|1866122_1866317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060619179.1|1866386_1867391_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	2.0e-30
WP_162677252.1|1868242_1869307_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	8.3e-104
WP_016161468.1|1869333_1870203_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	9.8e-111
WP_162677249.1|1870234_1871125_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.2	1.4e-27
WP_162677253.1|1871139_1871694_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.1	3.3e-51
WP_158609881.1|1871782_1872556_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_043874997.1|1872545_1873907_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	1.5e-12
>prophage 6
NZ_CP048379	Klebsiella variicola strain 118 chromosome, complete genome	5601806	2913375	2922784	5601806		Escherichia_phage(87.5%)	9	NA	NA
WP_162550795.1|2913375_2915010_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.5	5.8e-181
WP_008804978.1|2915064_2916330_+	MFS transporter	NA	NA	NA	NA	NA
WP_100631892.1|2916359_2917448_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	98.1	2.4e-207
WP_008804980.1|2917535_2917796_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	95.3	3.0e-39
WP_162677570.1|2918090_2918951_+	LEN family class A beta-lactamase	NA	A0A077SL40	Escherichia_phage	92.0	9.3e-146
WP_074385925.1|2918969_2919731_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	98.8	1.0e-132
WP_162677571.1|2919991_2920894_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	98.0	2.1e-156
WP_162677572.1|2920905_2922171_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	97.1	2.9e-228
WP_100680178.1|2922163_2922784_+	aldolase	NA	A0A077SK32	Escherichia_phage	97.6	1.7e-112
>prophage 7
NZ_CP048379	Klebsiella variicola strain 118 chromosome, complete genome	5601806	3428393	3485831	5601806	holin,integrase,tRNA,tail,capsid,head,terminase,portal	Klebsiella_phage(37.84%)	55	3451002:3451017	3495363:3495378
WP_023322373.1|3428393_3429452_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.7	8.0e-14
WP_162677739.1|3429874_3431284_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	49.2	1.1e-84
WP_162677740.1|3431345_3443936_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	42.6	0.0e+00
WP_099729057.1|3443993_3444569_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	57.0	1.1e-49
WP_012542161.1|3444582_3445290_-	peptidase P60	NA	A0A2H4J1J7	uncultured_Caudovirales_phage	45.4	1.3e-60
WP_012542162.1|3445292_3446042_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	57.2	2.6e-83
WP_064184437.1|3446134_3446494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044650396.1|3446506_3446857_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	41.8	4.5e-22
WP_162677741.1|3446856_3449853_-|tail	phage tail tape measure protein	tail	A0A2H4J7J3	uncultured_Caudovirales_phage	25.2	2.8e-32
WP_016160678.1|3450081_3450426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049013950.1|3450440_3450920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064184457.1|3450940_3451342_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	62.7	4.3e-37
3451002:3451017	attL	TTGTAATCCAGCGCCG	NA	NA	NA	NA
WP_162677742.1|3451358_3451739_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	67.8	3.0e-40
WP_014228910.1|3451719_3452058_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_023339902.1|3452054_3452372_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	88.8	5.8e-45
WP_048964994.1|3452352_3452640_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	79.6	2.5e-18
WP_046622319.1|3452697_3453984_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	86.2	6.3e-207
WP_033128541.1|3454061_3454982_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	2.1e-148
WP_033128540.1|3455018_3456278_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	2.3e-222
WP_017898992.1|3456277_3456457_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_012542167.1|3456450_3458172_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.1e-190
WP_012542168.1|3458171_3458606_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_101856795.1|3458938_3459370_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	62.0	2.4e-41
WP_162677743.1|3459369_3459690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162677744.1|3459641_3460004_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	84.2	4.0e-58
WP_133959449.1|3460146_3460368_-	DNA gyrase subunit B	NA	NA	NA	NA	NA
WP_162677745.1|3461178_3461538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162677746.1|3461746_3462097_-	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	36.8	4.6e-11
WP_162677747.1|3462093_3462591_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	86.4	8.7e-80
WP_017880269.1|3462590_3462806_-|holin	holin	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
WP_162677748.1|3463681_3464806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162677749.1|3464807_3465998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162677750.1|3466023_3466374_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	74.3	8.1e-48
WP_162677751.1|3466386_3467418_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	49.3	1.4e-95
WP_162677752.1|3467617_3468010_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	4.7e-12
WP_162677753.1|3468361_3468586_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	67.6	1.4e-21
WP_055323494.1|3469024_3469714_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	28.0	7.0e-11
WP_162677754.1|3469784_3470531_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	30.7	1.0e-07
WP_012542191.1|3470849_3471077_+	DUF1737 domain-containing protein	NA	NA	NA	NA	NA
WP_162677755.1|3471523_3473287_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_044613085.1|3473599_3474040_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162677756.1|3474053_3474518_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	70.9	2.6e-62
WP_080782674.1|3474510_3475482_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	38.3	2.4e-33
WP_162677757.1|3475542_3476097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071561166.1|3476099_3476324_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
WP_077255823.1|3476412_3476850_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
WP_162677758.1|3477666_3477861_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3477903_3478248_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_162677759.1|3478389_3480528_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.7	1.9e-99
WP_012542206.1|3480580_3480826_+	excisionase	NA	NA	NA	NA	NA
WP_032418030.1|3480806_3481934_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	4.4e-119
WP_008806032.1|3482051_3483302_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_032729972.1|3483542_3484193_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_061155057.1|3484209_3484668_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_162677760.1|3484724_3485831_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
3495363:3495378	attR	CGGCGCTGGATTACAA	NA	NA	NA	NA
>prophage 8
NZ_CP048379	Klebsiella variicola strain 118 chromosome, complete genome	5601806	3728019	3737467	5601806	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_061155194.1|3728019_3729741_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	32.7	2.6e-14
WP_162677804.1|3729762_3730485_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3730836_3731055_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_061155196.1|3731173_3733453_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
WP_002896520.1|3733483_3733801_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3734126_3734348_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_061155197.1|3734414_3736355_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	2.9e-38
WP_061155198.1|3736351_3737467_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_CP048380	Klebsiella variicola strain 118 plasmid p118_A, complete sequence	244254	3286	66320	244254	transposase,integrase	Escherichia_phage(25.0%)	51	10690:10749	63809:65149
WP_044702994.1|3286_4051_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|4277_4583_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|4888_5593_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|5598_5739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|6224_6962_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|6958_7183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|7393_8887_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|8917_9169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|9062_9365_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|9451_10267_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|10596_10773_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
10690:10749	attL	GAAAACGGAATCTATGGTCACTCCCGTTTTTGCAACACCGATTTTGACGACAAGTTGGCT	NA	NA	NA	NA
WP_000427619.1|10954_11959_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|13557_14262_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001445937.1|14642_15599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977825.1|15625_15787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|15783_16395_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001568067.1|16448_16730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977766.1|16902_17238_+	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_001067855.1|18258_18963_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_019706030.1|21105_22110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085286834.1|23822_24770_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	4.3e-176
WP_004099052.1|25142_27335_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_004099051.1|27464_28748_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_009653212.1|28836_30270_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_023157975.1|30288_32736_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	69.2	6.1e-25
WP_004197675.1|32849_34493_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.0	1.5e-22
WP_058350821.1|35517_35772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003846919.1|36511_36682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023158026.1|36738_37992_-	lactose permease	NA	NA	NA	NA	NA
WP_029498501.1|38043_41118_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.6	0.0e+00
WP_004152286.1|41239_42322_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_000427619.1|42908_43913_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_071785586.1|44210_44453_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004118251.1|44783_45077_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_004152282.1|45175_45943_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118246.1|45943_46900_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004118243.1|46896_47895_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_023157913.1|47891_48794_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_032430169.1|48838_51163_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004197067.1|51255_52209_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004197062.1|52205_52727_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_004118231.1|53829_53997_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_004118840.1|54281_55409_+	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118229.1|55405_55999_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004118228.1|55995_56844_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118227.1|56843_57764_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152278.1|57776_59381_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118225.1|59425_60373_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004118832.1|60380_62114_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_000427619.1|64073_65078_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_072143344.1|65351_66320_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	2.0e-173
63809:65149	attR	GAAAACGGAATCTATGGTCACTCCCGTTTTTGCAACACCGATTTTGACGACAAGTTGGCTTGCTTGAATCTATCCGGCGTCTGAATGGGATTTTATTCCCGCGCCTCGATGAGTTCCGCGCCTGATGAACCTCCAGAAAATATACGGCTTCAATGAGCCTTTCCGTTTTACAGGTTCCTCAACAGGCCGGTGGGCCGTTAGTATCATCAATATCAGTATTCGCAAAACCAGATGAATGATTGTTTAAACTGGTGTATTTCTGCCTTTATGCTTCGTAAGTTTGCTGTCGCGCCGTCAGTGCCCAGGCTATTCTGGCCAGCTTGTTTGCCAGAGCACAGGTGACGACAAAGTTGCTTTTCCGACACAACAACTCCCTGACCCAGTCGGCCAACTTGCCAGACTGGTGTTCCAGTTTTTGTATGAATACCCTGGCACACTGAACCAACAAAGTTCGGATCTTTTTGTTGCCCCGCTTGCTAATCCCTAACAATGTCGTCCGACCTCCCGTGCTGTACTGTCGGGGTACCAGCCCTGTTGCCGCCGCAAAGTCACGGCTGCTGGCGTACTGCTTCCCGTCGCCAATCTCAGTTGAAATAGTACTGGCAGTCAGCGTTCCAACGCAGGGAATACTCAGCAAGCGCTGTCCAACCTCATCTTCGTCCAACTTTCGTTTCAACTGAGATTCCAGATCTTTAATCTGCTCAACAAGATAGTGATAATGCTGTTGTAATTTCAGCAGTAACTGGCTGAGATAAAGAGGCAAACTACTGTCCTCAAGAAGGGTACTCAGTCGACTAATAACGGCAGCACCTCGCGGAACGCTGATACCAAATTCCAGCAGAAAAGCATGCATCTGATTAGTTGTTTTCACCTTATCCTGAACCAGGGATTCACGGACACGATGCAGAGCTCGCATTGCCTGCTGAGATTCGGTTCTGGGCTGCACGAAACGCATAGATGGACGTGATGCTGCTTCACAGATAGCTTCAGCATCAACGAAGTCATTTTTGTTGCTTTTAACGAATGGGCGGACAAATTGCGGTGATATCAGCTTTGGAAAATGCCCTAACTCTTCCAGCTTGCGTGCCATAAAGTGAGAACCGCCACAGGCTTCCATCGCGATGGTTGTTGCCGGGCATGTCGCCAGAAATTCGATTAGCTTTGGTCGGGTGAATTTTTTACGGTAAACGGCCTTCCCACGATGATCCTGACAATGAATATGGAAAGAGTTCTTACCCAGATCGATACCAATAAGCGCAATGTTTTCCATGATGGTTCTCCGAATGAAAGCCTGTCCTCAGCATAGTACTGGGAAGGAGGGAGTGACCATCTCATTAAATA	NA	NA	NA	NA
>prophage 2
NZ_CP048380	Klebsiella variicola strain 118 plasmid p118_A, complete sequence	244254	78822	178060	244254	transposase,protease,integrase	uncultured_Caudovirales_phage(16.13%)	94	81508:81523	187258:187275
WP_004118209.1|78822_79086_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|79100_79364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|79607_79889_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|79923_80493_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|80616_83412_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
81508:81523	attL	CTGGCCCGGCGCAAGA	NA	NA	NA	NA
WP_004152115.1|83411_83609_+	hypothetical protein	NA	NA	NA	NA	NA
81508:81523	attL	CTGGCCCGGCGCAAGA	NA	NA	NA	NA
WP_009483782.1|83846_84596_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152113.1|84582_85545_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_004143398.1|87034_87430_-	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_077253535.1|87478_88825_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_003026803.1|89032_89515_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003026799.1|89502_89769_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_019725033.1|89975_90170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019725034.1|90213_90444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725040.1|90457_90661_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_015065502.1|90694_91063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009310053.1|91106_91601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015065504.1|91631_92204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725036.1|92200_92449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152101.1|92806_93157_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152100.1|93206_93569_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152099.1|93586_95338_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152098.1|95385_96675_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152097.1|96687_97113_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152096.1|97145_97682_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152095.1|99578_99941_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004182005.1|100016_100562_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004182006.1|100570_101284_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004152092.1|101280_101607_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004196778.1|101938_102436_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004196769.1|102485_102995_-	major intrinsic family protein	NA	NA	NA	NA	NA
WP_024623170.1|104737_104917_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004152085.1|105148_105583_-	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152084.1|105799_107200_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|107196_107877_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004118344.1|107931_108861_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|108865_109246_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_001242438.1|109285_110182_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000925242.1|110181_111999_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001023257.1|112232_112682_+	copper resistance protein	NA	NA	NA	NA	NA
WP_004182013.1|112970_113708_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|113741_113939_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_023317528.1|113979_116433_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.5	9.9e-84
WP_000758228.1|116559_117000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|117086_120233_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_004098959.1|120243_121536_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246153.1|121649_122003_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475512.1|122031_123417_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001572351.1|123606_124287_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_003032875.1|124279_125755_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_004178091.1|126005_126437_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_085955172.1|127865_129072_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178088.1|130112_132110_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_004152070.1|132172_133450_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_080895248.1|134432_135869_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004197688.1|136488_136746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162678358.1|137418_138387_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	1.9e-184
WP_071527918.1|138406_138718_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_032430723.1|138744_139692_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	2.3e-12
WP_022652310.1|141611_142352_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_022652311.1|142677_143667_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	61.2	5.0e-103
WP_022652312.1|144522_144792_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004152391.1|145072_146788_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|146897_149927_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|150033_151059_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
150422:150437	attR	TCTTGCGCCGGGCCAG	NA	NA	NA	NA
WP_004152394.1|151055_151835_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
150422:150437	attR	TCTTGCGCCGGGCCAG	NA	NA	NA	NA
WP_004152396.1|152122_153004_+	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152397.1|153253_154573_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152398.1|154849_156034_-|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
WP_004152400.1|156537_156897_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_162678359.1|157696_158677_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	98.8	2.6e-184
WP_004152402.1|159262_159883_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_004152403.1|159971_162869_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
WP_001067855.1|162941_163646_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000935452.1|164721_166026_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001300294.1|166064_166733_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|166768_167005_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|167001_167364_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|167381_169076_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|169127_169550_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_072093211.1|169585_169711_-	mercury transporter	NA	NA	NA	NA	NA
WP_004152334.1|170442_171153_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044770.1|171226_171643_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|171639_171870_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_072093212.1|171826_172288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153649.1|172522_172729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|172774_173083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|173110_173440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004171440.1|173465_173864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152339.1|173870_174203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|174202_174985_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_011977773.1|175876_176107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152341.1|176198_176672_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_004152342.1|176791_178060_-|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
187258:187275	attR	ATCGACTTGCGCCGGCGG	NA	NA	NA	NA
>prophage 3
NZ_CP048380	Klebsiella variicola strain 118 plasmid p118_A, complete sequence	244254	182635	194727	244254		Enterobacteria_phage(25.0%)	13	NA	NA
WP_004152345.1|182635_184663_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
WP_004227314.1|184774_184990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152347.1|185214_185547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152348.1|185923_186898_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152349.1|186894_188100_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152350.1|188421_189318_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152351.1|189718_190990_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152352.1|190989_191421_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_004152353.1|191652_192624_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152354.1|192626_193298_+	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|193358_193589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343518.1|193707_193824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|194025_194727_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
>prophage 1
NZ_CP048381	Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence	164790	1728	66839	164790	transposase,integrase	Escherichia_phage(24.0%)	59	NA	NA
WP_001515717.1|1728_2469_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_032430957.1|3544_4567_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_022652309.1|5073_6552_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	73.2	1.9e-194
WP_032430841.1|6569_7397_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	40.3	4.9e-51
WP_022652307.1|7478_7682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021314637.1|7959_8190_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_050483874.1|9361_9871_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_022652302.1|12032_12743_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	3.7e-31
WP_022652303.1|12744_13950_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_022652304.1|13946_15098_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004393990.1|15094_15703_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022652300.1|15890_16844_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000493286.1|17262_17592_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|17572_17854_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_162678359.1|18131_19112_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	98.8	2.6e-184
WP_087893729.1|19417_20691_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.8e-146
WP_001752509.1|20764_21265_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_001067855.1|21591_22296_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000993245.1|22495_22708_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|22670_22790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652270.1|22773_23010_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|23006_23372_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|23389_25075_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|25113_25539_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|25566_25842_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294653.1|25857_26253_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|26324_26780_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_022652268.1|26873_27857_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	39.4	1.3e-47
WP_162678362.1|30553_31522_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	4.3e-184
WP_001395480.1|32343_33375_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_069219812.1|33261_33519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322250.1|33650_34181_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	35.8	2.9e-17
WP_008322246.1|34185_34383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008322245.1|34888_35920_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_008322243.1|36206_37160_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_008322240.1|37224_38757_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	1.9e-16
WP_004113181.1|38743_39763_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_008322237.1|39840_41211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322235.1|41207_42128_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_008322233.1|42673_43090_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261276.1|43086_43317_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_008322227.1|43569_44592_-	helicase UvrD	NA	NA	NA	NA	NA
WP_001067855.1|44677_45382_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000215515.1|45784_46141_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|49037_49742_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_003124096.1|49796_50357_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
WP_001138070.1|50359_53326_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_000427619.1|53404_54409_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|54590_54767_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|55096_55912_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|55972_56776_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_162678363.1|56775_57612_+	APH(6)-I family aminoglycoside O-phosphotransferase	NA	NA	NA	NA	NA
WP_001120891.1|57583_58123_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|58332_59193_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|59375_59933_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000608644.1|60496_61759_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|62014_62890_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|62936_63269_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_162678364.1|66143_66839_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	98.1	5.1e-126
>prophage 2
NZ_CP048381	Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence	164790	78297	99959	164790	transposase	Escherichia_phage(57.14%)	17	NA	NA
WP_004152403.1|78297_81195_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
WP_000509965.1|81289_81895_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001351729.1|82671_83064_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|83201_84086_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|84117_85317_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|85422_86073_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032140899.1|86104_86347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|87968_88673_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|88816_89371_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|89501_90332_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|90963_91668_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|93855_94560_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001097412.1|95961_96525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348195.1|96548_96923_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001515734.1|96987_97551_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000046891.1|97793_98129_+	thermonuclease family protein	NA	G8DH70	Emiliania_huxleyi_virus	35.7	2.8e-05
WP_001067855.1|99254_99959_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
