The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	0	59843	2942932	head,portal,protease,tRNA,holin,terminase,tail,capsid	Listeria_phage(69.7%)	63	NA	NA
WP_163621710.1|0_1644_+|terminase	terminase large subunit	terminase	A8AT95	Listeria_phage	98.9	0.0e+00
WP_163621711.1|1655_2786_+|portal	phage portal protein	portal	A0A059T6F0	Listeria_phage	97.1	3.2e-210
WP_163621712.1|2782_3580_+|protease	Clp protease ClpP	protease	A0A059T5F2	Listeria_phage	95.1	2.8e-136
WP_163621713.1|3606_4758_+|capsid	phage major capsid protein	capsid	A0A059T678	Listeria_phage	93.7	7.2e-202
WP_003731645.1|4944_5244_+	hypothetical protein	NA	A8ATA0	Listeria_phage	100.0	5.3e-48
WP_110097852.1|5227_5593_+|head,tail	phage head-tail adapter protein	head,tail	A8ATA1	Listeria_phage	95.0	2.1e-62
WP_163621714.1|5589_5991_+	hypothetical protein	NA	A8ATA2	Listeria_phage	97.7	2.3e-67
WP_163621715.1|5987_6371_+	DUF3168 domain-containing protein	NA	A8ATA3	Listeria_phage	96.1	2.3e-64
WP_046326023.1|6392_6980_+|tail	phage tail protein	tail	A8ATA4	Listeria_phage	98.5	9.9e-107
WP_009917698.1|7051_7384_+	hypothetical protein	NA	A8ATA5	Listeria_phage	99.1	1.8e-52
WP_163621716.1|7598_12521_+|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	92.6	0.0e+00
WP_061109159.1|12517_14167_+|tail	phage tail protein	tail	A0A059T682	Listeria_phage	96.9	0.0e+00
WP_163621717.1|14182_16477_+	hypothetical protein	NA	A0A059T7Y6	Listeria_phage	92.7	0.0e+00
WP_163621761.1|16466_17561_+	carbohydrate-binding protein CenC	NA	A0A059T7R4	Listeria_phage	90.1	1.0e-189
WP_039380821.1|17608_17911_+	hypothetical protein	NA	A0A059T5E6	Listeria_phage	93.1	5.9e-39
WP_150985121.1|17910_18177_+|holin	phage holin	holin	A0A059T684	Listeria_phage	95.5	5.2e-39
WP_163621718.1|18176_19019_+	M15 family peptidase	NA	A0A059T7Y8	Listeria_phage	82.0	4.2e-127
WP_003731799.1|19420_20020_+	N-acetyltransferase	NA	Q9T197	Listeria_phage	91.5	8.3e-101
WP_012581438.1|20090_20540_-	anti-CRISPR protein AcrIIA1	NA	Q9T196	Listeria_phage	97.3	3.8e-74
WP_012581437.1|20544_20895_-	AcrIIA2 family anti-CRISPR protein	NA	Q9T195	Listeria_phage	98.3	1.2e-56
WP_163621719.1|20926_21304_-	anti-CRISPR protein AcrIIA3	NA	Q9T194	Listeria_phage	99.2	1.7e-67
WP_009933529.1|21603_21837_+	hypothetical protein	NA	R4IDW6	Listeria_phage	78.9	2.8e-28
WP_009933528.1|21833_22025_+	hypothetical protein	NA	R4IBI5	Listeria_phage	88.9	8.9e-25
WP_014600783.1|22615_23878_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_009924171.1|23919_24513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009914084.1|24666_25074_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_014600785.1|25238_25838_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.5	1.7e-29
WP_003723543.1|25869_26130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014600786.1|26253_27666_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-51
WP_003723545.1|27690_27954_+	DUF3116 family protein	NA	NA	NA	NA	NA
WP_003723546.1|28122_28599_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003723547.1|28637_28883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723548.1|28879_30085_-	MFS transporter	NA	NA	NA	NA	NA
WP_003723549.1|30289_30949_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003723550.1|30990_31185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723551.1|31251_32100_-	YitT family protein	NA	NA	NA	NA	NA
WP_009931701.1|32719_33433_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_014600787.1|33463_35110_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003723556.1|35128_36613_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_003723557.1|36728_37181_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_012951571.1|37227_37692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723559.1|37880_38801_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003723560.1|38820_40068_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.8	1.2e-106
WP_003723561.1|40051_40882_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	4.3e-47
WP_014600789.1|41017_42157_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|42237_42633_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|42783_42999_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010989719.1|43117_43651_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003732795.1|43668_44334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014600790.1|44595_45534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|45648_46932_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|47116_48376_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_009924620.1|48494_49061_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_009924619.1|49095_49665_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003723889.1|49766_50309_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003723890.1|50318_51182_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003723891.1|51178_51964_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	3.0e-26
WP_003723892.1|52097_52958_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_014600791.1|53229_55308_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	4.1e-107
WP_009924616.1|55370_56675_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_009911635.1|56957_57860_+	tyrosine recombinase XerC	NA	A0A097EYL9	Mycobacterium_phage	28.6	1.2e-13
WP_003724001.1|57880_58420_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_010989722.1|58433_59843_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	27.7	4.9e-43
>prophage 2
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	63756	68180	2942932		Bacillus_virus(100.0%)	2	NA	NA
WP_003723731.1|63756_65724_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	6.7e-123
WP_010989723.1|65720_68180_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.6	4.7e-102
>prophage 3
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	72951	75731	2942932		Pseudomonas_phage(50.0%)	2	NA	NA
WP_012951576.1|72951_74820_-	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	31.9	6.5e-43
WP_003723737.1|75032_75731_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	32.4	1.3e-12
>prophage 4
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	82234	86218	2942932		Klosneuvirus(33.33%)	4	NA	NA
WP_003723435.1|82234_83569_+	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	26.4	2.0e-06
WP_014600796.1|83712_85008_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	61.6	2.4e-145
WP_003723437.1|85051_85573_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003723438.1|85603_86218_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.1	9.3e-15
>prophage 5
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	90536	97223	2942932		Streptococcus_phage(60.0%)	8	NA	NA
WP_014600798.1|90536_91268_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	58.7	4.4e-80
WP_003723445.1|91289_91796_-	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	66.7	4.0e-56
WP_003723446.1|91805_93110_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	52.1	9.5e-134
WP_010989732.1|93099_94305_-	helicase SNF2	NA	L0P6E9	Lactobacillus_phage	47.1	4.9e-92
WP_003723448.1|94282_94657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723449.1|94949_95678_+	UMP kinase	NA	NA	NA	NA	NA
WP_003723450.1|95677_96235_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_014600799.1|96464_97223_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.1	4.4e-22
>prophage 6
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	102308	114061	2942932	tRNA	Clostridium_phage(33.33%)	10	NA	NA
WP_003732817.1|102308_106643_+	DNA polymerase III subunit alpha	NA	A0A0A7RWA3	Clostridium_phage	35.1	8.6e-22
WP_003732818.1|106824_107292_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003722453.1|107321_108440_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003722454.1|108454_108739_+	YlxR family protein	NA	NA	NA	NA	NA
WP_003729918.1|108731_109031_+	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_003732820.1|109053_111399_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.4	3.0e-21
WP_003722457.1|111395_111674_+	DUF503 domain-containing protein	NA	NA	NA	NA	NA
WP_003719600.1|111690_112035_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_003722458.1|112132_113047_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_012951584.1|113116_114061_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	33.3	1.8e-09
>prophage 7
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	129482	132292	2942932		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_014600805.1|129482_130829_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.0	7.6e-62
WP_003722477.1|130825_132292_+	glycine dehydrogenase subunit 2	NA	E3ST28	Prochlorococcus_phage	43.0	2.1e-89
>prophage 8
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	138853	142579	2942932		Enterococcus_phage(33.33%)	5	NA	NA
WP_003726249.1|138853_139708_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	40.5	7.8e-36
WP_010990104.1|139726_141079_+	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	34.5	2.7e-30
WP_003722489.1|141068_141296_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_014600808.1|141298_142180_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003719639.1|142378_142579_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	75.8	1.3e-21
>prophage 9
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	149962	151390	2942932		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_014600811.1|149962_151390_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.5	6.5e-43
>prophage 10
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	156304	160042	2942932		Bacillus_phage(66.67%)	3	NA	NA
WP_163621721.1|156304_157723_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A0P0C6S9	Ostreococcus_lucimarinus_virus	28.9	3.5e-41
WP_003719652.1|157913_158594_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.3	8.7e-30
WP_003727467.1|158590_160042_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	1.4e-24
>prophage 11
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	164433	175459	2942932		Streptococcus_phage(50.0%)	8	NA	NA
WP_003727465.1|164433_165360_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	31.0	5.0e-28
WP_010990110.1|165511_167785_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.0	2.4e-84
WP_003722513.1|167817_168657_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_003722514.1|169009_170083_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003732280.1|170515_172057_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	29.3	2.0e-13
WP_003723915.1|172049_173102_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003723916.1|173098_174049_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010990111.1|174166_175459_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	30.8	1.9e-54
>prophage 12
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	180782	181829	2942932		Bacillus_phage(100.0%)	1	NA	NA
WP_003732286.1|180782_181829_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	68.5	6.0e-131
>prophage 13
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	185600	194053	2942932		Catovirus(25.0%)	5	NA	NA
WP_014600816.1|185600_188183_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.9	8.7e-38
WP_014600817.1|188202_190008_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.6	8.9e-74
WP_003721910.1|190024_190573_+	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_014600818.1|190998_193230_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	43.4	2.5e-182
WP_003721912.1|193306_194053_+	pyruvate formate lyase-activating protein	NA	E5DI79	Enterobacter_phage	35.3	2.5e-06
>prophage 14
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	214411	218830	2942932	holin	Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_003721933.1|214411_215605_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y1V5	Organic_Lake_phycodnavirus	29.6	3.2e-11
WP_003732329.1|215896_216457_-	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_014600825.1|216705_217089_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_014600826.1|217228_218830_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.3	5.5e-51
>prophage 15
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	228342	228951	2942932		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003732335.1|228342_228951_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	58.6	1.4e-68
>prophage 16
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	234692	238766	2942932		Staphylococcus_phage(33.33%)	4	NA	NA
WP_010990125.1|234692_235466_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.1e-15
WP_014600832.1|235608_236535_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_014600833.1|236550_237444_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.2	2.5e-21
WP_003721956.1|237458_238766_-	DEAD-box ATP-dependent RNA helicase CshB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.7	4.8e-45
>prophage 17
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	241842	244942	2942932		Vibrio_phage(50.0%)	2	NA	NA
WP_003721960.1|241842_242967_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	37.6	8.4e-38
WP_003721961.1|243061_244942_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.4	5.9e-60
>prophage 18
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	255630	262516	2942932		Catovirus(50.0%)	7	NA	NA
WP_003721973.1|255630_256590_-	PhoH family protein	NA	L7TP00	Rhizobium_phage	48.1	1.5e-48
WP_003736634.1|256777_257224_-	GatB/YqeY domain-containing protein	NA	G3MAQ0	Bacillus_virus	38.5	1.6e-16
WP_003719762.1|257243_257417_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003721977.1|257614_258382_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_010990133.1|258382_259327_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_010990134.1|259399_260533_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.2	1.1e-26
WP_003721980.1|260674_262516_-	molecular chaperone DnaK	NA	A0A1V0SAK3	Catovirus	46.7	6.2e-139
>prophage 19
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	267218	273534	2942932		Streptococcus_phage(33.33%)	5	NA	NA
WP_003721987.1|267218_269045_-	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	23.9	6.2e-22
WP_003726526.1|269277_269532_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_003721989.1|269617_270649_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_003721990.1|270716_272939_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	37.0	5.7e-38
WP_003721991.1|272973_273534_-	ComE operon protein 2	NA	A0A127AWN5	Bacillus_phage	57.5	3.8e-31
>prophage 20
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	283458	284088	2942932		Tupanvirus(100.0%)	1	NA	NA
WP_003732602.1|283458_284088_-	uridine kinase	NA	A0A2K9L178	Tupanvirus	36.7	3.6e-30
>prophage 21
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	287853	323762	2942932	tRNA	Bacillus_phage(33.33%)	29	NA	NA
WP_014600845.1|287853_290493_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	33.8	4.1e-67
WP_003723691.1|290799_291495_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_014600846.1|291503_293006_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014600847.1|293172_293859_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.1	1.8e-35
WP_010990146.1|293855_295295_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.1	5.0e-35
WP_014600848.1|295336_297733_-	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	32.6	9.8e-44
WP_010990147.1|297760_298399_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012951642.1|298439_299180_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014600849.1|299297_300413_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_014600850.1|300431_301580_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	38.1	5.8e-34
WP_014600851.1|301959_303243_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.7	1.3e-111
WP_163621723.1|303391_303814_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003723520.1|304058_305264_+	ammonium transporter	NA	NA	NA	NA	NA
WP_003723521.1|305277_305643_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_003727404.1|305792_306173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723523.1|306211_307987_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SJ84	Klosneuvirus	24.6	1.1e-12
WP_010989736.1|307989_309267_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014600852.1|309717_311001_+	SH3 domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	35.5	3.1e-20
WP_014600853.1|311037_311490_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_003723527.1|311505_313722_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	S4TRQ0	Salmonella_phage	40.5	4.0e-07
WP_003723528.1|313927_314449_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.8	2.5e-29
WP_003733816.1|314438_316790_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	32.6	3.3e-84
WP_003723530.1|316895_317240_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_003723531.1|317335_319600_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.2	9.3e-20
WP_003723532.1|319700_319991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723533.1|320133_320463_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	42.5	1.4e-09
WP_003723534.1|320496_321636_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.4	2.2e-86
WP_003723535.1|321722_322751_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003723536.1|322754_323762_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.7	1.6e-08
>prophage 22
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	331768	332086	2942932	protease	Enterococcus_phage(100.0%)	1	NA	NA
WP_003732583.1|331768_332086_-|protease	ribosomal-processing cysteine protease Prp	protease	D2J003	Enterococcus_phage	31.4	1.4e-06
>prophage 23
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	341558	344210	2942932	tRNA	Catovirus(100.0%)	1	NA	NA
WP_014600857.1|341558_344210_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	41.9	9.2e-160
>prophage 24
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	350584	361233	2942932	tRNA	Tupanvirus(20.0%)	8	NA	NA
WP_014600859.1|350584_352507_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.4	3.6e-105
WP_003732568.1|352856_353780_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	28.9	6.2e-31
WP_014600860.1|353789_355166_-	helicase DnaB	NA	NA	NA	NA	NA
WP_003723246.1|355171_355636_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_014600861.1|355713_356316_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_014600862.1|356332_357154_-	DNA-formamidopyrimidine glycosylase	NA	G3MA33	Bacillus_virus	35.1	3.1e-34
WP_014600863.1|357177_359805_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.5	7.7e-50
WP_010989744.1|359970_361233_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.2	1.7e-10
>prophage 25
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	368853	373237	2942932		Streptomyces_phage(50.0%)	2	NA	NA
WP_010989746.1|368853_372180_-	DNA polymerase III subunit alpha	NA	A0A1C9LWZ5	Streptomyces_phage	30.6	1.5e-146
WP_014600866.1|372301_373237_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	G3MA01	Bacillus_virus	24.7	2.0e-16
>prophage 26
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	381978	386113	2942932		Wolbachia_phage(33.33%)	4	NA	NA
WP_010989751.1|381978_382992_-	signal peptide peptidase SppA	NA	F8QZT1	Wolbachia_phage	31.2	2.5e-17
WP_003723315.1|383170_383974_+	NAD kinase	NA	NA	NA	NA	NA
WP_003723316.1|384005_384956_-	ornithine carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	26.6	2.8e-18
WP_014600869.1|384952_386113_-	acetylornithine transaminase	NA	A0A249XSK4	Mycobacterium_phage	25.3	4.3e-13
>prophage 27
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	396652	399241	2942932	tRNA	Cronobacter_phage(50.0%)	2	NA	NA
WP_003727370.1|396652_397912_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	44.4	2.5e-91
WP_003732549.1|398233_399241_-	catabolite control protein A	NA	C6ZCU4	Enterobacteria_phage	27.7	1.4e-20
>prophage 28
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	405517	409605	2942932		Mycobacterium_phage(50.0%)	3	NA	NA
WP_014600875.1|405517_407872_-	DNA translocase FtsK	NA	Q853W3	Mycobacterium_phage	52.0	1.1e-90
WP_003723572.1|408181_408799_-	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_003723573.1|408804_409605_-	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	58.6	1.9e-36
>prophage 29
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	427982	430334	2942932		Acinetobacter_phage(100.0%)	3	NA	NA
WP_003723936.1|427982_428741_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	38.3	7.2e-33
WP_003723937.1|428737_429757_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	37.1	2.1e-56
WP_003733215.1|429728_430334_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	46.4	2.2e-40
>prophage 30
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	436013	436934	2942932		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003733218.1|436013_436934_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.7	1.5e-37
>prophage 31
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	444038	447257	2942932		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_014600882.1|444038_447257_-	DEAD/DEAH box helicase family protein	NA	A0A1B1ISM1	uncultured_Mediterranean_phage	27.0	1.2e-33
>prophage 32
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	453556	457115	2942932		Bacillus_phage(100.0%)	2	NA	NA
WP_014600886.1|453556_455362_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	3.5e-46
WP_014600887.1|455345_457115_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.6	2.1e-51
>prophage 33
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	463881	471460	2942932	tRNA	Staphylococcus_phage(80.0%)	5	NA	NA
WP_022741847.1|463881_466293_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	70.7	0.0e+00
WP_014600892.1|466696_467662_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	64.2	1.4e-49
WP_014600893.1|467658_468234_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	43.9	5.1e-39
WP_009930749.1|468258_470124_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	29.4	1.8e-37
WP_003733235.1|470260_471460_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	69.8	2.5e-149
>prophage 34
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	478673	482018	2942932		Staphylococcus_phage(100.0%)	4	NA	NA
WP_003723260.1|478673_479147_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	42.4	5.7e-20
WP_003723261.1|479220_479487_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_012951687.1|479636_480590_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014930965.1|480608_482018_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	33.7	2.2e-67
>prophage 35
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	489801	492091	2942932		Pandoravirus(100.0%)	2	NA	NA
WP_014600901.1|489801_490974_-	cystathionine beta-lyase	NA	A0A0B5JD48	Pandoravirus	26.5	5.0e-17
WP_014600902.1|490966_492091_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	30.8	1.6e-17
>prophage 36
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	508119	511641	2942932		Trichoplusia_ni_ascovirus(50.0%)	4	NA	NA
WP_014600905.1|508119_508866_-	enoyl-[acyl-carrier-protein] reductase FabL	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.3	1.7e-10
WP_015454856.1|508869_509967_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003723878.1|510167_511148_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_009924860.1|511179_511641_-	dUTP diphosphatase	NA	Q2WG49	Clostridium_botulinum_D_phage	58.3	5.1e-42
>prophage 37
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	518964	523509	2942932		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_003733114.1|518964_519867_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.2	7.8e-10
WP_014600909.1|519894_520101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014600910.1|520135_520489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014600911.1|520517_520919_-	FosX/FosE/FosI family fosfomycin resistance thiol transferase	NA	NA	NA	NA	NA
WP_003733116.1|520933_522313_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	38.9	3.7e-88
WP_003733117.1|522377_522758_-	OsmC family protein	NA	NA	NA	NA	NA
WP_012951751.1|522864_523509_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	44.4	1.4e-42
>prophage 38
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	537548	540363	2942932		Catovirus(50.0%)	3	NA	NA
WP_014600913.1|537548_538874_-	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	30.0	3.2e-36
WP_003722200.1|538916_539690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003722201.1|539682_540363_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	34.2	4.6e-15
>prophage 39
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	559002	564276	2942932		Bacillus_phage(33.33%)	6	NA	NA
WP_009932115.1|559002_559521_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	41.6	1.6e-28
WP_010989799.1|559523_560630_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_009912711.1|560721_561537_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003722216.1|561538_562186_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.8	2.4e-29
WP_003729791.1|562196_562838_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010989801.1|563235_564276_-	sensor histidine kinase	NA	Q6XLV6	Feldmannia_irregularis_virus	28.7	3.4e-09
>prophage 40
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	570190	576432	2942932		Planktothrix_phage(33.33%)	7	NA	NA
WP_003722224.1|570190_570958_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	3.1e-28
WP_014600919.1|571085_571595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003722226.1|571818_572292_+	shikimate kinase	NA	NA	NA	NA	NA
WP_014600920.1|572322_572877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014600921.1|573211_574573_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	49.9	1.3e-120
WP_003722229.1|574596_575352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003722230.1|575499_576432_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.6	1.4e-17
>prophage 41
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	581019	585255	2942932		Ralstonia_phage(50.0%)	2	NA	NA
WP_014600923.1|581019_583035_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	38.8	1.1e-115
WP_022741854.1|583059_585255_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.5	2.9e-135
>prophage 42
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	589593	601038	2942932		Prochlorococcus_phage(37.5%)	11	NA	NA
WP_014600927.1|589593_591123_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.7	7.6e-74
WP_014600928.1|591128_591695_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	39.1	1.3e-26
WP_014600929.1|591691_592741_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	8.3e-64
WP_003722245.1|592759_594187_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_014600930.1|594171_596391_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.2	1.0e-159
WP_003733240.1|596383_597067_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|597070_597316_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003733239.1|597327_598041_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.7	2.7e-42
WP_014600931.1|598121_599414_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.6	5.5e-17
WP_031695688.1|599432_600557_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003722253.1|600549_601038_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.0	8.1e-22
>prophage 43
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	607154	612864	2942932		Golden_Marseillevirus(25.0%)	9	NA	NA
WP_003723983.1|607154_607760_-	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	25.9	4.9e-08
WP_014600933.1|607824_608598_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	29.9	1.7e-13
WP_009925961.1|608647_609010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014600934.1|609028_610261_-	peptidase T	NA	NA	NA	NA	NA
WP_014600935.1|610318_610849_-	DUF1697 domain-containing protein	NA	NA	NA	NA	NA
WP_003723988.1|610932_611688_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	48.1	2.4e-60
WP_003720097.1|611727_612087_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003720098.1|612126_612327_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_010958948.1|612348_612864_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	38.7	4.1e-16
>prophage 44
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	633114	635081	2942932		Acanthamoeba_polyphaga_lentillevirus(33.33%)	3	NA	NA
WP_012951781.1|633114_633804_-	ribonuclease III	NA	J2YAN1	Acanthamoeba_polyphaga_lentillevirus	31.2	1.5e-24
WP_003723866.1|633997_634231_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	39.3	1.7e-06
WP_010989818.1|634337_635081_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	A0A0G2Y924	Acanthamoeba_polyphaga_mimivirus	31.8	3.3e-06
>prophage 45
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	646453	660178	2942932	tRNA	Pandoravirus(33.33%)	12	NA	NA
WP_014600944.1|646453_648421_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	32.8	6.0e-23
WP_003723065.1|648417_649176_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_003733095.1|649198_650533_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_009930505.1|650533_651472_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.9	4.3e-11
WP_010989822.1|651485_653879_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_010989823.1|653883_655083_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.0	7.1e-43
WP_003728294.1|655237_655441_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003725659.1|655440_656058_-	guanylate kinase	NA	S4W1R9	Pandoravirus	32.9	1.0e-13
WP_010989824.1|656076_656952_-	YicC family protein	NA	NA	NA	NA	NA
WP_003723073.1|657108_658821_+	fibronectin/fibrinogen-binding protein	NA	Q84500	Paramecium_bursaria_Chlorella_virus	36.6	3.4e-06
WP_003723074.1|658908_659508_+	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_003723075.1|659548_660178_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	34.1	3.0e-29
>prophage 46
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	665775	673397	2942932		Halovirus(25.0%)	8	NA	NA
WP_003723080.1|665775_666867_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	37.6	1.1e-61
WP_012951791.1|666863_668144_-	dihydroorotase	NA	NA	NA	NA	NA
WP_014600946.1|668131_669043_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	29.9	1.2e-26
WP_003723083.1|669126_670413_-	uracil transporter	NA	Q9KX94	Enterobacteria_phage	35.8	2.3e-60
WP_003729510.1|670541_671093_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_003733083.1|671323_671554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003733835.1|671641_672466_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_003724126.1|672485_673397_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.8	1.4e-11
>prophage 47
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	678560	683972	2942932		Staphylococcus_phage(33.33%)	5	NA	NA
WP_003733074.1|678560_679283_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.4	3.9e-12
WP_003733073.1|679442_679859_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003733072.1|679895_681386_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.4	1.1e-21
WP_014600948.1|681539_681746_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_003723407.1|681758_683972_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.9	7.8e-112
>prophage 48
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	692957	695597	2942932		Vibrio_phage(100.0%)	1	NA	NA
WP_014600953.1|692957_695597_+	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	39.2	6.0e-87
>prophage 49
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	700375	708089	2942932		Bacillus_phage(40.0%)	8	NA	NA
WP_003723427.1|700375_700858_-	dihydrofolate reductase	NA	J9PU01	Bacillus_phage	47.6	5.7e-28
WP_014600956.1|700873_701818_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.4	3.7e-119
WP_014600957.1|701830_703723_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.4	1.4e-56
WP_014600958.1|703842_705525_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_014930987.1|705681_706110_-	transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_003728273.1|706474_706675_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	63.6	8.4e-18
WP_003732066.1|706797_707199_+	ribonuclease HI family protein	NA	NA	NA	NA	NA
WP_003732065.1|707216_708089_-	5'-3' exonuclease	NA	A0A0N7ACJ6	Bacillus_phage	36.2	2.0e-39
>prophage 50
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	716813	717419	2942932		Bacillus_phage(100.0%)	1	NA	NA
WP_003723001.1|716813_717419_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	2.2e-24
>prophage 51
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	721998	727924	2942932	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_003723006.1|721998_723291_-|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	30.8	7.1e-57
WP_003723007.1|723304_724486_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003723008.1|724508_725093_-	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_014600960.1|725137_727924_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.2	2.8e-50
>prophage 52
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	731856	739307	2942932	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_014600961.1|731856_733038_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	40.4	2.0e-34
WP_003723016.1|733052_733457_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_014600962.1|733472_734264_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_003723018.1|734260_734596_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_003723019.1|734735_735602_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	43.0	3.6e-65
WP_003723020.1|735591_736698_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003723021.1|737017_738154_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.5	8.8e-19
WP_003732050.1|738179_739307_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	2.7e-20
>prophage 53
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	742765	749710	2942932		Klosneuvirus(25.0%)	6	NA	NA
WP_014600964.1|742765_743773_+	serine hydrolase	NA	A0A1V0SLG8	Klosneuvirus	27.3	1.7e-05
WP_003723027.1|744007_746287_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	37.7	4.8e-141
WP_012951811.1|746332_747598_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	57.9	1.8e-28
WP_003728748.1|747711_748395_-	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_003732043.1|748480_749077_-	DUF1405 domain-containing protein	NA	NA	NA	NA	NA
WP_003723904.1|749164_749710_-	YpiB family protein	NA	G3MAV7	Bacillus_virus	39.8	4.8e-31
>prophage 54
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	753553	761556	2942932		Faustovirus(16.67%)	10	NA	NA
WP_014600967.1|753553_754636_-	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	24.6	5.4e-18
WP_009924600.1|754635_755010_-	chorismate mutase	NA	NA	NA	NA	NA
WP_014600968.1|755006_756104_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_003723911.1|756106_757273_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	39.0	7.1e-48
WP_014600969.1|757476_757920_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	48.1	3.1e-28
WP_003732038.1|757938_758904_-	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	21.4	1.7e-07
WP_003726790.1|758914_759628_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_014600970.1|759650_760418_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_003724029.1|760476_761046_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	47.2	2.4e-41
WP_003720260.1|761280_761556_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	69.7	2.0e-25
>prophage 55
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	769819	783553	2942932		Bacillus_phage(37.5%)	14	NA	NA
WP_009931427.1|769819_771223_-	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	38.6	2.2e-56
WP_009931429.1|771219_772227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723591.1|772381_772606_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	46.6	4.6e-12
WP_003732031.1|772647_773259_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003723593.1|773699_774218_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003723594.1|774233_776024_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	36.2	2.3e-37
WP_003723595.1|776124_776841_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.4	1.2e-45
WP_003723596.1|777023_777758_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_003723597.1|777760_778357_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	30.8	1.2e-11
WP_003723598.1|778353_779103_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.0	2.7e-08
WP_003732029.1|779118_780429_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_003723600.1|780609_781428_-	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	43.2	2.3e-61
WP_014600971.1|781446_782631_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_012951821.1|782659_783553_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	32.3	1.3e-41
>prophage 56
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	787654	795072	2942932		Lactobacillus_phage(40.0%)	8	NA	NA
WP_003732025.1|787654_788479_+	ABC transporter ATP-binding protein	NA	F2Y165	Organic_Lake_phycodnavirus	22.4	4.8e-06
WP_003723126.1|788468_789467_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.4	2.5e-17
WP_003723127.1|789482_790103_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014600972.1|790102_790918_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010679823.1|790914_791802_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.8	1.2e-18
WP_003723131.1|792402_792960_-	NUDIX hydrolase	NA	A0A2K9VDH1	Lactobacillus_phage	34.8	5.3e-17
WP_003723132.1|793235_793895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723133.1|793872_795072_+	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	29.1	8.4e-36
>prophage 57
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	803599	805075	2942932		Cyanophage(100.0%)	1	NA	NA
WP_003723144.1|803599_805075_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.2	8.6e-83
>prophage 58
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	809164	814168	2942932		Yellowstone_lake_phycodnavirus(50.0%)	4	NA	NA
WP_003732013.1|809164_810886_+	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.1	7.3e-57
WP_003723150.1|810886_811378_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_008948311.1|811476_812472_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003723152.1|812629_814168_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	25.5	8.6e-09
>prophage 59
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	819416	820718	2942932		Geobacillus_virus(100.0%)	1	NA	NA
WP_010989861.1|819416_820718_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	59.5	2.1e-133
>prophage 60
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	847835	857022	2942932	tRNA	Lactococcus_phage(33.33%)	8	NA	NA
WP_003723180.1|847835_848036_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	1.7e-18
WP_014600984.1|848324_849020_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_014600985.1|849033_850023_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_014600986.1|850134_852900_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	27.9	6.3e-87
WP_003723184.1|853182_853710_-	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_003723185.1|853803_854325_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_014600987.1|854329_855436_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_014600988.1|855567_857022_+	L-aspartate oxidase	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	27.6	1.7e-22
>prophage 61
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	885370	894772	2942932		uncultured_Mediterranean_phage(50.0%)	10	NA	NA
WP_014601000.1|885370_887611_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.5	3.6e-141
WP_014601001.1|887652_888693_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_014601002.1|888711_889194_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	44.7	9.8e-28
WP_003731966.1|889196_889754_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003726138.1|889850_890132_-	YlbG family protein	NA	NA	NA	NA	NA
WP_003724095.1|890162_890612_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_014601003.1|890659_891715_-	CAP domain-containing protein	NA	A0A0E3T7R5	Bacillus_phage	35.7	8.5e-16
WP_003733858.1|891861_892767_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_003731964.1|893003_893921_+	heme A synthase	NA	NA	NA	NA	NA
WP_003734055.1|894028_894772_+	potassium channel family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	32.5	6.2e-13
>prophage 62
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	899407	909176	2942932	protease,tRNA	uncultured_virus(40.0%)	9	NA	NA
WP_003723950.1|899407_900385_-	choloylglycine hydrolase family protein	NA	M1HS66	Paramecium_bursaria_Chlorella_virus	29.2	1.0e-23
WP_003726503.1|900642_902271_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.0	1.8e-158
WP_003726504.1|902306_902591_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.3	9.8e-20
WP_003731957.1|902826_903513_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003722328.1|903514_903718_+	DUF4305 domain-containing protein	NA	NA	NA	NA	NA
WP_003722329.1|903744_904392_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_163621729.1|904702_906655_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.3	5.7e-58
WP_003722331.1|906678_907638_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003731954.1|908153_909176_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.3	8.1e-64
>prophage 63
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	920984	926522	2942932		Moumouvirus(50.0%)	4	NA	NA
WP_014601012.1|920984_922028_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.5	5.2e-34
WP_009926995.1|922242_923457_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_014601013.1|923460_924831_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_003731943.1|924998_926522_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.9	3.9e-22
>prophage 64
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	932688	934134	2942932		Streptococcus_phage(100.0%)	1	NA	NA
WP_009925710.1|932688_934134_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.1	4.9e-22
>prophage 65
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	948053	952137	2942932		Planktothrix_phage(50.0%)	4	NA	NA
WP_003722374.1|948053_948821_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	3.7e-29
WP_014601020.1|948807_950748_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003722376.1|950790_951615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014601021.1|951675_952137_+	GNAT family N-acetyltransferase	NA	E9LUK4	Lactobacillus_phage	40.8	1.4e-23
>prophage 66
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	977733	978636	2942932		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_003722263.1|977733_978636_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.9	2.0e-21
>prophage 67
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	983667	984805	2942932	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_095177159.1|983667_984805_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	69.1	4.1e-48
>prophage 68
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	989517	997645	2942932		Listeria_phage(80.0%)	9	NA	NA
WP_003722273.1|989517_989835_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	58.4	2.2e-28
WP_003722274.1|990033_990210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003722275.1|990251_990551_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_003722276.1|990657_990984_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003722277.1|990980_991418_-	flavodoxin	NA	A0A060AFY8	Listeria_phage	38.6	2.5e-22
WP_003729560.1|991414_992464_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A059T7I4	Listeria_phage	85.1	2.1e-168
WP_003722279.1|992519_994811_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A060AGL6	Listeria_phage	72.8	0.0e+00
WP_014601031.1|995347_995689_+	YxeA family protein	NA	NA	NA	NA	NA
WP_014601032.1|995743_997645_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.4	6.8e-157
>prophage 69
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1005359	1005977	2942932		Streptococcus_phage(100.0%)	1	NA	NA
WP_003731912.1|1005359_1005977_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	47.1	6.4e-48
>prophage 70
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1012182	1014190	2942932		Bacillus_phage(50.0%)	2	NA	NA
WP_003722298.1|1012182_1013256_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.8	5.8e-20
WP_014601039.1|1013428_1014190_-	SDR family oxidoreductase	NA	A0A0G2Y8L6	Acanthamoeba_polyphaga_mimivirus	31.9	6.3e-05
>prophage 71
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1024098	1026159	2942932		Listeria_phage(50.0%)	3	NA	NA
WP_163621730.1|1024098_1024575_-	siphovirus Gp157 family protein	NA	A0A059T5F1	Listeria_phage	48.1	2.2e-32
WP_163621731.1|1024635_1025376_-	class B sortase	NA	NA	NA	NA	NA
WP_014601044.1|1025379_1026159_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	29.2	1.6e-16
>prophage 72
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1031194	1037954	2942932		Streptococcus_phage(33.33%)	6	NA	NA
WP_003722312.1|1031194_1033000_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	28.5	1.1e-66
WP_009912419.1|1033072_1034188_-	CoiA	NA	NA	NA	NA	NA
WP_003722314.1|1034313_1034967_-	adaptor protein MecA	NA	NA	NA	NA	NA
WP_003720569.1|1035198_1035594_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003722315.1|1035912_1036881_-	ATP-binding cassette domain-containing protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	28.0	6.6e-07
WP_012951901.1|1036877_1037954_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.3	8.4e-19
>prophage 73
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1047721	1052830	2942932		Brevibacillus_phage(50.0%)	4	NA	NA
WP_012951903.1|1047721_1048849_-	GW domain-containing glycosaminoglycan-binding protein	NA	S5M633	Brevibacillus_phage	45.5	1.1e-24
WP_003763532.1|1049171_1049360_+	YjzD family protein	NA	NA	NA	NA	NA
WP_003723823.1|1049449_1050139_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003723824.1|1050229_1052830_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.7	8.8e-123
>prophage 74
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1059941	1061277	2942932		Staphylococcus_phage(50.0%)	2	NA	NA
WP_003723833.1|1059941_1060694_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	2.9e-26
WP_003723834.1|1060854_1061277_+	HIT family protein	NA	B5LJ12	Mycobacterium_phage	33.6	9.9e-08
>prophage 75
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1068513	1068867	2942932		Streptococcus_phage(100.0%)	1	NA	NA
WP_003723354.1|1068513_1068867_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	32.4	3.1e-07
>prophage 76
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1072413	1073319	2942932		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003731881.1|1072413_1073319_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.7	4.7e-31
>prophage 77
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1089047	1093071	2942932		Acanthamoeba_polyphaga_mimivirus(33.33%)	6	NA	NA
WP_014601057.1|1089047_1089530_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	42.6	3.7e-19
WP_014931010.1|1089675_1090236_+	methylphosphotriester-DNA--protein-cysteine methyltransferase family protein	NA	NA	NA	NA	NA
WP_003731874.1|1090257_1091127_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003723377.1|1091139_1091532_-	hypothetical protein	NA	V5UQY3	Oenococcus_phage	51.2	1.1e-32
WP_003723378.1|1091533_1092190_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_012951917.1|1092186_1093071_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	29.7	9.5e-29
>prophage 78
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1096735	1100822	2942932		Planktothrix_phage(33.33%)	4	NA	NA
WP_003724134.1|1096735_1097461_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	4.4e-32
WP_003731868.1|1097536_1098685_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_009931351.1|1098727_1099357_-	HAD family hydrolase	NA	G3MA51	Bacillus_virus	35.6	8.1e-06
WP_003733871.1|1099529_1100822_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	4.2e-49
>prophage 79
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1108289	1111997	2942932		Bacillus_virus(100.0%)	1	NA	NA
WP_014601063.1|1108289_1111997_-	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	27.3	8.1e-21
>prophage 80
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1116771	1117119	2942932		Clostridium_phage(100.0%)	1	NA	NA
WP_003739618.1|1116771_1117119_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	40.7	9.9e-06
>prophage 81
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1121012	1122338	2942932		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_003731859.1|1121012_1122338_+	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	38.0	8.6e-82
>prophage 82
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1128354	1129134	2942932		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003722585.1|1128354_1129134_-	amino acid ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	23.1	4.1e-07
>prophage 83
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1137364	1138606	2942932		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014601109.1|1137364_1138606_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	36.8	7.3e-59
>prophage 84
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1162982	1166734	2942932		Planktothrix_phage(50.0%)	5	NA	NA
WP_003722398.1|1162982_1163663_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	1.1e-35
WP_022741865.1|1163705_1164020_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003722400.1|1164264_1165626_+	aspartate kinase	NA	NA	NA	NA	NA
WP_014601113.1|1165667_1166063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003722402.1|1166149_1166734_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	40.3	2.4e-28
>prophage 85
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1179458	1180454	2942932		Streptococcus_phage(100.0%)	1	NA	NA
WP_003722416.1|1179458_1180454_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	61.3	2.1e-40
>prophage 86
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1185766	1186267	2942932		Bacillus_virus(100.0%)	1	NA	NA
WP_003725592.1|1185766_1186267_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	54.8	6.8e-40
>prophage 87
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1191950	1192793	2942932		Golden_Marseillevirus(100.0%)	1	NA	NA
WP_003732461.1|1191950_1192793_-	DUF72 domain-containing protein	NA	A0A1D6Y809	Golden_Marseillevirus	28.6	2.7e-17
>prophage 88
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1196475	1200248	2942932		Mycobacterium_phage(33.33%)	4	NA	NA
WP_003722439.1|1196475_1196919_-	SUF system NifU family Fe-S cluster assembly protein	NA	A0A2P1CJL8	Mycobacterium_phage	35.8	1.6e-13
WP_014601122.1|1196915_1198142_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	45.1	6.7e-105
WP_014601123.1|1198142_1199444_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003722442.1|1199462_1200248_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	28.1	2.1e-11
>prophage 89
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1203271	1212498	2942932		Bacillus_phage(40.0%)	11	NA	NA
WP_014601124.1|1203271_1204294_-	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.2	5.0e-29
WP_003722448.1|1204610_1204799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003722449.1|1204877_1206020_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.7	5.0e-22
WP_003722450.1|1206009_1206705_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.7	3.8e-41
WP_003732468.1|1206779_1207655_-	cation transporter	NA	NA	NA	NA	NA
WP_003723326.1|1207847_1208132_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003723327.1|1208216_1208594_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_003723328.1|1208634_1208988_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	57.8	6.5e-29
WP_003723329.1|1209143_1210319_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_003723330.1|1210394_1211564_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_014601125.1|1211706_1212498_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	30.0	7.0e-15
>prophage 90
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1219818	1221526	2942932		Paenibacillus_phage(50.0%)	3	NA	NA
WP_009925285.1|1219818_1220160_+	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	40.7	8.0e-08
WP_003723342.1|1220191_1220575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014601126.1|1220629_1221526_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	28.2	2.7e-07
>prophage 91
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1233257	1236119	2942932		Staphylococcus_phage(50.0%)	2	NA	NA
WP_003723350.1|1233257_1233722_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	68.1	1.6e-51
WP_014601129.1|1233737_1236119_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.4	4.6e-94
>prophage 92
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1239544	1240837	2942932		Streptococcus_phage(100.0%)	1	NA	NA
WP_003727923.1|1239544_1240837_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	71.7	2.3e-172
>prophage 93
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1253160	1255933	2942932		Brevibacillus_phage(33.33%)	3	NA	NA
WP_012952013.1|1253160_1253496_+	membrane protein	NA	S5MNN8	Brevibacillus_phage	76.6	6.0e-16
WP_014601134.1|1253743_1255180_-	chitin-binding protein	NA	A0A2D1GD28	Mycobacterium_phage	29.1	9.8e-07
WP_003722600.1|1255336_1255933_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	6.6e-58
>prophage 94
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1259851	1267695	2942932		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722604.1|1259851_1260823_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003722605.1|1260830_1261799_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.3	6.7e-68
WP_010990001.1|1261800_1262676_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	3.2e-08
WP_014601136.1|1262783_1264514_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.3	4.3e-174
WP_003734087.1|1264555_1265617_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_014601137.1|1265633_1266617_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	37.2	1.6e-48
WP_003722610.1|1266735_1267695_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 95
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1275912	1278783	2942932		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003722620.1|1275912_1278783_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	58.7	0.0e+00
>prophage 96
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1282438	1285294	2942932		Bacillus_virus(66.67%)	4	NA	NA
WP_003722626.1|1282438_1282744_-	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	40.6	9.6e-05
WP_003722627.1|1283012_1283672_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003722628.1|1283684_1284464_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.2	2.4e-15
WP_003725427.1|1284478_1285294_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.1	1.9e-15
>prophage 97
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1288383	1300538	2942932	protease	Bacillus_phage(28.57%)	10	NA	NA
WP_014601141.1|1288383_1290159_-	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	37.1	1.3e-37
WP_009924808.1|1290158_1290869_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.7	7.4e-40
WP_003722635.1|1291018_1292194_-|protease	serine protease	protease	NA	NA	NA	NA
WP_003722636.1|1292221_1293670_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_003722637.1|1293792_1295103_-	peptidoglycan DD-metalloendopeptidase family protein	NA	G9BW84	Planktothrix_phage	35.5	6.6e-10
WP_003722638.1|1295222_1296428_-	peptidase P60	NA	A0A0K0NL58	Gordonia_phage	40.7	1.2e-05
WP_003732506.1|1296503_1297388_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003720823.1|1297377_1298064_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	30.7	5.0e-25
WP_003722640.1|1298567_1299431_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	34.5	1.2e-39
WP_096823716.1|1299436_1300538_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	3.2e-05
>prophage 98
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1304773	1308867	2942932		Streptococcus_phage(66.67%)	4	NA	NA
WP_009924458.1|1304773_1306093_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	37.4	2.1e-72
WP_003722646.1|1306288_1307140_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	37.1	9.9e-15
WP_003722647.1|1307160_1307847_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003733915.1|1308231_1308867_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	45.5	7.1e-42
>prophage 99
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1313731	1315321	2942932		Bacillus_phage(50.0%)	2	NA	NA
WP_003733917.1|1313731_1314565_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	60.4	1.3e-22
WP_003732514.1|1314955_1315321_-	single-stranded DNA-binding protein	NA	Q0ILF5	Lactococcus_phage	48.7	2.2e-27
>prophage 100
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1328781	1334413	2942932		Aeromonas_phage(33.33%)	6	NA	NA
WP_003732521.1|1328781_1330023_-	serine hydroxymethyltransferase	NA	A0A240F2Y9	Aeromonas_phage	53.1	5.9e-101
WP_014601150.1|1330158_1330566_-	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_003723473.1|1330562_1331600_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	42.0	3.7e-64
WP_010990011.1|1331900_1332752_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003726351.1|1332738_1333815_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_003723476.1|1333837_1334413_-	thymidine kinase	NA	A0A0A0Q2F0	Pectobacterium_bacteriophage	51.4	6.6e-47
>prophage 101
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1338737	1339685	2942932		Shigella_phage(100.0%)	1	NA	NA
WP_003724106.1|1338737_1339685_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	43.9	2.3e-65
>prophage 102
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1347253	1421083	2942932	integrase,protease,tRNA,holin,terminase,tail,capsid	Listeria_phage(80.77%)	84	1385986:1386035	1421171:1421220
WP_003732527.1|1347253_1348174_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	28.4	2.6e-21
WP_014601151.1|1348490_1351244_+	GW domain-containing glycosaminoglycan-binding protein	NA	A0A288WFW6	Bacillus_phage	29.4	2.9e-23
WP_014601152.1|1351287_1352886_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.2	6.5e-153
WP_014601153.1|1353252_1353789_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_014601154.1|1354154_1355825_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003723610.1|1355821_1356271_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003723611.1|1356348_1357002_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003723612.1|1357075_1357261_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_009924630.1|1357295_1358618_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.2	2.6e-30
WP_003723614.1|1358632_1359469_-	lipoyl-[GcvH]:protein N-lipoyltransferase	NA	NA	NA	NA	NA
WP_003723615.1|1359786_1359987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003729275.1|1360009_1360333_-	YxeA family protein	NA	NA	NA	NA	NA
WP_014601155.1|1360487_1362149_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003726112.1|1362284_1362899_-	SdpI family protein	NA	NA	NA	NA	NA
WP_003733267.1|1362922_1363555_-	nicotinamidase	NA	NA	NA	NA	NA
WP_003723621.1|1363555_1364080_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_014601156.1|1364082_1365081_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010990017.1|1365177_1365450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723624.1|1365498_1366410_-	cation transporter	NA	NA	NA	NA	NA
WP_014931025.1|1366535_1371128_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_014931026.1|1371348_1372176_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_014601159.1|1372290_1373166_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003723278.1|1373176_1373470_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014601160.1|1373502_1373664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014601161.1|1373732_1374401_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.0	3.8e-38
WP_003733261.1|1374400_1375489_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014601162.1|1375567_1376947_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	44.0	6.4e-56
WP_012952041.1|1376943_1377621_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	48.0	3.4e-58
WP_003723284.1|1377667_1378453_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_014601163.1|1378514_1378991_-	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_014601164.1|1378990_1381978_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_009931305.1|1382476_1383319_+	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein	NA	NA	NA	NA	NA
WP_014601165.1|1383366_1384848_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_014601166.1|1384948_1385836_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
1385986:1386035	attL	TTAAGCCACTTGTCGGATTTGAACCGACGACCCCTTCCTTACCATGGAAG	NA	NA	NA	NA
WP_061104720.1|1386406_1386640_-	hypothetical protein	NA	A0A059T6E1	Listeria_phage	97.4	2.8e-36
WP_039380811.1|1387334_1387559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133254337.1|1387555_1388074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039380814.1|1388513_1389257_-	M15 family metallopeptidase	NA	A8ASL5	Listeria_phage	65.5	2.8e-74
WP_012951558.1|1389256_1389514_-|holin	phage holin	holin	A8ATB7	Listeria_phage	69.0	3.2e-25
WP_012951557.1|1389513_1389816_-	hypothetical protein	NA	A0A059T5E6	Listeria_phage	93.0	1.7e-38
WP_072239157.1|1389863_1392029_-	hypothetical protein	NA	A8ATW1	Listeria_phage	93.8	0.0e+00
WP_072239155.1|1392041_1393610_-|tail	phage tail protein	tail	A8ATW0	Listeria_phage	98.5	5.8e-303
WP_163621735.1|1393606_1398406_-|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	89.1	0.0e+00
WP_072217631.1|1398410_1398722_-	hypothetical protein	NA	A0A0B5D116	Listeria_phage	93.4	2.5e-40
WP_014601497.1|1398718_1399150_-	hypothetical protein	NA	A0A0B5D0B8	Listeria_phage	99.3	1.1e-73
WP_163621736.1|1399205_1399895_-	Ig domain-containing protein	NA	A8ATV6	Listeria_phage	86.5	8.6e-102
WP_003725064.1|1399899_1400271_-	hypothetical protein	NA	A8ATV5	Listeria_phage	100.0	8.5e-64
WP_014601499.1|1400267_1400585_-	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	98.1	1.4e-51
WP_003725065.1|1400574_1400940_-	hypothetical protein	NA	A0A0B5D114	Listeria_phage	95.0	4.2e-63
WP_057171511.1|1400939_1401293_-	hypothetical protein	NA	A8ATV2	Listeria_phage	86.3	1.4e-52
WP_077945102.1|1401293_1401446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096832394.1|1401445_1402309_-|capsid	capsid protein	capsid	U3PDP8	Lactobacillus_phage	50.4	5.8e-71
WP_070778361.1|1403002_1404046_-|capsid	minor capsid protein	capsid	A0A0B5D111	Listeria_phage	96.8	7.7e-195
WP_070778363.1|1404050_1405589_-	hypothetical protein	NA	A8ATU7	Listeria_phage	61.2	1.4e-176
WP_163621737.1|1405603_1406923_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0B5CYJ6	Listeria_phage	86.9	4.6e-229
WP_070778368.1|1406861_1407632_-	TerS	NA	A0A0B5CTX0	Listeria_phage	69.9	3.6e-80
WP_070778370.1|1407671_1407899_-	hypothetical protein	NA	A0A0B5CTV3	Listeria_phage	92.0	1.2e-31
WP_163621738.1|1407957_1408128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031669409.1|1408343_1408778_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	88.9	3.0e-68
WP_096832398.1|1408915_1409320_-	hypothetical protein	NA	A8AU00	Listeria_phage	91.8	7.6e-66
WP_141009415.1|1409285_1409426_-	BH0509 family protein	NA	A8ATZ9	Listeria_phage	82.6	6.1e-15
WP_070778375.1|1409422_1409728_-	response regulator	NA	A8ATZ8	Listeria_phage	65.3	6.2e-28
WP_163621739.1|1409747_1410230_-	single-stranded DNA-binding protein	NA	A8ASP5	Listeria_phage	83.1	2.5e-71
WP_119724297.1|1410226_1410487_-	hypothetical protein	NA	A0A059T5G2	Listeria_phage	91.7	2.4e-41
WP_163621740.1|1410689_1410887_-	hypothetical protein	NA	A8ASP4	Listeria_phage	73.4	1.8e-20
WP_163621741.1|1410883_1411273_-	pentapeptide repeat-containing protein	NA	A8ATE4	Listeria_phage	66.5	5.6e-42
WP_031659537.1|1411269_1411479_-	hypothetical protein	NA	A8ASN7	Listeria_phage	64.2	1.6e-14
WP_163621742.1|1411653_1412583_-	DnaD domain-containing protein	NA	A8ATY7	Listeria_phage	90.9	2.3e-150
WP_031644198.1|1412602_1413418_-	recombinase RecT	NA	Q9T172	Listeria_phage	94.8	1.7e-144
WP_045553633.1|1413420_1414380_-	hypothetical protein	NA	Q9T173	Listeria_phage	83.4	5.7e-152
WP_003733629.1|1414611_1414800_-	hypothetical protein	NA	Q9T175	Listeria_phage	80.6	1.2e-21
WP_031644321.1|1414899_1415106_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069017952.1|1415095_1415626_-	hypothetical protein	NA	A8ATY1	Listeria_phage	86.7	1.9e-77
WP_163621743.1|1415747_1416536_-	phage antirepressor Ant	NA	Q9T178	Listeria_phage	93.9	2.1e-136
WP_015967160.1|1416599_1416797_+	hypothetical protein	NA	Q9T179	Listeria_phage	100.0	6.2e-21
WP_039390226.1|1416798_1417080_-	hypothetical protein	NA	A0A059T671	Listeria_phage	95.7	2.1e-38
WP_120215057.1|1417076_1417313_-	hypothetical protein	NA	A0A059T5E9	Listeria_phage	97.4	1.3e-36
WP_060587047.1|1417377_1417737_+	DUF2513 domain-containing protein	NA	A0A2H4J4K9	uncultured_Caudovirales_phage	25.4	1.0e-05
WP_061662968.1|1417695_1417890_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	92.2	2.6e-24
WP_003731220.1|1417893_1418145_-	helix-turn-helix transcriptional regulator	NA	A8ATX6	Listeria_phage	100.0	7.6e-40
WP_015987417.1|1418293_1418602_+	helix-turn-helix transcriptional regulator	NA	A8ATX5	Listeria_phage	100.0	9.3e-48
WP_070216149.1|1418632_1419124_+	hypothetical protein	NA	A8ATX4	Listeria_phage	98.2	1.4e-90
WP_070216148.1|1419150_1419858_+	hypothetical protein	NA	A0A0B5CTT6	Listeria_phage	98.7	9.1e-123
WP_069017956.1|1419919_1421083_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	31.7	1.1e-51
1421171:1421220	attR	TTAAGCCACTTGTCGGATTTGAACCGACGACCCCTTCCTTACCATGGAAG	NA	NA	NA	NA
>prophage 103
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1428109	1430529	2942932		Brevibacillus_phage(50.0%)	2	NA	NA
WP_014601167.1|1428109_1429636_+	GW domain-containing glycosaminoglycan-binding protein	NA	A0A0K2CP65	Brevibacillus_phage	48.7	6.9e-27
WP_003723644.1|1429677_1430529_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.0	1.4e-48
>prophage 104
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1443423	1445898	2942932		Bacillus_phage(66.67%)	3	NA	NA
WP_003728531.1|1443423_1444290_-	energy-coupling factor ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.5	1.3e-14
WP_008948839.1|1444265_1445105_-	energy-coupling factor ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	1.2e-17
WP_014601174.1|1445235_1445898_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	45.6	1.8e-19
>prophage 105
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1470533	1471514	2942932		Indivirus(100.0%)	1	NA	NA
WP_003723628.1|1470533_1471514_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	23.7	1.6e-08
>prophage 106
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1482578	1485962	2942932		Klosneuvirus(50.0%)	2	NA	NA
WP_003723640.1|1482578_1483766_-	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	26.7	1.2e-13
WP_003724965.1|1483874_1485962_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.8	1.0e-65
>prophage 107
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1493167	1495253	2942932		Tupanvirus(50.0%)	2	NA	NA
WP_003733054.1|1493167_1494199_-	zinc-binding dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	30.7	1.3e-16
WP_014601183.1|1494200_1495253_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	23.8	2.8e-11
>prophage 108
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1504001	1512143	2942932		Bacillus_phage(25.0%)	6	NA	NA
WP_014601190.1|1504001_1505258_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	41.6	3.4e-80
WP_003722034.1|1505259_1506072_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003722035.1|1506112_1506808_-	response regulator transcription factor	NA	Q56AR1	Bacillus_thuringiensis_phage	29.9	1.2e-05
WP_010990039.1|1506804_1509495_-	sensor histidine kinase KdpD	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.5	1.8e-09
WP_003733061.1|1509510_1510083_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_003733062.1|1510097_1512143_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.0	3.2e-27
>prophage 109
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1519655	1526580	2942932		Acanthocystis_turfacea_Chlorella_virus(33.33%)	5	NA	NA
WP_014601193.1|1519655_1522226_-	magnesium-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	26.0	2.0e-42
WP_009925488.1|1522779_1523346_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014601194.1|1523507_1525280_+	1,4-beta-N-acetylmuramoylhydrolase	NA	Q9ZXE4	Bacillus_phage	42.1	2.0e-17
WP_003722052.1|1525516_1525846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003722053.1|1525953_1526580_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	47.5	4.2e-47
>prophage 110
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1532216	1536156	2942932		Klosneuvirus(50.0%)	5	NA	NA
WP_014601198.1|1532216_1533059_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	26.6	8.0e-25
WP_003722061.1|1533104_1533350_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003722062.1|1533364_1533961_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003722063.1|1534069_1534387_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_014601199.1|1534416_1536156_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	39.2	2.5e-57
>prophage 111
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1544537	1548001	2942932		Bacillus_phage(50.0%)	2	NA	NA
WP_003732089.1|1544537_1546277_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.9	4.1e-23
WP_014601201.1|1546276_1548001_-	thiol reductant ABC exporter subunit CydD	NA	A0A2H4UU96	Bodo_saltans_virus	33.5	9.3e-20
>prophage 112
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1551453	1553031	2942932		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003722080.1|1551453_1553031_+	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.5	2.1e-82
>prophage 113
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1567821	1586042	2942932	tRNA	Bacillus_phage(33.33%)	17	NA	NA
WP_014601211.1|1567821_1568955_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.9	2.7e-44
WP_003722097.1|1568958_1569915_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014601212.1|1569982_1571317_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_014601213.1|1571434_1572124_-	NAD-dependent protein deacylase	NA	A0A068EPD4	Bacillus_phage	30.7	4.7e-23
WP_003732104.1|1572116_1572407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010990057.1|1572396_1573605_-	multidrug efflux MFS transporter Lde	NA	NA	NA	NA	NA
WP_003722102.1|1573721_1574069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003722103.1|1574087_1574732_-	fructose-6-phosphate aldolase	NA	H8ZMU3	Synechococcus_phage	47.7	1.0e-48
WP_003722104.1|1574874_1575564_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_010990058.1|1575893_1577621_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	53.3	2.5e-150
WP_003722106.1|1577674_1577926_-	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_003722107.1|1577945_1579229_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	5.0e-95
WP_003722108.1|1579563_1579983_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_003722109.1|1580112_1580685_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	46.8	2.2e-42
WP_003722110.1|1580681_1582388_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	31.3	8.8e-47
WP_003732111.1|1582548_1584270_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	23.4	2.3e-10
WP_003732112.1|1584269_1586042_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	4.0e-50
>prophage 114
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1589877	1599909	2942932		Tupanvirus(33.33%)	6	NA	NA
WP_014601215.1|1589877_1592031_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	34.1	6.7e-44
WP_014601216.1|1592054_1593827_-	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	37.1	1.1e-79
WP_003722118.1|1593987_1595454_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	8.0e-97
WP_003722119.1|1595739_1596270_-	ADP-ribose-binding protein	NA	A0A0K1L687	Scale_drop_disease_virus	49.3	2.6e-29
WP_014601217.1|1596327_1597938_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	7.5e-48
WP_003725314.1|1598454_1599909_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	30.3	1.9e-50
>prophage 115
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1605603	1606491	2942932		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_003722129.1|1605603_1606491_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.4	3.3e-13
>prophage 116
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1624215	1625682	2942932		Tupanvirus(100.0%)	1	NA	NA
WP_014601223.1|1624215_1625682_-	catalase	NA	A0A2K9L572	Tupanvirus	47.8	1.8e-109
>prophage 117
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1630057	1633969	2942932		Bifidobacterium_phage(66.67%)	5	NA	NA
WP_003722149.1|1630057_1630909_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	32.7	2.5e-18
WP_003722150.1|1630901_1631663_-	ParA family protein	NA	Q8JL10	Natrialba_phage	29.0	4.4e-22
WP_003732136.1|1631886_1632645_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014601226.1|1632803_1633103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010990072.1|1633114_1633969_-	nucleoid occlusion protein	NA	I3NLC2	Bifidobacterium_phage	31.6	4.9e-14
>prophage 118
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1663618	1673547	2942932		Streptococcus_phage(42.86%)	10	NA	NA
WP_009918143.1|1663618_1664806_-	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	54.2	6.2e-116
WP_012951057.1|1664798_1665890_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	61.1	2.0e-121
WP_014601241.1|1666260_1667409_-	MFS transporter	NA	NA	NA	NA	NA
WP_014601242.1|1667422_1667845_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014601243.1|1667947_1668301_-	hypothetical protein	NA	A0A1S7FZ87	Listeria_phage	41.3	7.2e-12
WP_003732155.1|1668494_1669094_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003727589.1|1669149_1669470_-	thioredoxin family protein	NA	A0A0K2FIM3	Achromobacter_phage	31.1	3.6e-10
WP_003727588.1|1669592_1670255_-	beta-phosphoglucomutase	NA	M1I080	Acanthocystis_turfacea_Chlorella_virus	27.5	3.1e-08
WP_014601244.1|1670251_1671373_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	50.0	4.6e-68
WP_014601245.1|1671369_1673547_-	glycoside hydrolase family 65 protein	NA	A0A2P0VNC6	Tetraselmis_virus	24.6	3.9e-07
>prophage 119
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1685506	1686919	2942932		Mycobacterium_phage(100.0%)	1	NA	NA
WP_014601249.1|1685506_1686919_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	27.4	3.6e-30
>prophage 120
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1698598	1707326	2942932		Bacillus_virus(50.0%)	6	NA	NA
WP_003725616.1|1698598_1699744_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	25.7	1.7e-25
WP_003723766.1|1699853_1701197_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_010958651.1|1701376_1701598_+	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	45.6	2.6e-07
WP_003728715.1|1701601_1702714_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003723769.1|1702762_1704703_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	45.4	6.1e-145
WP_003723770.1|1704797_1707326_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	37.6	5.8e-111
>prophage 121
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1728930	1731186	2942932		Bacillus_phage(50.0%)	3	NA	NA
WP_003721652.1|1728930_1729269_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	32.7	2.1e-05
WP_003721653.1|1729304_1730114_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003721654.1|1730130_1731186_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	26.4	3.3e-20
>prophage 122
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1737438	1743168	2942932		Acanthocystis_turfacea_Chlorella_virus(66.67%)	5	NA	NA
WP_003721659.1|1737438_1738464_+	putrescine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.1	1.1e-15
WP_003732183.1|1738536_1739922_+	APC family permease	NA	NA	NA	NA	NA
WP_014600349.1|1739908_1741003_+	agmatine deiminase	NA	M1HES8	Acanthocystis_turfacea_Chlorella_virus	53.5	2.7e-113
WP_003721662.1|1741015_1741957_+	carbamate kinase	NA	NA	NA	NA	NA
WP_009911777.1|1742058_1743168_+	agmatine deiminase	NA	M1HI51	Acanthocystis_turfacea_Chlorella_virus	51.8	4.0e-109
>prophage 123
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1746667	1747204	2942932		Listeria_phage(100.0%)	1	NA	NA
WP_003721668.1|1746667_1747204_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	66.3	1.2e-53
>prophage 124
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1750681	1756927	2942932		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_003721674.1|1750681_1751410_+	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	29.2	6.0e-29
WP_003721675.1|1751576_1753550_+	cyclic-di-AMP phosphodiesterase PdeA	NA	NA	NA	NA	NA
WP_003724881.1|1753552_1753999_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_014600351.1|1754023_1755376_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	54.2	1.0e-122
WP_014600352.1|1755634_1756927_+	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	36.1	2.9e-66
>prophage 125
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1762897	1767717	2942932		Mycobacterium_phage(50.0%)	2	NA	NA
WP_014600356.1|1762897_1767394_+	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	23.5	3.1e-35
WP_003724890.1|1767399_1767717_+	DUF4176 domain-containing protein	NA	A0A1X9I6T6	Streptococcus_phage	40.4	1.0e-12
>prophage 126
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1776119	1779212	2942932		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_003732204.1|1776119_1777076_+	NAD(P)-binding domain-containing protein	NA	M1H502	Paramecium_bursaria_Chlorella_virus	29.6	2.5e-30
WP_014600363.1|1777798_1778587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014600364.1|1778588_1779212_+	TIR domain-containing protein	NA	A0A0S2MYG4	Enterococcus_phage	32.8	5.5e-15
>prophage 127
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1803560	1810377	2942932		Bacillus_phage(66.67%)	4	NA	NA
WP_077346005.1|1803560_1805831_+	chitinase	NA	A0A2K9L3D4	Tupanvirus	32.1	5.8e-38
WP_003721732.1|1805933_1806836_+	ROK family protein	NA	NA	NA	NA	NA
WP_003732216.1|1806860_1808642_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.8	1.7e-53
WP_014600373.1|1808634_1810377_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	4.0e-55
>prophage 128
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1814200	1824927	2942932	tail,holin	Listeria_phage(33.33%)	17	NA	NA
WP_003721739.1|1814200_1814653_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|1814658_1814994_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003732219.1|1815210_1815639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732220.1|1815650_1816067_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	39.3	1.3e-20
WP_014600375.1|1816344_1816734_+	DUF5072 domain-containing protein	NA	NA	NA	NA	NA
WP_003721744.1|1816746_1817259_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|1817306_1817609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009911444.1|1817650_1818055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014600377.1|1818041_1819910_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_003721748.1|1819906_1820725_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	4.2e-39
WP_014600378.1|1820734_1821871_+	minor structural protein	NA	A8ATA9	Listeria_phage	28.9	8.4e-54
WP_003721751.1|1821860_1822160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009931689.1|1822174_1822750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009931691.1|1822764_1823244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732226.1|1823240_1823777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003721755.1|1823795_1824218_+|holin	holin family protein	holin	Q2I8E7	Bacillus_phage	46.3	1.1e-27
WP_010989349.1|1824198_1824927_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	42.5	5.6e-35
>prophage 129
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1828326	1829835	2942932		Klosneuvirus(100.0%)	1	NA	NA
WP_003721759.1|1828326_1829835_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	34.0	1.3e-57
>prophage 130
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1842680	1843385	2942932		Bacillus_virus(100.0%)	1	NA	NA
WP_003723481.1|1842680_1843385_+	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.1	2.5e-19
>prophage 131
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1850861	1852577	2942932		Streptococcus_phage(100.0%)	1	NA	NA
WP_003723487.1|1850861_1852577_+	collagen binding domain-containing protein	NA	F8HGQ4	Streptococcus_phage	33.9	1.3e-13
>prophage 132
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1856959	1860469	2942932		Streptococcus_phage(33.33%)	4	NA	NA
WP_014600397.1|1856959_1857841_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.9	7.7e-63
WP_003723495.1|1857885_1858170_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	51.4	5.8e-12
WP_014600398.1|1858284_1859142_+	glucose transporter GlcU	NA	NA	NA	NA	NA
WP_014600399.1|1859203_1860469_+	DUF1254 domain-containing protein	NA	A0A1J0FA30	Only_Syngen_Nebraska_virus	26.0	1.1e-25
>prophage 133
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1866965	1868963	2942932	tRNA	Hokovirus(100.0%)	1	NA	NA
WP_003722707.1|1866965_1868963_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	33.6	1.1e-101
>prophage 134
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1881893	1883120	2942932		Bacillus_phage(100.0%)	1	NA	NA
WP_003733142.1|1881893_1883120_+	DUF348 domain-containing protein	NA	A0A0S2SXZ8	Bacillus_phage	58.4	2.0e-24
>prophage 135
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1886996	1889408	2942932		Klosneuvirus(50.0%)	3	NA	NA
WP_003722721.1|1886996_1887815_+	pur operon repressor	NA	A0A1V0SKE5	Klosneuvirus	25.4	3.1e-05
WP_003722722.1|1887989_1888667_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003722723.1|1888715_1889408_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	7.2e-32
>prophage 136
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1892420	1894801	2942932		Acanthamoeba_polyphaga_mimivirus(50.0%)	2	NA	NA
WP_003722727.1|1892420_1893794_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	36.5	3.5e-30
WP_061108155.1|1893844_1894801_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	35.8	2.5e-43
>prophage 137
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1904540	1904873	2942932		Rhodobacter_phage(100.0%)	1	NA	NA
WP_003725735.1|1904540_1904873_-	putative heavy metal-binding protein	NA	M4STD1	Rhodobacter_phage	43.5	5.7e-11
>prophage 138
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1915766	1922971	2942932	tRNA	Tupanvirus(33.33%)	5	NA	NA
WP_014600416.1|1915766_1917713_+|tRNA	bifunctional tRNA lysidine(34) synthetase TilS/hypoxanthine phosphoribosyltransferase HprT	tRNA	A0A2K9L634	Tupanvirus	24.5	2.6e-10
WP_003733155.1|1918058_1920134_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	G8DDJ2	Micromonas_pusilla_virus	47.7	3.6e-111
WP_014600417.1|1920249_1921029_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_003723744.1|1921044_1921929_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_003723745.1|1922044_1922971_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	69.5	2.1e-119
>prophage 139
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1926728	1928225	2942932	tRNA	Catovirus(100.0%)	1	NA	NA
WP_014600419.1|1926728_1928225_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	40.4	2.1e-92
>prophage 140
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1941798	1944261	2942932	protease	Enterobacteria_phage(100.0%)	1	NA	NA
WP_096922301.1|1941798_1944261_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.7	7.3e-127
>prophage 141
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1950683	1955584	2942932	tRNA	Moumouvirus(50.0%)	8	NA	NA
WP_014600423.1|1950683_1952099_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	31.0	2.3e-53
WP_003732830.1|1952102_1952513_+	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_003724085.1|1952512_1953268_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_014600424.1|1953270_1953783_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_003732831.1|1953863_1954469_+	RNA polymerase sporulation sigma factor SigH	NA	NA	NA	NA	NA
WP_003728079.1|1954572_1954722_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003728078.1|1954741_1954921_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003726896.1|1955050_1955584_+	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	32.1	2.0e-13
>prophage 142
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1959977	1968986	2942932		Bacillus_phage(33.33%)	3	NA	NA
WP_014600427.1|1959977_1961156_+	RNA-splicing ligase RtcB	NA	X2JMN6	Bacillus_phage	55.1	1.7e-118
WP_003723045.1|1961655_1965210_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.5	2.6e-48
WP_003723046.1|1965380_1968986_+	DNA-directed RNA polymerase subunit beta'	NA	A0A076FGB9	Aureococcus_anophage	25.4	9.9e-56
>prophage 143
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	1984410	2011675	2942932		Bacillus_phage(25.0%)	27	NA	NA
WP_003722891.1|1984410_1985847_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	31.2	5.3e-53
WP_003729164.1|1985966_1986779_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_014600435.1|1986914_1987418_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009924286.1|1987454_1988117_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003722895.1|1988375_1989218_-	MBL fold metallo-hydrolase	NA	Q0H255	Geobacillus_phage	63.1	1.5e-87
WP_014600436.1|1989234_1990056_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_009924288.1|1990172_1991144_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003732853.1|1991182_1992283_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	40.6	5.0e-19
WP_163621749.1|1992573_1994724_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	63.0	5.2e-262
WP_003722900.1|1994716_1995268_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	60.8	3.3e-56
WP_014600437.1|1995517_1996183_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.5	4.7e-12
WP_014600438.1|1996187_1996970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014600439.1|1997041_1997542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014588998.1|1997552_1997873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014600440.1|1997938_1998166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014600441.1|1998240_1998912_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_009930687.1|1999073_1999853_-	carbon-nitrogen family hydrolase	NA	M1I0W4	Acanthocystis_turfacea_Chlorella_virus	25.2	6.1e-11
WP_003722903.1|1999942_2000605_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003722904.1|2000601_2001618_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	1.3e-29
WP_003722905.1|2001632_2002454_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014600442.1|2002836_2004018_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003722907.1|2004230_2004944_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.4	2.6e-45
WP_003722908.1|2005128_2006961_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.3	4.1e-34
WP_003722909.1|2006957_2008280_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003722910.1|2008282_2009122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003722911.1|2009241_2010072_+	MBL fold metallo-hydrolase	NA	A0A0A0RVF5	Bacillus_phage	29.0	8.4e-19
WP_014930814.1|2010169_2011675_+	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	32.6	4.8e-12
>prophage 144
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2015726	2017346	2942932		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014600447.1|2015726_2017346_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	26.3	1.8e-28
>prophage 145
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2069223	2069880	2942932		Synechococcus_phage(100.0%)	1	NA	NA
WP_014600487.1|2069223_2069880_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	46.7	1.5e-47
>prophage 146
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2078108	2079629	2942932		Lactobacillus_phage(100.0%)	1	NA	NA
WP_003723206.1|2078108_2079629_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.9	5.3e-51
>prophage 147
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2086621	2087566	2942932		Streptococcus_phage(100.0%)	1	NA	NA
WP_003723215.1|2086621_2087566_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	24.7	6.0e-05
>prophage 148
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2097703	2098624	2942932		Streptococcus_phage(100.0%)	1	NA	NA
WP_014600494.1|2097703_2098624_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	25.7	1.8e-06
>prophage 149
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2110164	2113549	2942932		Equid_alphaherpesvirus(50.0%)	5	NA	NA
WP_003723102.1|2110164_2110830_+	uracil-DNA glycosylase	NA	A0A2K9QQR6	Equid_alphaherpesvirus	47.5	1.6e-49
WP_003741454.1|2110997_2111297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723104.1|2111293_2112238_+	flotillin-like protein FloA	NA	NA	NA	NA	NA
WP_003723105.1|2112272_2112722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723106.1|2112865_2113549_+	SH3 domain-containing protein	NA	A7KUS1	Bacillus_phage	34.7	3.6e-07
>prophage 150
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2128209	2130813	2942932		Hokovirus(100.0%)	1	NA	NA
WP_014600504.1|2128209_2130813_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	31.2	6.5e-41
>prophage 151
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2135741	2136041	2942932		Bacillus_virus(100.0%)	1	NA	NA
WP_003722968.1|2135741_2136041_-	hypothetical protein	NA	G3MBF7	Bacillus_virus	63.4	1.4e-27
>prophage 152
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2149183	2149930	2942932		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_014600514.1|2149183_2149930_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	26.0	1.6e-05
>prophage 153
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2177945	2178893	2942932		Acidianus_two-tailed_virus(100.0%)	1	NA	NA
WP_003721242.1|2177945_2178893_-	MoxR family ATPase	NA	A0A1C9EGB9	Acidianus_two-tailed_virus	27.8	7.1e-06
>prophage 154
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2198382	2200040	2942932		Bacillus_virus(50.0%)	2	NA	NA
WP_014600538.1|2198382_2199111_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	34.9	1.8e-25
WP_014600539.1|2199146_2200040_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.0	2.1e-07
>prophage 155
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2211946	2215372	2942932		Cyanophage(50.0%)	3	NA	NA
WP_014600545.1|2211946_2212597_+	transaldolase	NA	A0A0C5AMY8	Cyanophage	30.1	7.3e-18
WP_014600546.1|2212705_2214766_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_003733192.1|2214769_2215372_+	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	24.2	1.2e-14
>prophage 156
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2219720	2220656	2942932		Hokovirus(100.0%)	1	NA	NA
WP_163621754.1|2219720_2220656_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	31.7	3.1e-38
>prophage 157
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2237432	2238764	2942932		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_014600556.1|2237432_2238764_+	DUF1254 domain-containing protein	NA	M1I2Z8	Paramecium_bursaria_Chlorella_virus	28.6	3.4e-38
>prophage 158
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2255869	2257063	2942932		Mycobacterium_virus(100.0%)	1	NA	NA
WP_003721334.1|2255869_2257063_+	serine hydrolase	NA	G1BSP8	Mycobacterium_virus	22.8	3.9e-09
>prophage 159
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2270511	2271990	2942932		Acinetobacter_phage(100.0%)	1	NA	NA
WP_014600568.1|2270511_2271990_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	39.9	1.5e-79
>prophage 160
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2278133	2278451	2942932		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_014600569.1|2278133_2278451_-	phosphoribosyl-AMP cyclohydrolase	NA	A0A2H4UVM0	Bodo_saltans_virus	38.1	4.5e-13
>prophage 161
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2285168	2287909	2942932		Streptococcus_phage(50.0%)	3	NA	NA
WP_009924768.1|2285168_2285465_-	MGMT family protein	NA	M1PFU9	Streptococcus_phage	34.0	4.5e-07
WP_003721366.1|2285541_2286573_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003721367.1|2286613_2287909_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.4	4.8e-53
>prophage 162
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2293726	2297347	2942932		Bacillus_phage(33.33%)	4	NA	NA
WP_009925352.1|2293726_2293936_+	hypothetical protein	NA	A0A172JI00	Bacillus_phage	53.0	1.2e-14
WP_003732650.1|2293957_2294614_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012951274.1|2294644_2295829_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	44.6	8.4e-81
WP_014600574.1|2295916_2297347_-	invasion associated endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	50.0	1.1e-18
>prophage 163
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2306055	2307459	2942932		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_014600579.1|2306055_2307459_+	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	32.9	3.6e-62
>prophage 164
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2313407	2314685	2942932		Pandoravirus(100.0%)	1	NA	NA
WP_003723401.1|2313407_2314685_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	26.7	4.0e-12
>prophage 165
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2324340	2327879	2942932		Bacillus_phage(100.0%)	2	NA	NA
WP_012951286.1|2324340_2326065_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	5.8e-46
WP_003732630.1|2326061_2327879_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	1.1e-58
>prophage 166
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2331516	2338788	2942932		Megavirus(25.0%)	9	NA	NA
WP_096922289.1|2331516_2332458_+	NADP-dependent oxidoreductase	NA	A0A2P1EIJ9	Megavirus	25.2	1.9e-06
WP_009924454.1|2332553_2333087_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003722811.1|2333083_2333326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014600590.1|2333432_2335184_+	glycerophosphodiester phosphodiesterase	NA	M1HJV8	Acanthocystis_turfacea_Chlorella_virus	25.3	5.2e-10
WP_003722813.1|2335224_2335719_-	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
WP_010989529.1|2335798_2336941_-	serine/threonine protein kinase	NA	G9BWE0	Planktothrix_phage	31.6	2.0e-15
WP_003722815.1|2337047_2337503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014600591.1|2337558_2337951_+	DUF1398 family protein	NA	NA	NA	NA	NA
WP_014600592.1|2338047_2338788_+	sulfite exporter TauE/SafE family protein	NA	Q6A1Z9	Oenococcus_phage	30.8	7.8e-16
>prophage 167
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2360687	2366045	2942932		Streptococcus_phage(66.67%)	4	NA	NA
WP_014600597.1|2360687_2362568_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.2	8.3e-107
WP_003722841.1|2362663_2363392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732614.1|2363534_2364185_+	transaldolase	NA	A0A0E3HJ81	Synechococcus_phage	27.6	3.4e-15
WP_015454299.1|2364224_2366045_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	28.4	2.2e-48
>prophage 168
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2376026	2376734	2942932		Enterococcus_phage(100.0%)	1	NA	NA
WP_003732609.1|2376026_2376734_+	serine/threonine protein phosphatase	NA	A0A249Y183	Enterococcus_phage	27.8	2.5e-19
>prophage 169
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2383596	2386438	2942932		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_014600601.1|2383596_2384532_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	4.4e-24
WP_003721786.1|2384524_2385295_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_077346033.1|2385553_2386438_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	43.6	3.4e-58
>prophage 170
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2400969	2405539	2942932		Indivirus(33.33%)	4	NA	NA
WP_003733162.1|2400969_2402883_+	glycosyltransferase	NA	A0A1V0SEC5	Indivirus	25.8	3.8e-06
WP_003721810.1|2402895_2403804_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	34.7	2.6e-45
WP_003721811.1|2404041_2404905_+	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_003721812.1|2405179_2405539_+	response regulator	NA	W8CYM9	Bacillus_phage	36.9	7.6e-09
>prophage 171
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2427683	2437696	2942932		Geobacillus_virus(25.0%)	10	NA	NA
WP_014600611.1|2427683_2428352_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	55.6	2.9e-30
WP_010989550.1|2428365_2429010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003721840.1|2429131_2429458_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003721841.1|2429457_2429781_+	DUF1048 domain-containing protein	NA	NA	NA	NA	NA
WP_014600612.1|2429826_2430474_-	elongation factor G-binding protein	NA	NA	NA	NA	NA
WP_014600613.1|2430744_2432475_+	pyruvate oxidase	NA	H8ZJ31	Ostreococcus_tauri_virus	22.6	1.0e-13
WP_003733177.1|2432636_2434442_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	20.9	1.7e-08
WP_003721845.1|2434454_2435183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014600614.1|2435231_2435444_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003732898.1|2435890_2437696_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HQK2	Paramecium_bursaria_Chlorella_virus	39.3	3.6e-99
>prophage 172
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2442950	2443460	2942932		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003721853.1|2442950_2443460_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	46.7	6.5e-06
>prophage 173
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2448792	2456884	2942932		Planktothrix_phage(50.0%)	10	NA	NA
WP_014600616.1|2448792_2450166_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	23.7	6.9e-26
WP_010989554.1|2450179_2450839_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003721861.1|2451102_2451480_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009925969.1|2451463_2452153_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	24.4	3.4e-05
WP_010989555.1|2452149_2452854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014600617.1|2452868_2454869_+	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	37.9	8.2e-28
WP_003732907.1|2454897_2455401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732909.1|2455945_2456287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003733768.1|2456393_2456681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003721866.1|2456677_2456884_+	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	50.9	2.5e-09
>prophage 174
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2461080	2461986	2942932		Staphylococcus_phage(100.0%)	1	NA	NA
WP_010989559.1|2461080_2461986_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.6	1.5e-37
>prophage 175
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2479181	2480111	2942932		Catovirus(100.0%)	1	NA	NA
WP_010989568.1|2479181_2480111_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	28.2	3.2e-19
>prophage 176
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2513986	2515081	2942932		Mycoplasma_phage(100.0%)	1	NA	NA
WP_072215848.1|2513986_2515081_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	45.8	3.0e-40
>prophage 177
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2523090	2529280	2942932		Acanthocystis_turfacea_Chlorella_virus(50.0%)	6	NA	NA
WP_014600646.1|2523090_2525721_+	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	29.8	9.3e-80
WP_096922226.1|2525735_2526584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014600647.1|2526693_2527251_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003732954.1|2527267_2527930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003721389.1|2527945_2528335_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009924976.1|2528455_2529280_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	50.0	5.5e-71
>prophage 178
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2544989	2546660	2942932		Bacillus_phage(100.0%)	1	NA	NA
WP_072219357.1|2544989_2546660_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	2.4e-57
>prophage 179
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2550476	2553119	2942932		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_014600655.1|2550476_2553119_+	cation-translocating P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	29.8	1.1e-91
>prophage 180
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2560796	2565438	2942932		uncultured_virus(50.0%)	4	NA	NA
WP_009930625.1|2560796_2561900_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	49.5	1.9e-98
WP_003721411.1|2562004_2563105_+	excinuclease ABC subunit C	NA	NA	NA	NA	NA
WP_009917534.1|2563274_2564717_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003724779.1|2564709_2565438_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	2.4e-30
>prophage 181
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2581670	2585369	2942932		Streptococcus_phage(50.0%)	2	NA	NA
WP_014600661.1|2581670_2583344_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	41.2	1.5e-120
WP_003732374.1|2583806_2585369_+	ATP-dependent RNA helicase CshA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.4	7.0e-67
>prophage 182
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2601006	2604704	2942932		Tupanvirus(33.33%)	5	NA	NA
WP_014600668.1|2601006_2602386_+	protoporphyrinogen oxidase	NA	A0A2K9L6U6	Tupanvirus	24.2	1.8e-10
WP_003721452.1|2602387_2602744_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_014600669.1|2602762_2603869_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	30.2	2.0e-36
WP_003721454.1|2604074_2604353_+	CopG family ribbon-helix-helix protein	NA	NA	NA	NA	NA
WP_003743775.1|2604356_2604704_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5RCS0	Lactobacillus_phage	40.4	9.9e-14
>prophage 183
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2608513	2611726	2942932		Bacillus_phage(50.0%)	3	NA	NA
WP_003721462.1|2608513_2609293_+	RNA polymerase sigma factor SigB	NA	A0A0A0RV91	Bacillus_phage	34.6	4.3e-25
WP_003721463.1|2609293_2609893_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_003732387.1|2610100_2611726_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.5	8.4e-47
>prophage 184
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2614814	2615255	2942932		Faustovirus(100.0%)	1	NA	NA
WP_009926861.1|2614814_2615255_+	NADAR family protein	NA	A0A141ZK81	Faustovirus	52.5	1.7e-34
>prophage 185
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2620223	2620721	2942932		Pseudomonas_phage(100.0%)	1	NA	NA
WP_014600672.1|2620223_2620721_+	hypothetical protein	NA	A0A1Y0SYU1	Pseudomonas_phage	31.0	4.4e-07
>prophage 186
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2634639	2636211	2942932		Streptococcus_phage(100.0%)	1	NA	NA
WP_014600681.1|2634639_2636211_+	ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	34.2	1.2e-63
>prophage 187
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2639356	2643865	2942932		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
WP_003721491.1|2639356_2640079_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.9	6.4e-23
WP_014600683.1|2640078_2641194_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003734004.1|2641216_2641873_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003722749.1|2641903_2643865_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.2	4.0e-136
>prophage 188
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2648158	2649106	2942932		Salmonella_phage(100.0%)	1	NA	NA
WP_003722755.1|2648158_2649106_-	glycosyltransferase family 2 protein	NA	A0A2H5BFL1	Salmonella_phage	39.0	1.9e-59
>prophage 189
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2655660	2659918	2942932		Hokovirus(50.0%)	4	NA	NA
WP_014600687.1|2655660_2657466_-	HSP90 family protein	NA	A0A1V0SHA7	Hokovirus	29.6	1.1e-15
WP_003719147.1|2657669_2658140_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_003722764.1|2658372_2658675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003729869.1|2658787_2659918_+	MBL fold metallo-hydrolase	NA	Q332B9	Clostridium_botulinum_C_phage	38.1	8.2e-41
>prophage 190
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2672510	2673737	2942932		Phage_TP(100.0%)	1	NA	NA
WP_014600688.1|2672510_2673737_+	U32 family peptidase	NA	Q6DW11	Phage_TP	32.3	1.9e-43
>prophage 191
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2682466	2685180	2942932		Pseudomonas_phage(50.0%)	2	NA	NA
WP_003732428.1|2682466_2683651_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	28.3	4.1e-19
WP_003732429.1|2683647_2685180_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	29.5	1.0e-46
>prophage 192
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2688926	2689691	2942932		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_014600693.1|2688926_2689691_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.9	2.0e-22
>prophage 193
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2694643	2701916	2942932		Bacillus_phage(50.0%)	7	NA	NA
WP_009926409.1|2694643_2695555_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	7.3e-24
WP_003732439.1|2695547_2696402_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014600696.1|2696483_2698052_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	27.5	3.7e-31
WP_009913969.1|2698158_2698584_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012951432.1|2698635_2699997_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_003722856.1|2700278_2701046_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	40.7	2.6e-30
WP_003732442.1|2701148_2701916_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	38.5	9.2e-28
>prophage 194
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2704990	2707660	2942932	protease	Acanthamoeba_polyphaga_mimivirus(50.0%)	2	NA	NA
WP_003722861.1|2704990_2705470_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.7e-19
WP_014600699.1|2705485_2707660_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	41.5	5.8e-128
>prophage 195
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2722436	2723630	2942932		Bacillus_virus(100.0%)	1	NA	NA
WP_003722878.1|2722436_2723630_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.3	7.6e-29
>prophage 196
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2737195	2740731	2942932		Enterobacteria_phage(50.0%)	3	NA	NA
WP_010989641.1|2737195_2738224_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	22.3	2.9e-05
WP_014600707.1|2738487_2739891_+	L-fucose/L-arabinose isomerase family protein	NA	NA	NA	NA	NA
WP_003722656.1|2739906_2740731_+	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	31.4	5.2e-13
>prophage 197
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2747771	2748434	2942932		Bacillus_virus(100.0%)	1	NA	NA
WP_003722664.1|2747771_2748434_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.1	4.6e-20
>prophage 198
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2756207	2756759	2942932		Synechococcus_phage(100.0%)	1	NA	NA
WP_003722677.1|2756207_2756759_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.7	1.1e-14
>prophage 199
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2761437	2774420	2942932		Erysipelothrix_phage(25.0%)	13	NA	NA
WP_003722682.1|2761437_2762841_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	30.1	2.3e-48
WP_003732693.1|2763028_2763340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014600713.1|2763468_2764422_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003722685.1|2764421_2764694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014600714.1|2764715_2765246_+	DsbA family protein	NA	NA	NA	NA	NA
WP_003722687.1|2765387_2766050_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	2.8e-33
WP_003734007.1|2766024_2767470_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003722689.1|2767556_2768978_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014600715.1|2768990_2769659_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	2.2e-25
WP_003722692.1|2769725_2770670_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003722693.1|2770870_2771485_-	YktB family protein	NA	NA	NA	NA	NA
WP_014600716.1|2771616_2772390_+	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_003722695.1|2772581_2774420_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	24.2	7.3e-23
>prophage 200
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2783479	2789194	2942932		Bacillus_phage(66.67%)	4	NA	NA
WP_003722702.1|2783479_2784481_+	teichoic acids export ABC transporter ATP-binding subunit TagH	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	2.1e-16
WP_003732702.1|2784657_2786376_+	GW domain-containing glycosaminoglycan-binding protein	NA	Q9ZXE4	Bacillus_phage	44.1	4.3e-17
WP_003721494.1|2786591_2788280_+	glycosyl transferase group 2	NA	NA	NA	NA	NA
WP_003721495.1|2788321_2789194_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.2	4.5e-79
>prophage 201
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2794263	2796696	2942932		Enterobacteria_phage(66.67%)	3	NA	NA
WP_003721498.1|2794263_2795130_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	7.5e-103
WP_003721499.1|2795148_2795709_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	44.8	1.1e-38
WP_010989656.1|2795709_2796696_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	46.8	3.6e-77
>prophage 202
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2802695	2810118	2942932		Hokovirus(33.33%)	8	NA	NA
WP_003721506.1|2802695_2803079_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_014600722.1|2803100_2804084_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	35.3	3.1e-12
WP_014930875.1|2804098_2805112_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.0	6.0e-11
WP_003721509.1|2805320_2806811_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_003727000.1|2806822_2807647_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	9.7e-68
WP_014600724.1|2807659_2807968_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003732712.1|2808028_2808433_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_014600725.1|2808561_2810118_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	2.3e-17
>prophage 203
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2820063	2823427	2942932		Bacillus_phage(50.0%)	2	NA	NA
WP_014600742.1|2820063_2821779_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.2	2.3e-18
WP_014600743.1|2821780_2823427_+	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	28.6	1.6e-16
>prophage 204
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2827830	2828403	2942932	protease	Salicola_phage(100.0%)	1	NA	NA
WP_003721539.1|2827830_2828403_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A248SJ97	Salicola_phage	37.6	4.7e-29
>prophage 205
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2885717	2886524	2942932		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003721605.1|2885717_2886524_+	ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	28.3	2.0e-09
>prophage 206
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2889652	2893571	2942932		Leuconostoc_phage(33.33%)	5	NA	NA
WP_003721610.1|2889652_2890183_+	AAA family ATPase	NA	A0A097BYE2	Leuconostoc_phage	35.3	3.6e-07
WP_003724743.1|2890213_2890525_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003721612.1|2890527_2891079_+	DUF2812 domain-containing protein	NA	NA	NA	NA	NA
WP_003734016.1|2891418_2892288_+	GW domain-containing glycosaminoglycan-binding protein	NA	S5M633	Brevibacillus_phage	51.6	8.5e-38
WP_022741829.1|2892584_2893571_+	GW domain-containing glycosaminoglycan-binding protein	NA	A0A0A7RU71	Clostridium_phage	42.8	1.1e-25
>prophage 207
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2896796	2901119	2942932	tRNA	Tupanvirus(50.0%)	3	NA	NA
WP_003736387.1|2896796_2897849_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.9	1.3e-29
WP_014600775.1|2897848_2900257_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_014600776.1|2900417_2901119_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.4	3.0e-33
>prophage 208
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2908415	2915590	2942932		Canid_alphaherpesvirus(25.0%)	7	NA	NA
WP_003732773.1|2908415_2909090_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	47.7	7.5e-50
WP_072215733.1|2909127_2910054_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_022741830.1|2910207_2910471_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_012951513.1|2910470_2911013_+	CvpA family protein	NA	NA	NA	NA	NA
WP_003723851.1|2911105_2912818_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.8	5.1e-18
WP_010989713.1|2912840_2915198_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	1.0e-21
WP_003723853.1|2915278_2915590_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	39.6	5.4e-19
>prophage 209
NZ_CP048400	Listeria monocytogenes strain AUF chromosome, complete genome	2942932	2922606	2942531	2942932	integrase	Listeria_phage(95.65%)	35	2921127:2921142	2926467:2926482
2921127:2921142	attL	AAAGGAGAATAAGAAA	NA	NA	NA	NA
WP_014930113.1|2922606_2923761_-|integrase	site-specific integrase	integrase	A8ATC7	Listeria_phage	94.8	2.0e-207
WP_014930257.1|2923891_2924755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026747145.1|2924806_2925259_-	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	87.3	9.1e-76
WP_012951519.1|2925275_2925599_-	helix-turn-helix transcriptional regulator	NA	R4IDX0	Listeria_phage	75.7	6.3e-39
WP_003730994.1|2925999_2926203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003730995.1|2926269_2926461_+	helix-turn-helix transcriptional regulator	NA	A0A059T5F8	Listeria_phage	87.1	5.4e-22
WP_061105177.1|2926482_2926725_+	hypothetical protein	NA	A8ATD2	Listeria_phage	92.5	1.5e-40
2926467:2926482	attR	AAAGGAGAATAAGAAA	NA	NA	NA	NA
WP_009931094.1|2927436_2927727_+	hypothetical protein	NA	A0A059T7V3	Listeria_phage	89.4	1.8e-40
WP_031659545.1|2927744_2927927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014930119.1|2928120_2928396_+	hypothetical protein	NA	R4ICD2	Listeria_phage	94.3	3.4e-41
WP_009931089.1|2928392_2928836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014930120.1|2928852_2929161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014930121.1|2929157_2929721_+	DUF1642 domain-containing protein	NA	A8ATD8	Listeria_phage	61.5	1.6e-58
WP_163621760.1|2929779_2930412_+	pentapeptide repeat-containing protein	NA	M4H0V1	Listeria_phage	70.7	1.1e-26
WP_009932944.1|2930412_2931042_+	hypothetical protein	NA	A0A191KBJ8	Streptococcus_virus	57.9	2.4e-66
WP_003722554.1|2931060_2931228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045131531.1|2931331_2931508_+	hypothetical protein	NA	A0A076G7F4	Listeria_phage	86.2	5.5e-21
WP_014930124.1|2931504_2931906_+	hypothetical protein	NA	A8ATD9	Listeria_phage	95.5	7.8e-71
WP_031645762.1|2931902_2932118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031645562.1|2932114_2932324_+	hypothetical protein	NA	A0A059T6C7	Listeria_phage	59.1	6.6e-13
WP_154079741.1|2932350_2932521_+	hypothetical protein	NA	A0A059T654	Listeria_phage	92.3	2.4e-21
WP_023548953.1|2932517_2932952_+	hypothetical protein	NA	A8ATS7	Listeria_phage	52.8	2.5e-38
WP_009933640.1|2933154_2933355_+	hypothetical protein	NA	A0A059T6A2	Listeria_phage	58.1	2.6e-11
WP_014930125.1|2933351_2933963_+	hypothetical protein	NA	B6D7K1	Listeria_phage	49.5	6.8e-50
WP_009933853.1|2933977_2934211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014930126.1|2934207_2934978_+	DUF1351 domain-containing protein	NA	B6D7K2	Listeria_phage	27.4	3.3e-17
WP_014930127.1|2934980_2935616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014930128.1|2935688_2937377_+	hypothetical protein	NA	A8ATS1	Listeria_phage	43.6	1.6e-125
WP_014930129.1|2937379_2939185_+	primase	NA	A8ATS2	Listeria_phage	40.2	3.5e-126
WP_097296418.1|2939600_2940140_+	DUF3310 domain-containing protein	NA	A8ATF5	Listeria_phage	78.3	7.0e-75
WP_045131521.1|2940136_2940415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731655.1|2940650_2940878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731654.1|2940890_2941316_+	DUF722 domain-containing protein	NA	A0A059T6H4	Listeria_phage	99.3	1.8e-73
WP_097296419.1|2941935_2942217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097296420.1|2942216_2942531_+	HNH endonuclease	NA	A8ATF8	Listeria_phage	98.1	1.1e-56
