The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048020	Treponema sp. OMZ 804 chromosome, complete genome	2980180	995294	1001271	2980180		Burkholderia_phage(16.67%)	15	NA	NA
WP_162663087.1|995294_995666_+	HNH endonuclease	NA	Q3HQV7	Burkholderia_phage	40.2	4.7e-22
WP_162663089.1|995658_995973_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_162663091.1|995997_996327_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162663093.1|996331_996949_+	master DNA invertase Mpi family serine-type recombinase	NA	H2A0H0	Bacteroides_phage	69.1	1.1e-68
WP_162663095.1|996945_997434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663097.1|997486_997822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663099.1|997889_998552_+	HTH domain-containing protein	NA	Q0H241	Geobacillus_phage	36.2	6.3e-17
WP_162663101.1|998555_998702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663103.1|998708_998984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663105.1|998980_999202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663107.1|999204_999549_+	DUF1064 domain-containing protein	NA	B0VK09	Azospirillum_phage	48.9	5.7e-14
WP_162663109.1|999602_999791_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_162663111.1|999787_1000183_+	HicB family protein	NA	A0A0C5AN56	Paenibacillus_phage	40.2	5.2e-19
WP_162663113.1|1000213_1000588_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162663115.1|1000710_1001271_+	ParB N-terminal domain-containing protein	NA	U3PCR3	Lactobacillus_phage	50.0	1.7e-31
>prophage 2
NZ_CP048020	Treponema sp. OMZ 804 chromosome, complete genome	2980180	1015802	1070083	2980180	tail,head,integrase	Paenibacillus_phage(100.0%)	36	1044298:1044357	1077583:1077674
WP_162663152.1|1015802_1016195_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_162663154.1|1016191_1016587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663156.1|1016599_1016968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663158.1|1018036_1018615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663160.1|1018790_1023602_+|tail	phage tail tape measure protein	tail	A0A0K2CYF4	Paenibacillus_phage	32.8	1.2e-45
WP_162664744.1|1023641_1024349_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_162663162.1|1024345_1026934_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_162663164.1|1026937_1027780_+	ATP synthase F0 subunit B	NA	NA	NA	NA	NA
WP_162663166.1|1028326_1028689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663168.1|1028681_1028909_+	LamG domain-containing protein	NA	NA	NA	NA	NA
WP_162663170.1|1028877_1030557_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_162663172.1|1030777_1031212_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_162664745.1|1031224_1032475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162663174.1|1033130_1033553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663176.1|1033684_1034785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663178.1|1034757_1035120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663181.1|1035222_1036623_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_162663183.1|1036957_1037269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162664746.1|1037280_1037520_+	hypothetical protein	NA	NA	NA	NA	NA
1044298:1044357	attL	AACCACGGACATCCCTGTCCGTTCTGATACGTTGAGTATTTTCAGCAGCGGCGCGCAGTA	NA	NA	NA	NA
WP_162664747.1|1044673_1045378_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_016522149.1|1046358_1046547_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_162663185.1|1046562_1046796_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_162663187.1|1055010_1055898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663189.1|1056016_1056376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663191.1|1056566_1057253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663193.1|1057260_1057863_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_162663195.1|1060512_1060695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663197.1|1060834_1061044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663199.1|1063345_1063813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663201.1|1064322_1064610_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_162663203.1|1064881_1065163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162663205.1|1065493_1066177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162661907.1|1066585_1066777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663206.1|1066721_1068581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663208.1|1068683_1069262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663210.1|1069246_1070083_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1077583:1077674	attR	AACCACGGACATCCCTGTCCGTTCTGATACGTTGAGTATTTTCAGCAGCGGCGCGCAGTATATACCCTTTCCGTAAGCCTTTTGAAATAGAC	NA	NA	NA	NA
>prophage 3
NZ_CP048020	Treponema sp. OMZ 804 chromosome, complete genome	2980180	1788661	1846477	2980180	tRNA,transposase	Gordonia_phage(30.0%)	58	NA	NA
WP_162663766.1|1788661_1789132_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_162663767.1|1789283_1790762_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_162663768.1|1790851_1791565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162663769.1|1791638_1792214_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	34.4	3.3e-14
WP_162663770.1|1792298_1794041_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	22.1	6.7e-34
WP_162663771.1|1794173_1796687_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_162663772.1|1796891_1799162_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	28.4	1.6e-27
WP_162663773.1|1799163_1800042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162663774.1|1800219_1801776_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_162663775.1|1801876_1802788_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_162663776.1|1802816_1803683_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_162663777.1|1803754_1805050_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_162663778.1|1805282_1805933_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_162663779.1|1807101_1807614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044012752.1|1807933_1808182_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_006188554.1|1808196_1808430_+	KH domain-containing protein	NA	NA	NA	NA	NA
WP_162663780.1|1808429_1808954_+	16S rRNA processing protein RimM	NA	NA	NA	NA	NA
WP_162663781.1|1808950_1809697_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_162663782.1|1809674_1810034_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_162663783.1|1810039_1811017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663784.1|1811072_1811348_+	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_162663785.1|1811331_1812564_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_162664817.1|1812563_1812935_+	YraN family protein	NA	NA	NA	NA	NA
WP_162663786.1|1813109_1813511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663787.1|1816428_1816713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162663788.1|1816728_1816887_-	rubredoxin	NA	NA	NA	NA	NA
WP_162663789.1|1817086_1817470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663790.1|1817515_1818508_+	radical SAM protein	NA	NA	NA	NA	NA
WP_162663791.1|1818754_1819432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162663792.1|1819510_1821475_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_162663793.1|1821611_1823786_-	TIGR03545 family protein	NA	NA	NA	NA	NA
WP_162663794.1|1823788_1824301_-	TIGR03546 family protein	NA	NA	NA	NA	NA
WP_162663795.1|1824470_1824686_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162663796.1|1824915_1825602_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_162663797.1|1825684_1826803_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162663798.1|1826795_1828382_+	MiaB/RimO family radical SAM methylthiotransferase	NA	NA	NA	NA	NA
WP_162663799.1|1828475_1828784_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162664818.1|1828780_1829095_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_162663800.1|1829315_1829606_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	45.8	3.2e-18
WP_162663801.1|1829607_1829931_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	46.0	1.5e-16
WP_162663802.1|1830613_1832266_+	nucleoside kinase	NA	NA	NA	NA	NA
WP_162663803.1|1832577_1833156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162663804.1|1833426_1834062_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162663805.1|1834324_1836106_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.6	6.9e-26
WP_162663806.1|1836178_1836415_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162664819.1|1836417_1837323_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	25.3	2.4e-11
WP_162663807.1|1837441_1837669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162663808.1|1837697_1838129_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_162663809.1|1838166_1838484_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_162663810.1|1838455_1838722_+	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_162663811.1|1838797_1840555_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	1.6e-30
WP_162663442.1|1840635_1840926_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162663812.1|1840930_1841785_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	25.3	2.3e-11
WP_162663813.1|1842003_1842210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162664820.1|1842188_1844642_+	InlB B-repeat-containing protein	NA	NA	NA	NA	NA
WP_162663440.1|1845011_1845242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162664821.1|1845614_1845791_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162663814.1|1845766_1846477_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	25.0	1.1e-06
>prophage 4
NZ_CP048020	Treponema sp. OMZ 804 chromosome, complete genome	2980180	1956835	1993142	2980180	terminase,integrase,protease,head,capsid	Bacillus_phage(22.22%)	28	1960547:1960562	1970227:1970242
WP_162663892.1|1956835_1957738_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A097EYL9	Mycobacterium_phage	33.0	6.6e-17
1960547:1960562	attL	CTGTCCAAAAACTGAA	NA	NA	NA	NA
WP_162664830.1|1960587_1963962_+	type I restriction-modification system endonuclease	NA	A0A291AXA8	Shigella_phage	27.2	1.9e-05
WP_162663893.1|1963977_1965408_+	N-6 DNA methylase	NA	A0A220A2U5	Liberibacter_phage	27.8	1.7e-19
WP_162663894.1|1965404_1966220_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_162663895.1|1966247_1967864_+	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	28.7	2.5e-11
WP_162664831.1|1968354_1968759_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_162663896.1|1968758_1968998_-	DUF2281 domain-containing protein	NA	NA	NA	NA	NA
WP_162663897.1|1969332_1970142_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0H4TI16	Erysipelothrix_phage	27.8	1.7e-19
WP_162663898.1|1970267_1970921_-	hypothetical protein	NA	NA	NA	NA	NA
1970227:1970242	attR	TTCAGTTTTTGGACAG	NA	NA	NA	NA
WP_162663899.1|1971337_1971481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162663900.1|1971855_1973163_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_162663901.1|1973907_1975008_+	slipin family protein	NA	L7RCW8	Acanthamoeba_polyphaga_moumouvirus	22.7	9.1e-13
WP_162663902.1|1975018_1977532_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.8	8.1e-73
WP_162663903.1|1978175_1978358_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_162663904.1|1978431_1978794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162663905.1|1978956_1979253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162663906.1|1979280_1982487_-	LamG domain-containing protein	NA	NA	NA	NA	NA
WP_162663907.1|1982488_1984771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162663908.1|1984798_1984951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162663909.1|1985043_1985367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162663910.1|1985377_1986352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664832.1|1986381_1986816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162663911.1|1986821_1987286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162663912.1|1987292_1987802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162663913.1|1987876_1988929_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_162663914.1|1988942_1989704_-|head,protease	HK97 family phage prohead protease	head,protease	A0A288WFX1	Bacillus_phage	37.8	2.6e-19
WP_162664833.1|1990975_1992439_-|terminase	terminase large subunit	terminase	A0A1B0RXJ8	Streptococcus_phage	34.0	8.9e-64
WP_162663915.1|1992638_1993142_-|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
>prophage 5
NZ_CP048020	Treponema sp. OMZ 804 chromosome, complete genome	2980180	2641520	2696861	2980180	terminase,integrase,tRNA,capsid,portal	Bacillus_phage(23.08%)	55	2636020:2636037	2700424:2700441
2636020:2636037	attL	TGAAGATATTGCGCTGCT	NA	NA	NA	NA
WP_162664415.1|2641520_2643263_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_162664416.1|2643479_2644190_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_162664417.1|2645633_2647874_+	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	31.2	1.6e-08
WP_162664418.1|2647870_2648680_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_162664419.1|2648710_2651968_+	cell division protein FtsK	NA	S5VNE3	Mycobacterium_phage	47.8	1.6e-84
WP_162664420.1|2652034_2654128_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.7	9.3e-06
WP_162664421.1|2654142_2654895_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_162664422.1|2654943_2656683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664423.1|2656663_2657107_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_162664424.1|2657109_2658195_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_162664425.1|2660213_2661104_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_162664426.1|2661451_2662384_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	52.8	1.9e-19
WP_162664427.1|2662712_2662997_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_162664428.1|2662935_2663421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162661910.1|2663433_2664084_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_162661911.1|2664146_2664692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664429.1|2665604_2666114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664430.1|2666116_2666533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664431.1|2666568_2667855_-	DUF2715 domain-containing protein	NA	NA	NA	NA	NA
WP_162661912.1|2668802_2669309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044014234.1|2669528_2669771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162664432.1|2669751_2670171_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_162664433.1|2670296_2670509_-	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_162664434.1|2671095_2672490_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_162664435.1|2672556_2672934_-	hypothetical protein	NA	A0A2K9V3K4	Faecalibacterium_phage	41.0	1.2e-12
WP_162664436.1|2673101_2673260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162664437.1|2673280_2674348_+	hypothetical protein	NA	F6K8R9	Clostridium_phage	34.7	6.8e-05
WP_162664438.1|2674382_2675090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162664439.1|2675082_2678940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664440.1|2678917_2679292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664441.1|2679310_2679772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664442.1|2679768_2680104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664443.1|2680100_2682758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664444.1|2682757_2683336_-	hypothetical protein	NA	B3GW12	Streptococcus_phage	34.0	1.1e-06
WP_162664445.1|2683345_2683867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664446.1|2683893_2684283_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_162664447.1|2684260_2684620_-|capsid	minor capsid protein	capsid	I1TLE6	Bacillus_phage	47.1	1.4e-18
WP_162664448.1|2684616_2684952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664449.1|2684963_2685302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664450.1|2685309_2685489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664451.1|2685559_2686429_-	hypothetical protein	NA	A0A1S5SAC9	Streptococcus_phage	34.6	2.2e-33
WP_162664452.1|2686453_2687008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664453.1|2687144_2687633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664859.1|2687640_2688126_-	hypothetical protein	NA	A0A0Y0AEU3	Bacillus_phage	53.7	2.3e-40
WP_162664454.1|2688156_2688606_-	M15 family metallopeptidase	NA	A0A2P0PAE7	Pectobacterium_phage	29.5	7.5e-06
WP_162664455.1|2688608_2689301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664456.1|2689304_2689832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664457.1|2690059_2690785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664458.1|2690788_2691139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664459.1|2691135_2691300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664460.1|2691407_2691617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664461.1|2691613_2693590_-|capsid	minor capsid protein	capsid	A0A0A8WHV3	Clostridium_phage	29.2	2.3e-38
WP_162664462.1|2693602_2694127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664463.1|2694143_2695529_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_162664464.1|2695556_2696861_-|terminase	PBSX family phage terminase large subunit	terminase	B6CXD2	Clostridium_phage	37.8	1.4e-73
2700424:2700441	attR	TGAAGATATTGCGCTGCT	NA	NA	NA	NA
>prophage 6
NZ_CP048020	Treponema sp. OMZ 804 chromosome, complete genome	2980180	2700731	2706854	2980180		Proteus_phage(16.67%)	10	NA	NA
WP_162664473.1|2700731_2701646_-	hypothetical protein	NA	A0A1P8DTG2	Proteus_phage	36.9	8.1e-07
WP_162664474.1|2701672_2702281_-	site-specific DNA-methyltransferase	NA	X2KR14	Campylobacter_phage	44.9	4.7e-51
WP_162664475.1|2702349_2703090_-	hypothetical protein	NA	A0A2H4JG85	uncultured_Caudovirales_phage	34.2	1.5e-30
WP_162664476.1|2703094_2703427_-	hypothetical protein	NA	A0A1J1J9S3	Escherichia_phage	34.2	1.5e-06
WP_162664477.1|2703492_2703672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664478.1|2703686_2704067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664479.1|2704080_2704383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664480.1|2704386_2704818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162664481.1|2705583_2705982_-	single-stranded DNA-binding protein	NA	A6M990	Geobacillus_virus	37.8	2.3e-14
WP_162664482.1|2705978_2706854_-	DUF2188 domain-containing protein	NA	A0A1B1ITH1	uncultured_Mediterranean_phage	33.0	5.2e-35
