The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	0	2729	4238533		Brucella_phage(33.33%)	3	NA	NA
WP_163898896.1|1386_1770_-	hypothetical protein	NA	A0A141GEV7	Brucella_phage	43.0	8.1e-17
WP_163898899.1|1950_2244_-	HNH endonuclease	NA	Q38456	Bacillus_phage	38.2	9.9e-07
WP_163898902.1|2246_2729_-	hypothetical protein	NA	A0A142IF90	Pseudomonas_phage	45.3	4.1e-26
>prophage 2
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	5876	29759	4238533	integrase	Rhizobium_phage(60.0%)	30	18243:18257	33826:33840
WP_163898916.1|5876_8180_-	DUF3987 domain-containing protein	NA	B4UTY9	Rhizobium_phage	41.0	8.5e-61
WP_163898919.1|8834_9212_-	hypothetical protein	NA	B4UTY6	Rhizobium_phage	62.4	2.2e-43
WP_163898922.1|9208_10264_-	site-specific DNA-methyltransferase	NA	A0A0F7L417	uncultured_marine_virus	50.3	1.7e-88
WP_163898925.1|10263_11694_-	helicase	NA	F8TUJ9	EBPR_podovirus	48.5	1.2e-116
WP_163898928.1|12056_12827_-	hypothetical protein	NA	B4UTX9	Rhizobium_phage	52.4	7.7e-51
WP_163898931.1|12895_15688_-	DEAD/DEAH box helicase family protein	NA	B4UTX6	Rhizobium_phage	75.7	8.6e-07
WP_163898934.1|15684_16143_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_163898936.1|16166_17099_-	oxidoreductase	NA	B4UTX3	Rhizobium_phage	47.9	1.4e-83
WP_163898939.1|17390_18446_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	56.7	1.5e-97
18243:18257	attL	CGTCGTCGTGCCGGC	NA	NA	NA	NA
WP_163898942.1|18510_18693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163898945.1|18719_19349_-	hypothetical protein	NA	B4UTW6	Rhizobium_phage	75.8	1.0e-69
WP_163898948.1|19375_19519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163898951.1|19518_20328_-	AAA family ATPase	NA	B4UTW5	Rhizobium_phage	36.5	4.0e-42
WP_163898954.1|20349_20523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163898957.1|20519_20762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163898960.1|20758_20896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163898963.1|21029_22010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163898966.1|22011_22308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163898968.1|22304_22589_-	hypothetical protein	NA	B4UTW0	Rhizobium_phage	46.1	2.3e-08
WP_163898971.1|23156_23849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163898974.1|23853_24366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163905700.1|24626_24845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163898977.1|24986_26189_+	hypothetical protein	NA	A0A0M4REI4	Salmonella_phage	45.8	2.3e-25
WP_163898979.1|26185_26443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163898984.1|26444_26810_+	hypothetical protein	NA	A0A127KNK1	Pseudomonas_phage	54.7	4.6e-30
WP_163898987.1|26806_27562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163898989.1|27558_28155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163898992.1|28154_28442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163905701.1|28444_28687_+	hypothetical protein	NA	A0A141GEZ4	Brucella_phage	52.4	1.9e-11
WP_163898996.1|28676_29759_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A141GEZ3	Brucella_phage	51.6	6.3e-99
33826:33840	attR	GCCGGCACGACGACG	NA	NA	NA	NA
>prophage 3
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	34615	35443	4238533		Bacillus_virus(100.0%)	1	NA	NA
WP_163899014.1|34615_35443_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	35.3	1.6e-30
>prophage 4
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	42200	42908	4238533		Aurantimonas_phage(100.0%)	1	NA	NA
WP_163899037.1|42200_42908_+	AAA family ATPase	NA	A0A0A8IL09	Aurantimonas_phage	38.8	1.6e-31
>prophage 5
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	57292	58309	4238533		Bordetella_phage(100.0%)	1	NA	NA
WP_163899100.1|57292_58309_+	helix-turn-helix domain-containing protein	NA	A0A291LAM3	Bordetella_phage	41.6	2.8e-08
>prophage 6
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	63519	65538	4238533		Bacillus_phage(100.0%)	1	NA	NA
WP_163899120.1|63519_65538_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	29.4	4.6e-10
>prophage 7
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	73690	74894	4238533		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_163905703.1|73690_74275_-	DnaJ domain-containing protein	NA	Q8QNB4	Ectocarpus_siliculosus_virus	46.8	8.6e-10
WP_099057933.1|74681_74894_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	54.0	5.6e-12
>prophage 8
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	85485	85980	4238533		Synechococcus_phage(100.0%)	1	NA	NA
WP_163899162.1|85485_85980_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	34.2	6.3e-14
>prophage 9
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	92344	93472	4238533		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_163899189.1|92344_93472_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	27.7	6.2e-33
>prophage 10
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	103298	104390	4238533		Bacillus_virus(100.0%)	1	NA	NA
WP_163899216.1|103298_104390_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	32.2	1.9e-23
>prophage 11
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	109328	113338	4238533		Synechococcus_phage(50.0%)	3	NA	NA
WP_163899232.1|109328_110756_-	NADP-dependent phosphogluconate dehydrogenase	NA	M1T2E7	Synechococcus_phage	30.2	1.0e-27
WP_099057962.1|110885_111041_-	cbb3-type cytochrome oxidase assembly protein CcoS	NA	NA	NA	NA	NA
WP_163899235.1|111037_113338_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.3	7.1e-76
>prophage 12
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	160960	161338	4238533		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_163899340.1|160960_161338_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	35.0	6.3e-06
>prophage 13
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	166376	169241	4238533		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_163899353.1|166376_169241_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.5	1.0e-265
>prophage 14
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	174754	181278	4238533		environmental_halophage(33.33%)	5	NA	NA
WP_163899366.1|174754_175999_-	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.4	1.3e-100
WP_163899368.1|175991_177266_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_163899370.1|177291_178047_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.4	6.3e-05
WP_163899372.1|178480_179950_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_163899373.1|180111_181278_-	aminotransferase class V-fold PLP-dependent enzyme	NA	H7BUW1	unidentified_phage	37.3	6.3e-28
>prophage 15
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	184469	185726	4238533	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_163899377.1|184469_185726_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	37.6	9.6e-67
>prophage 16
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	191307	194969	4238533		Bacillus_phage(50.0%)	3	NA	NA
WP_163899387.1|191307_192660_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1D6X855	Bacillus_phage	48.8	1.6e-22
WP_163899389.1|192711_193335_+	LysE family transporter	NA	NA	NA	NA	NA
WP_163899391.1|193481_194969_+	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	32.7	5.1e-51
>prophage 17
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	200672	206731	4238533		Enterobacteria_phage(33.33%)	7	NA	NA
WP_163899407.1|200672_201167_-	flavin reductase	NA	Q9KX93	Enterobacteria_phage	42.9	1.4e-13
WP_163899408.1|201359_202430_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163899410.1|202453_203218_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.8	4.8e-21
WP_163899411.1|203372_204050_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_163905715.1|204106_204778_+	DUF2259 domain-containing protein	NA	NA	NA	NA	NA
WP_163899412.1|204777_205302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163899423.1|205429_206731_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	29.5	2.5e-17
>prophage 18
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	210732	211497	4238533		Synechococcus_phage(100.0%)	1	NA	NA
WP_163899430.1|210732_211497_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	41.7	4.1e-44
>prophage 19
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	215820	218043	4238533		Microbacterium_phage(100.0%)	1	NA	NA
WP_163899440.1|215820_218043_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	43.0	2.3e-156
>prophage 20
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	222142	228018	4238533	tRNA	Escherichia_phage(66.67%)	6	NA	NA
WP_163899449.1|222142_223030_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	52.7	1.7e-70
WP_163899451.1|223091_224018_-	glutaminase	NA	NA	NA	NA	NA
WP_163899453.1|224131_224749_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_163899455.1|225084_226083_+	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	35.2	4.5e-43
WP_163899457.1|226237_227476_+	peptidase T	NA	NA	NA	NA	NA
WP_163899459.1|227595_228018_+	DUF1810 family protein	NA	A0A2H4UVK5	Bodo_saltans_virus	38.1	7.3e-11
>prophage 21
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	237350	243003	4238533	tRNA	uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_163899472.1|237350_238988_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.4	1.4e-38
WP_163899474.1|239101_241765_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.0	4.4e-77
WP_099058071.1|241920_243003_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.9	8.2e-115
>prophage 22
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	246079	248701	4238533		Bacillus_phage(100.0%)	1	NA	NA
WP_163899481.1|246079_248701_-	response regulator	NA	W8CYM9	Bacillus_phage	35.6	1.4e-06
>prophage 23
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	255880	256750	4238533		Pandoravirus(100.0%)	1	NA	NA
WP_163899497.1|255880_256750_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	34.3	3.5e-23
>prophage 24
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	268178	271201	4238533		Brazilian_cedratvirus(50.0%)	3	NA	NA
WP_163899510.1|268178_269000_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.4	2.2e-11
WP_163899512.1|269007_270186_-	MlaE family lipid ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_163899514.1|270340_271201_-	UDP-2,3-diacylglucosamine diphosphatase	NA	A0A218MKA7	uncultured_virus	40.2	2.1e-57
>prophage 25
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	281931	283611	4238533		Agrobacterium_phage(100.0%)	1	NA	NA
WP_163899531.1|281931_283611_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.1	5.2e-100
>prophage 26
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	302227	303298	4238533		Bacillus_phage(100.0%)	1	NA	NA
WP_163899558.1|302227_303298_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.7	6.6e-16
>prophage 27
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	323581	325114	4238533		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_163905731.1|323581_325114_+	HAMP domain-containing histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.0	2.3e-22
>prophage 28
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	328437	330704	4238533		Bacillus_phage(50.0%)	2	NA	NA
WP_163899608.1|328437_329778_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.3	3.3e-17
WP_163905735.1|329882_330704_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	28.2	1.4e-05
>prophage 29
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	337077	337869	4238533		Bacillus_virus(100.0%)	1	NA	NA
WP_163899618.1|337077_337869_+	heme ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.4	6.6e-13
>prophage 30
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	342880	343909	4238533		Planktothrix_phage(100.0%)	1	NA	NA
WP_163899628.1|342880_343909_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.0	8.8e-26
>prophage 31
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	361316	362444	4238533		Bordetella_phage(100.0%)	1	NA	NA
WP_099058211.1|361316_362444_-	AAA family ATPase	NA	A0A291LA07	Bordetella_phage	56.6	1.2e-108
>prophage 32
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	370303	372082	4238533		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_163899684.1|370303_372082_-	acetolactate synthase 3 large subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	29.5	4.7e-51
>prophage 33
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	376493	381865	4238533	protease	uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_163899692.1|376493_378053_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	37.6	1.1e-22
WP_163899694.1|378150_378336_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_163899696.1|378346_379267_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_163899698.1|379269_380364_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_163899700.1|380513_381038_-	dihydrofolate reductase	NA	A0A142IIC1	Enterobacteria_phage	38.2	5.0e-25
WP_163899702.1|381070_381865_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.7	4.4e-110
>prophage 34
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	389989	398243	4238533		Leptospira_phage(50.0%)	4	NA	NA
WP_163899713.1|389989_393169_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	24.1	7.1e-66
WP_163899715.1|393165_394365_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_163899717.1|394659_395652_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_163899718.1|395753_398243_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	38.1	5.0e-115
>prophage 35
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	403048	408120	4238533		Ostreococcus_lucimarinus_virus(50.0%)	6	NA	NA
WP_163899729.1|403048_403876_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	35.7	1.3e-40
WP_163899731.1|403955_404825_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_163899732.1|404834_405083_-	DUF2164 family protein	NA	NA	NA	NA	NA
WP_163899734.1|405229_405943_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_163899736.1|405939_406251_+	AzlD family protein	NA	NA	NA	NA	NA
WP_163899738.1|406278_408120_-	M24 family metallopeptidase	NA	A0A0P0I8D7	Acinetobacter_phage	33.7	8.2e-83
>prophage 36
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	413167	421497	4238533		Aeromonas_phage(20.0%)	6	NA	NA
WP_163899749.1|413167_413656_-	CreA family protein	NA	A0A2H4YFD9	Aeromonas_phage	27.9	1.6e-06
WP_163899751.1|413705_414389_-	3'-5' exonuclease	NA	A0A1S5SFA9	Streptococcus_phage	40.1	4.2e-24
WP_163899753.1|414592_416692_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.0	1.4e-46
WP_163899755.1|416831_417812_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	27.5	6.5e-10
WP_163899757.1|417888_419145_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_163899759.1|419337_421497_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	37.9	6.4e-119
>prophage 37
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	454085	454847	4238533		Sphingobium_phage(100.0%)	1	NA	NA
WP_163899808.1|454085_454847_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	43.0	1.1e-12
>prophage 38
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	462544	463327	4238533		Geobacillus_phage(100.0%)	1	NA	NA
WP_163899822.1|462544_463327_+	glycoside hydrolase family 25 protein	NA	A0A1U9WQS3	Geobacillus_phage	31.6	1.3e-21
>prophage 39
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	470947	478108	4238533		Tupanvirus(33.33%)	5	NA	NA
WP_163899833.1|470947_472597_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	28.5	1.9e-46
WP_163899835.1|473085_474042_+	alpha/beta fold hydrolase	NA	A0A220T682	Eptesipox_virus	22.3	1.8e-12
WP_163899837.1|474288_475245_+	EamA family transporter	NA	NA	NA	NA	NA
WP_163899838.1|475256_476459_+	CoA transferase	NA	NA	NA	NA	NA
WP_163899840.1|476455_478108_+	thiamine pyrophosphate-binding protein	NA	A9YVT5	Ostreococcus_tauri_virus	25.9	1.6e-32
>prophage 40
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	483766	484486	4238533		Aurantimonas_phage(100.0%)	1	NA	NA
WP_163899854.1|483766_484486_-	AAA family ATPase	NA	A0A0A8IL09	Aurantimonas_phage	37.2	3.5e-29
>prophage 41
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	495709	503517	4238533		Bacillus_virus(50.0%)	8	NA	NA
WP_163899873.1|495709_496768_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.8	1.2e-30
WP_163899875.1|496913_497543_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_163899877.1|497647_498451_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_163899879.1|498651_499746_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	35.0	1.4e-24
WP_163899880.1|499792_500953_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_163899882.1|501062_501926_+	ABC transporter permease subunit	NA	Q6GZ02	Mycoplasma_phage	25.7	5.7e-10
WP_163899884.1|501925_502750_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_163899886.1|502755_503517_+	glucose 1-dehydrogenase	NA	A0A0M4JSW6	Mollivirus	29.0	6.3e-13
>prophage 42
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	514883	516515	4238533		Bacillus_virus(100.0%)	1	NA	NA
WP_163899906.1|514883_516515_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.9	9.7e-19
>prophage 43
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	522501	533175	4238533		Tupanvirus(33.33%)	7	NA	NA
WP_163899916.1|522501_523545_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L7I1	Tupanvirus	32.1	2.1e-19
WP_163899917.1|523674_525378_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_163899919.1|525384_525819_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_163899921.1|525944_527282_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.5	6.7e-34
WP_163905747.1|527284_528184_-	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_163899922.1|528344_529214_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_163899924.1|529407_533175_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	58.7	2.3e-15
>prophage 44
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	538207	542692	4238533		Planktothrix_phage(33.33%)	3	NA	NA
WP_163899932.1|538207_538915_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.6	2.1e-31
WP_163899934.1|539014_540139_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	27.3	6.2e-25
WP_163899936.1|541069_542692_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.2	7.3e-59
>prophage 45
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	554569	554992	4238533		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_163899972.1|554569_554992_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	64.2	6.3e-47
>prophage 46
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	562772	563594	4238533		Caulobacter_virus(100.0%)	1	NA	NA
WP_163899986.1|562772_563594_+	serine/threonine protein phosphatase	NA	K4JNE2	Caulobacter_virus	37.2	1.4e-26
>prophage 47
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	576364	583086	4238533		Vibrio_phage(25.0%)	4	NA	NA
WP_163900014.1|576364_578431_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.6	8.5e-36
WP_163905753.1|578948_580949_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	44.6	1.3e-94
WP_163900016.1|581115_581568_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.1	8.9e-15
WP_163900018.1|581880_583086_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.3	5.1e-41
>prophage 48
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	593672	595208	4238533		Mycobacterium_phage(100.0%)	1	NA	NA
WP_163900033.1|593672_595208_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	31.3	1.8e-35
>prophage 49
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	601040	602015	4238533		Orpheovirus(100.0%)	1	NA	NA
WP_163900046.1|601040_602015_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.7	3.3e-67
>prophage 50
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	616210	622678	4238533	tRNA	Lactococcus_phage(25.0%)	9	NA	NA
WP_027488319.1|616210_616426_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	52.4	2.0e-09
WP_163900074.1|616577_617048_+	BA14K family protein	NA	NA	NA	NA	NA
WP_163900076.1|617146_617794_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_163900078.1|618061_618595_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163900080.1|618596_619298_+	response regulator	NA	W8CYM9	Bacillus_phage	36.1	2.3e-38
WP_163900082.1|619449_620829_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	27.5	5.3e-10
WP_163900084.1|620850_621438_+	DUF1349 domain-containing protein	NA	NA	NA	NA	NA
WP_163900086.1|621512_621878_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_163905757.1|621874_622678_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	32.2	1.5e-25
>prophage 51
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	629215	630148	4238533		Tupanvirus(100.0%)	1	NA	NA
WP_163900102.1|629215_630148_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.0	1.3e-47
>prophage 52
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	636770	639146	4238533		Bacillus_virus(100.0%)	1	NA	NA
WP_163900112.1|636770_639146_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	33.5	5.4e-18
>prophage 53
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	645592	648152	4238533		Molluscum_contagiosum_virus(50.0%)	4	NA	NA
WP_163900128.1|645592_646078_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.9	5.3e-13
WP_163905761.1|646106_646916_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_163900130.1|646970_647582_+	LysE family transporter	NA	NA	NA	NA	NA
WP_099058465.1|647609_648152_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.1	1.5e-32
>prophage 54
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	652291	658876	4238533		Bacillus_phage(100.0%)	5	NA	NA
WP_163900140.1|652291_654175_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.0	5.9e-28
WP_163905763.1|654589_655780_+	glucose/galactose MFS transporter	NA	NA	NA	NA	NA
WP_163900142.1|655851_656274_-	DMT family transporter	NA	NA	NA	NA	NA
WP_163900144.1|656273_656753_-	EamA-like transporter family protein	NA	NA	NA	NA	NA
WP_163900146.1|657019_658876_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	32.1	2.4e-34
>prophage 55
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	663665	664922	4238533	tRNA	Roseobacter_phage(100.0%)	1	NA	NA
WP_163900157.1|663665_664922_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A1B0V011	Roseobacter_phage	32.9	7.4e-51
>prophage 56
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	686972	687557	4238533	protease	Agrobacterium_phage(100.0%)	1	NA	NA
WP_163900194.1|686972_687557_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	5.2e-31
>prophage 57
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	694428	698167	4238533		Microcystis_phage(50.0%)	4	NA	NA
WP_163900203.1|694428_695892_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.9	5.1e-51
WP_163900205.1|696195_696693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163900207.1|696957_697530_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_163900209.1|697702_698167_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	48.8	4.2e-28
>prophage 58
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	725380	726430	4238533	holin	Bacillus_virus(100.0%)	1	NA	NA
WP_163900244.1|725380_726430_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	33.7	1.3e-19
>prophage 59
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	731053	732037	4238533		Mycobacterium_phage(100.0%)	1	NA	NA
WP_163900254.1|731053_732037_-	alpha/beta fold hydrolase	NA	A0A2P1JTI7	Mycobacterium_phage	25.8	3.2e-09
>prophage 60
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	750296	757470	4238533		Acinetobacter_phage(60.0%)	6	NA	NA
WP_163900288.1|750296_751070_+	3-hydroxybutyrate dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	6.4e-13
WP_163900289.1|751148_752618_+	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	44.1	1.9e-106
WP_163900291.1|752779_755116_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	51.1	7.5e-206
WP_163900293.1|755367_756228_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	33.4	1.2e-23
WP_163900295.1|756200_756431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163900297.1|756540_757470_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.8	4.8e-15
>prophage 61
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	769412	770447	4238533		Tupanvirus(100.0%)	1	NA	NA
WP_163900325.1|769412_770447_-	glutamine synthetase	NA	A0A2K9L422	Tupanvirus	42.9	1.1e-71
>prophage 62
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	775783	779824	4238533		Hokovirus(100.0%)	1	NA	NA
WP_163900337.1|775783_779824_-	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	32.7	9.3e-63
>prophage 63
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	787535	788987	4238533		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_163900355.1|787535_788987_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.2	4.0e-56
>prophage 64
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	806735	817377	4238533		Liberibacter_phage(33.33%)	6	NA	NA
WP_163900387.1|806735_809825_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	31.6	3.3e-60
WP_163900390.1|809833_810769_-	DUF1016 family protein	NA	NA	NA	NA	NA
WP_163900392.1|810765_812034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163900394.1|812027_814481_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	37.1	3.8e-75
WP_163900395.1|814830_815427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163900397.1|815469_817377_+	AAA family ATPase	NA	A0A1V0SG63	Hokovirus	23.4	4.8e-09
>prophage 65
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	827393	828974	4238533		Streptococcus_phage(100.0%)	1	NA	NA
WP_163900409.1|827393_828974_-	recombinase family protein	NA	K4JU73	Streptococcus_phage	25.5	9.7e-24
>prophage 66
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	834775	838311	4238533		Bacillus_phage(50.0%)	3	NA	NA
WP_163900423.1|834775_835111_+	helix-turn-helix domain-containing protein	NA	A0A0U4B0B5	Bacillus_phage	43.9	3.6e-05
WP_163905785.1|835283_836144_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_163905783.1|836127_838311_+	sigma-70 family RNA polymerase sigma factor	NA	F4YCU2	Synechococcus_phage	28.9	2.6e-19
>prophage 67
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	846613	848659	4238533		Aeropyrum_pernix_spindle-shaped_virus(50.0%)	2	NA	NA
WP_163900434.1|846613_848149_-	DNA (cytosine-5-)-methyltransferase	NA	G3CB01	Aeropyrum_pernix_spindle-shaped_virus	28.1	1.1e-19
WP_163900436.1|848215_848659_+	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	52.4	3.0e-39
>prophage 68
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	853222	853987	4238533		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_163900449.1|853222_853987_-	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	24.3	6.1e-08
>prophage 69
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	864817	867502	4238533		Bacillus_virus(100.0%)	1	NA	NA
WP_163900468.1|864817_867502_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	31.3	4.2e-19
>prophage 70
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	873247	874036	4238533		Cedratvirus(100.0%)	1	NA	NA
WP_163900478.1|873247_874036_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	28.5	2.5e-12
>prophage 71
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	878379	881706	4238533		Leptospira_phage(100.0%)	1	NA	NA
WP_163900487.1|878379_881706_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.8	8.2e-73
>prophage 72
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	884748	886563	4238533		Bacillus_phage(50.0%)	2	NA	NA
WP_163900493.1|884748_885603_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.8	5.8e-15
WP_163905793.1|886026_886563_-	redoxin family protein	NA	A0A1D8KSL1	Synechococcus_phage	57.9	2.4e-51
>prophage 73
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	893114	894667	4238533		Staphylococcus_phage(50.0%)	2	NA	NA
WP_163900508.1|893114_893810_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.0	1.5e-13
WP_163900510.1|893914_894667_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-14
>prophage 74
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	899215	909904	4238533		Staphylococcus_phage(33.33%)	8	NA	NA
WP_163905797.1|899215_899848_-	YjbE family putative metal transport protein	NA	W8EBD0	Pseudomonas_phage	35.6	6.0e-17
WP_163900516.1|900101_900944_-	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	A0A167R0X0	Powai_lake_megavirus	34.8	2.2e-22
WP_163900517.1|901241_904625_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.7	2.8e-28
WP_163900520.1|904617_905541_+	response regulator	NA	W8CYM9	Bacillus_phage	33.3	3.2e-11
WP_163905799.1|905714_907352_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	26.3	4.1e-33
WP_163900522.1|907543_908662_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163900524.1|908802_909156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163900526.1|909175_909904_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	3.9e-12
>prophage 75
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	922325	923351	4238533		Paracoccus_phage(100.0%)	1	NA	NA
WP_163900545.1|922325_923351_+	DUF2793 domain-containing protein	NA	A0A0B5A0F6	Paracoccus_phage	38.3	7.2e-28
>prophage 76
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	927894	928596	4238533		Roseobacter_phage(100.0%)	1	NA	NA
WP_099058674.1|927894_928596_+	response regulator transcription factor	NA	F4YXP8	Roseobacter_phage	48.6	3.0e-17
>prophage 77
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	939574	944320	4238533		Salicola_phage(50.0%)	3	NA	NA
WP_163900576.1|939574_940477_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	32.5	4.1e-35
WP_163900578.1|940561_942958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163900580.1|943021_944320_-	adenylosuccinate synthase	NA	A0A291AUF9	Pandoravirus	32.4	2.7e-56
>prophage 78
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	949538	950381	4238533		Bacillus_virus(100.0%)	1	NA	NA
WP_163900592.1|949538_950381_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	36.4	6.7e-32
>prophage 79
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	959866	960568	4238533		Pandoravirus(100.0%)	1	NA	NA
WP_163900610.1|959866_960568_-	uracil-DNA glycosylase	NA	S4VYQ4	Pandoravirus	46.9	3.2e-51
>prophage 80
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	977267	980571	4238533		Catovirus(50.0%)	3	NA	NA
WP_163900640.1|977267_978266_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	A0A1V0SBM3	Catovirus	24.3	4.0e-07
WP_163900645.1|978262_979039_+	L-iditol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_163900647.1|979086_980571_+	mannitol dehydrogenase family protein	NA	E5EQS6	Micromonas_sp._RCC1109_virus	28.9	2.2e-46
>prophage 81
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	990650	992246	4238533		Cedratvirus(100.0%)	1	NA	NA
WP_163900666.1|990650_992246_-	phosphoglycerate dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	36.8	3.8e-44
>prophage 82
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1000521	1001562	4238533		uncultured_virus(100.0%)	1	NA	NA
WP_163900679.1|1000521_1001562_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	32.5	3.2e-07
>prophage 83
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1004592	1005462	4238533		Mocis_latipes_granulovirus(100.0%)	1	NA	NA
WP_163900689.1|1004592_1005462_-	glycosyl transferase	NA	A0A162GVE7	Mocis_latipes_granulovirus	29.6	4.4e-10
>prophage 84
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1014462	1016406	4238533	protease	Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_163900706.1|1014462_1016406_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	41.1	2.8e-113
>prophage 85
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1023851	1025096	4238533		Orpheovirus(100.0%)	1	NA	NA
WP_163900720.1|1023851_1025096_+	methyltransferase domain-containing protein	NA	A0A2I2L5L3	Orpheovirus	35.8	5.4e-54
>prophage 86
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1033899	1034796	4238533		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_163900734.1|1033899_1034796_+	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	26.0	8.8e-06
>prophage 87
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1039650	1041453	4238533		Bacillus_phage(100.0%)	1	NA	NA
WP_163900748.1|1039650_1041453_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	32.6	7.8e-62
>prophage 88
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1050830	1051331	4238533		Tetraselmis_virus(100.0%)	1	NA	NA
WP_163900765.1|1050830_1051331_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.0	3.5e-20
>prophage 89
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1057030	1057294	4238533		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_099058787.1|1057030_1057294_+	DUF2312 domain-containing protein	NA	A0A0F6R615	Sinorhizobium_phage	84.0	2.3e-31
>prophage 90
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1063142	1067792	4238533		Pandoravirus(50.0%)	5	NA	NA
WP_163900781.1|1063142_1064303_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	43.9	1.3e-41
WP_163900783.1|1064287_1064917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163900785.1|1064916_1065201_+	GTP cyclohydrolase	NA	NA	NA	NA	NA
WP_163900787.1|1065240_1066152_+	DUF3445 domain-containing protein	NA	NA	NA	NA	NA
WP_163900789.1|1066349_1067792_+	homospermidine synthase	NA	B2ZXX8	Ralstonia_phage	40.3	1.6e-102
>prophage 91
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1076005	1076893	4238533		Bacillus_phage(100.0%)	1	NA	NA
WP_163900803.1|1076005_1076893_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.2	4.6e-63
>prophage 92
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1089390	1089858	4238533		uncultured_virus(100.0%)	1	NA	NA
WP_163900817.1|1089390_1089858_-	Hsp20 family protein	NA	A0A218MMV3	uncultured_virus	36.4	3.6e-19
>prophage 93
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1097055	1099034	4238533		Mycoplasma_phage(50.0%)	2	NA	NA
WP_163900829.1|1097055_1097934_-	ABC transporter permease subunit	NA	Q6GZ02	Mycoplasma_phage	22.1	4.3e-05
WP_163900831.1|1097930_1099034_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.2	3.8e-27
>prophage 94
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1113293	1114721	4238533		Hokovirus(100.0%)	1	NA	NA
WP_163900851.1|1113293_1114721_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.9	4.8e-54
>prophage 95
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1123082	1125545	4238533		Dickeya_phage(100.0%)	1	NA	NA
WP_163900859.1|1123082_1125545_+	glycogen/starch/alpha-glucan family phosphorylase	NA	A0A140XAG6	Dickeya_phage	44.9	2.7e-12
>prophage 96
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1141202	1141427	4238533		Pelagibacter_phage(100.0%)	1	NA	NA
WP_099058844.1|1141202_1141427_+	30S ribosomal protein S21	NA	M1HLV7	Pelagibacter_phage	49.2	1.5e-07
>prophage 97
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1161712	1164484	4238533		Bartonella_henselae_phage(50.0%)	3	NA	NA
WP_163905821.1|1161712_1162348_-	outer membrane beta-barrel protein	NA	O11861	Bartonella_henselae_phage	29.0	1.2e-09
WP_163900931.1|1162681_1163275_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_163900932.1|1163350_1164484_-	type III PLP-dependent enzyme	NA	A0A1V0SKK0	Klosneuvirus	28.8	1.5e-31
>prophage 98
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1170304	1172427	4238533		Aeromonas_phage(50.0%)	3	NA	NA
WP_163900947.1|1170304_1170793_+	CYTH domain-containing protein	NA	E5DPT6	Aeromonas_phage	31.4	6.7e-08
WP_163900949.1|1170776_1171688_+	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_163900951.1|1171731_1172427_+	HTH domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	28.6	2.7e-10
>prophage 99
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1176348	1177389	4238533		Bacillus_virus(100.0%)	1	NA	NA
WP_163905826.1|1176348_1177389_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.8	8.6e-21
>prophage 100
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1181641	1182280	4238533		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_163900965.1|1181641_1182280_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	44.8	1.5e-15
>prophage 101
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1185565	1187095	4238533		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_163900971.1|1185565_1187095_-	ATP-binding cassette domain-containing protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.5	7.7e-10
>prophage 102
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1194809	1195835	4238533		Enterobacteria_phage(100.0%)	1	NA	NA
WP_163905833.1|1194809_1195835_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	54.4	3.5e-06
>prophage 103
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1199741	1200497	4238533		Moraxella_phage(100.0%)	1	NA	NA
WP_163900988.1|1199741_1200497_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	39.3	1.2e-40
>prophage 104
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1204475	1205969	4238533	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_163900994.1|1204475_1205969_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	36.1	3.4e-79
>prophage 105
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1209582	1210524	4238533		Staphylococcus_phage(100.0%)	1	NA	NA
WP_163905835.1|1209582_1210524_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.1	1.2e-10
>prophage 106
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1228670	1229660	4238533		Bacillus_virus(100.0%)	1	NA	NA
WP_163901024.1|1228670_1229660_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	37.2	1.7e-26
>prophage 107
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1236454	1244283	4238533		Synechococcus_phage(25.0%)	8	NA	NA
WP_163901038.1|1236454_1237411_-	transaldolase	NA	A0A1D8KMI9	Synechococcus_phage	32.3	9.4e-14
WP_163901040.1|1237535_1238426_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	36.0	1.1e-16
WP_163901042.1|1238507_1239005_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_163901044.1|1239027_1239807_+	endonuclease III	NA	NA	NA	NA	NA
WP_163901046.1|1239922_1240636_-	sulfate transporter family protein	NA	NA	NA	NA	NA
WP_163901048.1|1240799_1241585_-	carbon-nitrogen hydrolase family protein	NA	M1I5Z5	Acanthocystis_turfacea_Chlorella_virus	33.5	4.2e-12
WP_163901050.1|1241680_1242340_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_163901052.1|1242438_1244283_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	9.9e-20
>prophage 108
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1252170	1252953	4238533		Bacillus_virus(100.0%)	1	NA	NA
WP_163901073.1|1252170_1252953_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	43.9	2.1e-35
>prophage 109
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1257342	1260264	4238533		Staphylococcus_phage(100.0%)	1	NA	NA
WP_163901081.1|1257342_1260264_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	5.4e-20
>prophage 110
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1268127	1269716	4238533		Bacillus_virus(50.0%)	2	NA	NA
WP_163901093.1|1268127_1268886_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.1	1.3e-18
WP_163901095.1|1268882_1269716_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.5	4.5e-12
>prophage 111
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1276524	1277625	4238533		Mycoplasma_phage(100.0%)	1	NA	NA
WP_163901106.1|1276524_1277625_+	polyamine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	41.5	1.1e-26
>prophage 112
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1288360	1288699	4238533		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_163901123.1|1288360_1288699_+	YnfA family protein	NA	A0A2H4JF35	uncultured_Caudovirales_phage	49.5	6.4e-18
>prophage 113
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1293943	1296154	4238533		Bacillus_phage(50.0%)	2	NA	NA
WP_163901133.1|1293943_1295041_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	W8CYL7	Bacillus_phage	28.5	4.2e-10
WP_163901135.1|1295044_1296154_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	26.1	6.2e-25
>prophage 114
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1307888	1308455	4238533		Rhizobium_phage(100.0%)	1	NA	NA
WP_163901158.1|1307888_1308455_-	RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	31.6	1.4e-12
>prophage 115
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1322524	1324108	4238533		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_163901187.1|1322524_1324108_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.1	1.4e-09
>prophage 116
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1331918	1333478	4238533	holin	Catovirus(100.0%)	1	NA	NA
WP_163901203.1|1331918_1333478_+|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0S9M4	Catovirus	28.8	8.9e-46
>prophage 117
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1356222	1361410	4238533		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_163901230.1|1356222_1357005_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.2	9.7e-09
WP_113340873.1|1357006_1357708_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.5	7.9e-10
WP_112829236.1|1357712_1358600_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_163901232.1|1358601_1359609_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_163901234.1|1359814_1361410_+	FAD-binding protein	NA	A0A1V0S9M4	Catovirus	30.6	1.8e-54
>prophage 118
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1364595	1365627	4238533		Mycoplasma_phage(100.0%)	1	NA	NA
WP_099059025.1|1364595_1365627_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	36.3	2.7e-22
>prophage 119
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1377775	1379757	4238533		Planktothrix_phage(100.0%)	2	NA	NA
WP_163901283.1|1377775_1378759_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.0	4.2e-17
WP_163901285.1|1378755_1379757_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.8	2.3e-26
>prophage 120
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1386848	1389629	4238533		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_163901294.1|1386848_1389629_+	ribosome-associated ATPase/putative transporter RbbA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.5	3.6e-13
>prophage 121
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1398733	1401713	4238533		Catovirus(100.0%)	2	NA	NA
WP_163901308.1|1398733_1400710_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	27.3	4.5e-18
WP_163901310.1|1400975_1401713_+	glycosyltransferase family 25 protein	NA	A0A1V0SBR2	Catovirus	28.6	2.0e-08
>prophage 122
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1405087	1406137	4238533		Klosneuvirus(100.0%)	1	NA	NA
WP_163901320.1|1405087_1406137_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	30.1	2.7e-38
>prophage 123
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1412125	1413058	4238533		Brevibacillus_phage(100.0%)	1	NA	NA
WP_163901333.1|1412125_1413058_+	CbbX protein	NA	S5MNT2	Brevibacillus_phage	33.6	3.8e-36
>prophage 124
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1416213	1417571	4238533		Staphylococcus_phage(50.0%)	2	NA	NA
WP_163901342.1|1416213_1416942_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	1.0e-15
WP_163901344.1|1416938_1417571_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	35.7	1.9e-23
>prophage 125
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1425901	1426432	4238533		uncultured_virus(100.0%)	1	NA	NA
WP_163901362.1|1425901_1426432_-	c-type cytochrome, methanol metabolism-related	NA	A0A218MKF6	uncultured_virus	49.5	2.6e-21
>prophage 126
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1429744	1430872	4238533		Synechococcus_phage(100.0%)	1	NA	NA
WP_163901368.1|1429744_1430872_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.0	1.3e-33
>prophage 127
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1451623	1461666	4238533		Tupanvirus(100.0%)	2	NA	NA
WP_163901397.1|1451623_1459762_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	26.0	1.0e-84
WP_163905877.1|1459758_1461666_-	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	28.4	1.6e-49
>prophage 128
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1486009	1491348	4238533		Mycobacterium_phage(40.0%)	5	NA	NA
WP_163901439.1|1486009_1487215_-	adenylate/guanylate cyclase domain-containing protein	NA	M1HLN3	Pelagibacter_phage	27.8	4.4e-08
WP_163901441.1|1487402_1488377_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	73.8	2.8e-138
WP_163905879.1|1488570_1490718_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	52.1	1.9e-208
WP_163901443.1|1490714_1491113_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	S6ANL8	Bacillus_phage	35.5	1.6e-12
WP_163901445.1|1491126_1491348_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	61.6	1.9e-18
>prophage 129
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1496650	1498461	4238533		Indivirus(50.0%)	2	NA	NA
WP_163901455.1|1496650_1497436_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	26.9	8.5e-13
WP_163901457.1|1497432_1498461_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.0	8.0e-11
>prophage 130
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1501580	1503419	4238533		Bacillus_phage(100.0%)	1	NA	NA
WP_163901459.1|1501580_1503419_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	25.4	3.4e-20
>prophage 131
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1506673	1508191	4238533		Bacillus_phage(100.0%)	1	NA	NA
WP_163901467.1|1506673_1508191_-	ABC transporter permease subunit	NA	W8CYL7	Bacillus_phage	33.1	3.7e-20
>prophage 132
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1545585	1549382	4238533		Mycoplasma_phage(50.0%)	4	NA	NA
WP_163901526.1|1545585_1546644_+	polyamine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	34.8	8.5e-24
WP_163901528.1|1546640_1547501_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_163901530.1|1547502_1548285_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_163901532.1|1548344_1549382_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	1.4e-26
>prophage 133
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1565150	1566727	4238533		Pithovirus(50.0%)	2	NA	NA
WP_163901562.1|1565150_1565960_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	26.1	5.7e-12
WP_163901564.1|1565956_1566727_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	27.9	1.1e-15
>prophage 134
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1578886	1579837	4238533		Mollivirus(100.0%)	1	NA	NA
WP_163901574.1|1578886_1579837_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	31.4	7.9e-29
>prophage 135
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1613181	1614066	4238533		Synechococcus_phage(100.0%)	1	NA	NA
WP_163901614.1|1613181_1614066_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	42.2	8.1e-12
>prophage 136
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1626993	1629387	4238533		Hokovirus(100.0%)	1	NA	NA
WP_163901630.1|1626993_1629387_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.0	6.3e-168
>prophage 137
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1645962	1648451	4238533		Acinetobacter_phage(50.0%)	3	NA	NA
WP_163901654.1|1645962_1647060_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.8	3.1e-61
WP_163901656.1|1647152_1647893_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_163901658.1|1648007_1648451_-	pseudoazurin	NA	A0A1D8KSC7	Synechococcus_phage	41.9	2.8e-05
>prophage 138
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1659120	1659927	4238533		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_163901671.1|1659120_1659927_-	AAA domain-containing protein	NA	A0A2H4N7N3	Lake_Baikal_phage	25.1	1.0e-08
>prophage 139
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1682528	1683311	4238533		Cedratvirus(100.0%)	1	NA	NA
WP_163901704.1|1682528_1683311_-	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	27.6	2.2e-13
>prophage 140
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1687545	1691407	4238533		Mycobacterium_phage(50.0%)	2	NA	NA
WP_163901710.1|1687545_1690260_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	45.0	2.1e-79
WP_163901712.1|1690420_1691407_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	36.6	9.6e-54
>prophage 141
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1696860	1698000	4238533		Burkholderia_phage(100.0%)	1	NA	NA
WP_163901724.1|1696860_1698000_-	acyltransferase family protein	NA	Q6QI96	Burkholderia_phage	37.4	3.9e-51
>prophage 142
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1706005	1710609	4238533		Planktothrix_phage(33.33%)	5	NA	NA
WP_163905909.1|1706005_1707004_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.5	6.6e-18
WP_163901738.1|1707004_1707991_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	25.5	5.9e-11
WP_163901740.1|1708007_1708934_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_163901742.1|1708947_1709829_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_163901744.1|1709862_1710609_+	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	33.8	1.7e-07
>prophage 143
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1715817	1720998	4238533		Staphylococcus_phage(50.0%)	4	NA	NA
WP_163901756.1|1715817_1716987_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.2	4.4e-13
WP_163901758.1|1716983_1717820_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_163901760.1|1717994_1719797_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_163901762.1|1719924_1720998_-	zinc-binding dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.2	3.3e-15
>prophage 144
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1738808	1740040	4238533	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_163901778.1|1738808_1740040_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	65.6	1.5e-101
>prophage 145
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1747497	1757655	4238533		Planktothrix_phage(25.0%)	7	NA	NA
WP_163901782.1|1747497_1749441_+	peptidoglycan DD-metalloendopeptidase family protein	NA	G9BW84	Planktothrix_phage	43.3	2.8e-20
WP_163901784.1|1749573_1752174_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	38.3	3.3e-122
WP_163901786.1|1752409_1753063_-	DUF4167 domain-containing protein	NA	NA	NA	NA	NA
WP_163898879.1|1753070_1753439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163901788.1|1753392_1754286_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_163901790.1|1754282_1755362_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	44.3	9.0e-05
WP_163901792.1|1755387_1757655_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.4	1.7e-05
>prophage 146
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1765221	1767365	4238533		Klosneuvirus(50.0%)	4	NA	NA
WP_163901804.1|1765221_1765773_+	DUF924 family protein	NA	A0A1V0SIY0	Klosneuvirus	38.1	7.5e-16
WP_163901806.1|1765810_1766239_-	DUF1178 family protein	NA	NA	NA	NA	NA
WP_163901808.1|1766235_1767096_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_163901810.1|1767107_1767365_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	55.4	1.6e-16
>prophage 147
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1779117	1780755	4238533		Staphylococcus_phage(100.0%)	1	NA	NA
WP_163901829.1|1779117_1780755_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	35.4	1.2e-64
>prophage 148
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1783889	1784447	4238533		Virus_Rctr197k(100.0%)	1	NA	NA
WP_163901833.1|1783889_1784447_-	HNH endonuclease	NA	A0A1P8DIY8	Virus_Rctr197k	39.0	4.2e-22
>prophage 149
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1796704	1797973	4238533		Bovine_gammaherpesvirus(100.0%)	1	NA	NA
WP_163901856.1|1796704_1797973_-	diaminopimelate decarboxylase	NA	A0A060D2X4	Bovine_gammaherpesvirus	26.6	1.0e-15
>prophage 150
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1803099	1803759	4238533		Klosneuvirus(100.0%)	1	NA	NA
WP_163901868.1|1803099_1803759_-	cell division ATP-binding protein FtsE	NA	A0A1V0SKJ1	Klosneuvirus	26.5	1.1e-10
>prophage 151
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1808476	1809580	4238533		Pacmanvirus(100.0%)	1	NA	NA
WP_163901883.1|1808476_1809580_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.4	8.6e-19
>prophage 152
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1814769	1819376	4238533		Vibrio_phage(33.33%)	4	NA	NA
WP_163901897.1|1814769_1815405_+	queuosine precursor transporter	NA	A0A2I7SAW6	Vibrio_phage	34.2	3.1e-21
WP_163901899.1|1815438_1816476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099059487.1|1816465_1818370_-	cobaltochelatase subunit CobT	NA	J9Q7G6	Salmonella_phage	29.9	1.6e-17
WP_163901901.1|1818383_1819376_-	cobaltochelatase subunit CobS	NA	L7TKP0	Rhizobium_phage	30.9	1.6e-40
>prophage 153
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1823437	1824379	4238533		Brevibacillus_phage(100.0%)	1	NA	NA
WP_163901913.1|1823437_1824379_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.3	1.4e-30
>prophage 154
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1832813	1834658	4238533		Streptococcus_phage(100.0%)	1	NA	NA
WP_163901930.1|1832813_1834658_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.6	2.7e-65
>prophage 155
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1841885	1842374	4238533		Acinetobacter_phage(100.0%)	1	NA	NA
WP_163901942.1|1841885_1842374_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	A0A0P0IVM8	Acinetobacter_phage	36.5	1.6e-17
>prophage 156
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1849811	1853451	4238533		Klosneuvirus(50.0%)	3	NA	NA
WP_163901950.1|1849811_1850744_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	35.3	1.2e-26
WP_163901952.1|1851184_1852972_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_163901954.1|1852971_1853451_+	purine-binding chemotaxis protein CheW	NA	Q56AR1	Bacillus_thuringiensis_phage	24.8	1.1e-07
>prophage 157
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1866712	1869554	4238533	holin	Oenococcus_phage(50.0%)	2	NA	NA
WP_163901976.1|1866712_1867930_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	36.4	3.1e-54
WP_163901978.1|1867940_1869554_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.6	4.4e-56
>prophage 158
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1884252	1888952	4238533	integrase	Leptospira_phage(50.0%)	5	1873798:1873812	1891362:1891376
1873798:1873812	attL	CTTGACGGTGTCGCC	NA	NA	NA	NA
WP_163901996.1|1884252_1885215_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	28.7	6.5e-15
WP_163901998.1|1885288_1886383_+	polysaccharide biosynthesis protein GumN	NA	NA	NA	NA	NA
WP_163902000.1|1886388_1886871_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_163902002.1|1886906_1887407_-	cytochrome b	NA	NA	NA	NA	NA
WP_163902004.1|1887545_1888952_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	30.5	2.1e-46
1891362:1891376	attR	CTTGACGGTGTCGCC	NA	NA	NA	NA
>prophage 159
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1906457	1907555	4238533	tRNA	Moraxella_phage(100.0%)	1	NA	NA
WP_163902025.1|1906457_1907555_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	44.9	1.3e-72
>prophage 160
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1915499	1916033	4238533		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_163902043.1|1915499_1916033_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	50.9	2.3e-46
>prophage 161
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1934659	1935373	4238533		Planktothrix_phage(100.0%)	1	NA	NA
WP_163902075.1|1934659_1935373_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.3	1.6e-34
>prophage 162
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1941403	1944484	4238533		Salicola_phage(100.0%)	1	NA	NA
WP_163905929.1|1941403_1944484_-	helicase	NA	A0A248SJQ0	Salicola_phage	31.8	6.9e-26
>prophage 163
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1989141	1990881	4238533		Bacillus_phage(100.0%)	1	NA	NA
WP_163902141.1|1989141_1990881_+	glucan ABC transporter ATP-binding protein/ permease	NA	W8CYL7	Bacillus_phage	27.1	2.4e-39
>prophage 164
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	1996438	1997761	4238533		Moraxella_phage(100.0%)	1	NA	NA
WP_163902150.1|1996438_1997761_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.6	1.4e-23
>prophage 165
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2001097	2003558	4238533		Streptococcus_phage(100.0%)	2	NA	NA
WP_163902159.1|2001097_2002384_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	2.6e-91
WP_163902161.1|2002376_2003558_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.1	8.5e-57
>prophage 166
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2008241	2009330	4238533		Brochothrix_phage(100.0%)	1	NA	NA
WP_163902173.1|2008241_2009330_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	6.7e-24
>prophage 167
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2012420	2018536	4238533	integrase	Burkholderia_phage(33.33%)	6	2003839:2003853	2019872:2019886
2003839:2003853	attL	TTCCAGCTCATGCTT	NA	NA	NA	NA
WP_163902176.1|2012420_2013413_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A1I5U0	Burkholderia_phage	39.8	5.8e-59
WP_163902178.1|2013593_2013833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163902180.1|2014094_2014493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163902182.1|2014530_2015619_-	HigA family addiction module antidote protein	NA	A0A0N7BS23	Escherichia_phage	35.6	4.8e-06
WP_163902184.1|2015661_2015994_-	system killer suppression protein	NA	NA	NA	NA	NA
WP_163902188.1|2017063_2018536_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	31.4	1.6e-33
2019872:2019886	attR	AAGCATGAGCTGGAA	NA	NA	NA	NA
>prophage 168
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2027941	2031280	4238533		Cronobacter_phage(100.0%)	1	NA	NA
WP_163902208.1|2027941_2031280_-	error-prone DNA polymerase	NA	A0A096XUX6	Cronobacter_phage	30.5	1.1e-48
>prophage 169
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2039937	2043339	4238533	protease	Salisaeta_icosahedral_phage(50.0%)	3	NA	NA
WP_163902226.1|2039937_2040810_+	RNA polymerase factor sigma-32	NA	I1ZBD5	Salisaeta_icosahedral_phage	26.6	6.8e-11
WP_163902228.1|2040829_2042356_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_163902230.1|2042610_2043339_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.0	1.2e-24
>prophage 170
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2048306	2050139	4238533		Tupanvirus(100.0%)	1	NA	NA
WP_163902235.1|2048306_2050139_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.1	6.0e-33
>prophage 171
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2056176	2058969	4238533	tRNA	Trichoplusia_ni_ascovirus(50.0%)	3	NA	NA
WP_163902249.1|2056176_2056944_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.5	2.0e-11
WP_163902251.1|2057409_2057931_+|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_163902253.1|2057991_2058969_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	40.2	8.7e-15
>prophage 172
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2062829	2070119	4238533		Ostreococcus_tauri_virus(33.33%)	6	NA	NA
WP_163902262.1|2062829_2064191_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	29.7	2.1e-30
WP_163902264.1|2064543_2067204_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	44.1	2.0e-77
WP_163902266.1|2067303_2067960_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_163902268.1|2068044_2068848_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_163902270.1|2068956_2069412_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_163902272.1|2069435_2070119_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.2	1.3e-22
>prophage 173
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2092637	2099706	4238533		uncultured_phage(33.33%)	9	NA	NA
WP_163902309.1|2092637_2093999_+	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	38.9	3.4e-17
WP_163902311.1|2094047_2094698_+	septation protein A	NA	NA	NA	NA	NA
WP_163902313.1|2094694_2095285_+	DUF2585 family protein	NA	NA	NA	NA	NA
WP_163902315.1|2095488_2096676_+	diguanylate cyclase	NA	A0A2D0WB36	Bordetella_virus	42.2	2.4e-06
WP_163902317.1|2096659_2097280_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_163902319.1|2097276_2097453_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_163902321.1|2097449_2098217_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_163902323.1|2098262_2098922_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_163902325.1|2099058_2099706_-	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	26.8	3.6e-09
>prophage 174
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2104051	2106121	4238533		Bacillus_phage(100.0%)	1	NA	NA
WP_163905959.1|2104051_2106121_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	28.6	8.4e-68
>prophage 175
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2109573	2110389	4238533		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_163902333.1|2109573_2110389_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.6	3.6e-14
>prophage 176
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2124479	2129481	4238533		Bacillus_virus(50.0%)	5	NA	NA
WP_163902356.1|2124479_2126015_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	26.6	1.7e-17
WP_163902357.1|2126129_2127200_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_163902359.1|2127370_2128318_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163902361.1|2128418_2128817_+	DUF2794 domain-containing protein	NA	NA	NA	NA	NA
WP_163902363.1|2128923_2129481_-	GNAT family N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	38.5	1.2e-21
>prophage 177
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2144134	2145751	4238533		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_163902379.1|2144134_2145751_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	49.2	3.5e-45
>prophage 178
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2151411	2163253	4238533	tRNA	Staphylococcus_phage(60.0%)	9	NA	NA
WP_099059771.1|2151411_2153364_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	1.5e-82
WP_099059772.1|2153601_2154303_+	DUF1013 domain-containing protein	NA	NA	NA	NA	NA
WP_163902390.1|2154416_2156324_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	30.9	8.6e-59
WP_163902392.1|2156445_2157105_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_163902394.1|2157307_2159935_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.4	4.8e-169
WP_163905965.1|2159945_2160446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163902396.1|2160457_2161504_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_163902398.1|2161548_2162430_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	39.5	8.9e-19
WP_163902400.1|2162458_2163253_-	AAA family ATPase	NA	Q8JL10	Natrialba_phage	29.3	4.3e-20
>prophage 179
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2173629	2174331	4238533		Bradyrhizobium_phage(100.0%)	1	NA	NA
WP_163902417.1|2173629_2174331_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	51.7	7.3e-56
>prophage 180
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2178494	2180930	4238533		Bacillus_virus(100.0%)	1	NA	NA
WP_163902429.1|2178494_2180930_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.9	6.3e-115
>prophage 181
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2190037	2193988	4238533		Streptomyces_phage(50.0%)	2	NA	NA
WP_099055916.1|2190037_2190358_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	48.5	5.5e-19
WP_163902444.1|2190433_2193988_-	double-strand break repair helicase AddA	NA	G3MA40	Bacillus_virus	28.7	7.1e-06
>prophage 182
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2197164	2203724	4238533	tRNA	Bacillus_virus(25.0%)	4	NA	NA
WP_163902448.1|2197164_2197896_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	24.8	1.2e-08
WP_163902450.1|2198014_2199529_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	A0A1V0SB89	Catovirus	27.9	9.7e-05
WP_163905976.1|2199525_2202084_-	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	23.8	1.2e-20
WP_163902452.1|2202323_2203724_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	31.9	7.5e-44
>prophage 183
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2207033	2220432	4238533	tRNA,protease	Bacillus_thuringiensis_phage(14.29%)	15	NA	NA
WP_163905979.1|2207033_2207774_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	33.3	3.5e-08
WP_163902461.1|2208095_2209706_+	phosphoenolpyruvate carboxykinase	NA	A0A2H4PQN1	Staphylococcus_phage	50.9	8.3e-148
WP_163902463.1|2209804_2210239_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_163902465.1|2210327_2210801_+	peptidoglycan-binding protein LysM	NA	G3MBQ1	Bacillus_virus	34.5	4.6e-06
WP_163902467.1|2210840_2211467_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	NA	NA	NA	NA
WP_099055930.1|2211516_2212512_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.9	1.1e-28
WP_163902468.1|2212508_2212832_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_163902470.1|2212849_2213638_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_163902472.1|2213652_2214387_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	A0A2H4UVM0	Bodo_saltans_virus	28.2	1.2e-05
WP_163902473.1|2214418_2215069_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_099055935.1|2215167_2215776_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_163902475.1|2215985_2216513_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_163902477.1|2216562_2217870_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	2.5e-41
WP_163902479.1|2218030_2218978_+	DUF1402 family protein	NA	NA	NA	NA	NA
WP_163905981.1|2219022_2220432_+	cytochrome P450	NA	I6XNL0	Cotesia_sesamiae_Mombasa_bracovirus	25.6	3.9e-24
>prophage 184
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2241720	2243256	4238533		Catovirus(100.0%)	1	NA	NA
WP_163902501.1|2241720_2243256_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.5	3.6e-76
>prophage 185
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2247190	2247988	4238533		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_163902510.1|2247190_2247988_-	serine/threonine protein phosphatase	NA	S5MD19	Sinorhizobium_phage	32.2	2.2e-24
>prophage 186
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2264788	2271399	4238533		Bacillus_virus(75.0%)	6	NA	NA
WP_163902534.1|2264788_2265637_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.5	7.3e-18
WP_163902536.1|2265633_2266497_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.2	6.7e-19
WP_163902538.1|2266773_2267538_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163902540.1|2267658_2269170_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_163902542.1|2269231_2270314_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.1	2.4e-21
WP_163902544.1|2270328_2271399_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	26.5	3.7e-19
>prophage 187
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2276875	2278501	4238533		Swinepox_virus(100.0%)	1	NA	NA
WP_163902554.1|2276875_2278501_-	cisplatin damage response ATP-dependent DNA ligase	NA	Q8V3G6	Swinepox_virus	24.8	4.1e-09
>prophage 188
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2282018	2295640	4238533		uncultured_Caudovirales_phage(40.0%)	12	NA	NA
WP_099056040.1|2282018_2282387_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	34.8	1.8e-10
WP_163902560.1|2282383_2284420_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_163902562.1|2284416_2284938_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_163902564.1|2284956_2286654_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.4	5.0e-10
WP_163902566.1|2286863_2288678_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.5	6.8e-13
WP_163902567.1|2288680_2289163_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_163902569.1|2289183_2290038_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_163902571.1|2290044_2291136_+	chemotaxis-specific protein-glutamate methyltransferase CheB	NA	NA	NA	NA	NA
WP_163902573.1|2291362_2292082_+	AAA family ATPase	NA	A0A0A8IL09	Aurantimonas_phage	37.5	3.7e-31
WP_163902574.1|2292136_2293558_-	phosphomannomutase	NA	NA	NA	NA	NA
WP_163902576.1|2293643_2294954_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_163902578.1|2294950_2295640_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.7	6.5e-25
>prophage 189
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2300054	2304667	4238533		Tupanvirus(50.0%)	5	NA	NA
WP_163902587.1|2300054_2301575_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	24.1	8.5e-17
WP_163902589.1|2301655_2302282_+	ribonuclease D	NA	NA	NA	NA	NA
WP_163902591.1|2302338_2302695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163902592.1|2302881_2303232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163902594.1|2303260_2304667_-	nicotinate phosphoribosyltransferase	NA	A0A1B0V392	Roseobacter_phage	45.0	1.3e-107
>prophage 190
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2325926	2328659	4238533		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_163902637.1|2325926_2328659_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.7	6.4e-23
>prophage 191
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2336771	2338652	4238533		Streptococcus_virus(100.0%)	1	NA	NA
WP_163902650.1|2336771_2338652_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	35.2	6.5e-43
>prophage 192
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2345808	2354602	4238533		Only_Syngen_Nebraska_virus(25.0%)	11	NA	NA
WP_163902667.1|2345808_2346813_+	D-glycerate dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	27.5	7.3e-25
WP_163902669.1|2346813_2347299_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_163902671.1|2347295_2348063_-	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A291ATS8	Pandoravirus	31.6	3.9e-10
WP_163902673.1|2348108_2349236_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_164490817.1|2349427_2349694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163902677.1|2349823_2350033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163902678.1|2350039_2350639_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163902680.1|2350742_2350994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163902682.1|2351059_2352214_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.4	3.2e-24
WP_163902683.1|2352218_2352692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163902685.1|2352691_2354602_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	52.1	1.5e-151
>prophage 193
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2360668	2363662	4238533		Bacillus_phage(100.0%)	1	NA	NA
WP_163905997.1|2360668_2363662_+	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	32.4	1.0e-69
>prophage 194
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2374779	2377869	4238533		Planktothrix_phage(66.67%)	4	NA	NA
WP_163902709.1|2374779_2375634_-	phosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.7	1.7e-19
WP_163902711.1|2375756_2376374_-	acetyltransferase	NA	NA	NA	NA	NA
WP_163902713.1|2376370_2377078_-	phosphonate C-P lyase system protein PhnL	NA	G9BWD6	Planktothrix_phage	33.0	1.8e-14
WP_099056118.1|2377092_2377869_-	phosphonate C-P lyase system protein PhnK	NA	G9BWD6	Planktothrix_phage	31.3	6.2e-16
>prophage 195
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2383483	2385274	4238533		Bacillus_phage(100.0%)	1	NA	NA
WP_163902726.1|2383483_2385274_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.1	4.6e-54
>prophage 196
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2392528	2396953	4238533		Planktothrix_phage(50.0%)	4	NA	NA
WP_163902738.1|2392528_2394157_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	5.1e-20
WP_163902740.1|2394203_2395166_+	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_163902742.1|2395261_2395528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163902744.1|2395648_2396953_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	54.4	6.6e-135
>prophage 197
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2403476	2405063	4238533		Enterobacteria_phage(100.0%)	1	NA	NA
WP_163902755.1|2403476_2405063_-	BON domain-containing protein	NA	A7BJX1	Enterobacteria_phage	25.0	3.0e-09
>prophage 198
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2413036	2419945	4238533		Geobacillus_virus(33.33%)	7	NA	NA
WP_163902772.1|2413036_2414347_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	43.2	1.8e-84
WP_163902774.1|2414364_2415138_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_163902776.1|2415124_2415940_-	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.8	7.9e-46
WP_163902778.1|2415936_2416329_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_163902780.1|2416332_2417304_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_163902782.1|2417313_2418417_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_163902784.1|2418424_2419945_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	1.5e-18
>prophage 199
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2441387	2442536	4238533		Bacillus_virus(100.0%)	1	NA	NA
WP_163902802.1|2441387_2442536_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.5	4.1e-24
>prophage 200
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2446652	2447444	4238533		Bacillus_virus(100.0%)	1	NA	NA
WP_163902812.1|2446652_2447444_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	36.9	6.3e-32
>prophage 201
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2452371	2457122	4238533		Bacillus_virus(33.33%)	5	NA	NA
WP_163902821.1|2452371_2453178_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	39.6	2.4e-34
WP_163902823.1|2453174_2454014_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_163902825.1|2454074_2454662_+	DUF1949 domain-containing protein	NA	A0A1X9I5T8	Streptococcus_phage	44.4	3.5e-19
WP_163902827.1|2454694_2455552_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_163902829.1|2455730_2457122_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	34.0	2.4e-34
>prophage 202
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2463988	2465602	4238533		Escherichia_phage(100.0%)	1	NA	NA
WP_163902842.1|2463988_2465602_-	site-specific DNA-methyltransferase	NA	A0A220NUF4	Escherichia_phage	32.6	2.5e-51
>prophage 203
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2473569	2475393	4238533		Streptococcus_phage(100.0%)	1	NA	NA
WP_163902865.1|2473569_2475393_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.2	5.6e-23
>prophage 204
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2482424	2483450	4238533		Tupanvirus(100.0%)	1	NA	NA
WP_163902879.1|2482424_2483450_+	histone deacetylase family protein	NA	A0A2K9L0J7	Tupanvirus	36.3	4.6e-43
>prophage 205
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2495692	2496781	4238533		Mycoplasma_phage(100.0%)	1	NA	NA
WP_163902901.1|2495692_2496781_-	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	30.2	5.5e-18
>prophage 206
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2501102	2503721	4238533	tRNA	Orpheovirus(50.0%)	4	NA	NA
WP_112827575.1|2501102_2502188_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	31.8	2.2e-27
WP_099056272.1|2502320_2502725_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_099056273.1|2502767_2502971_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_163906029.1|2503184_2503721_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.0	1.2e-10
>prophage 207
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2520403	2524128	4238533		Verrucomicrobia_phage(33.33%)	5	NA	NA
WP_163902940.1|2520403_2520667_-	hypothetical protein	NA	A0A0E3M2R3	Verrucomicrobia_phage	43.1	6.8e-07
WP_163902942.1|2520882_2522502_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	35.2	5.6e-35
WP_163902944.1|2522501_2523101_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_163902946.1|2523286_2523622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163902948.1|2523918_2524128_+	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	45.0	2.0e-09
>prophage 208
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2528733	2529687	4238533		Bacillus_phage(100.0%)	1	NA	NA
WP_163902961.1|2528733_2529687_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.9	4.1e-17
>prophage 209
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2539955	2540318	4238533		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_113446997.1|2539955_2540318_-	septal ring lytic transglycosylase RlpA family protein	NA	A0A0F6SJ38	Sinorhizobium_phage	70.1	2.1e-30
>prophage 210
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2548260	2550540	4238533		Rhizobium_phage(50.0%)	2	NA	NA
WP_163902991.1|2548260_2549379_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	48.7	1.9e-82
WP_163902993.1|2549616_2550540_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.2	7.8e-50
>prophage 211
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2554176	2555292	4238533		Planktothrix_phage(100.0%)	1	NA	NA
WP_163903001.1|2554176_2555292_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.5	2.7e-20
>prophage 212
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2558798	2559767	4238533		Streptococcus_phage(100.0%)	1	NA	NA
WP_163903010.1|2558798_2559767_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	53.9	2.4e-81
>prophage 213
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2564187	2566337	4238533		Caulobacter_phage(50.0%)	2	NA	NA
WP_163903021.1|2564187_2564661_-	dUTP diphosphatase	NA	K4JSC8	Caulobacter_phage	55.2	5.6e-44
WP_163903023.1|2564753_2566337_+	peptide chain release factor 3	NA	E4ZFJ7	Streptococcus_phage	28.6	3.2e-35
>prophage 214
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2573296	2577983	4238533		Methanothermobacter_phage(33.33%)	4	NA	NA
WP_163903040.1|2573296_2574508_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.4	1.9e-40
WP_163903042.1|2574589_2576164_-	2-polyprenylphenol 6-hydroxylase	NA	A0A2P0VMP1	Tetraselmis_virus	23.4	3.7e-15
WP_163903044.1|2576169_2576946_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_163903046.1|2577092_2577983_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	31.0	7.6e-26
>prophage 215
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2585524	2586169	4238533		Ugandan_cassava_brown_streak_virus(100.0%)	1	NA	NA
WP_163903061.1|2585524_2586169_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	30.0	5.9e-12
>prophage 216
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2592466	2593213	4238533		Cedratvirus(100.0%)	1	NA	NA
WP_163906044.1|2592466_2593213_-	LPS export ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	30.1	1.2e-16
>prophage 217
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2603016	2605668	4238533		Klosneuvirus(100.0%)	1	NA	NA
WP_163906048.1|2603016_2605668_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.1	1.3e-25
>prophage 218
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2613228	2613792	4238533		uncultured_virus(100.0%)	1	NA	NA
WP_163903097.1|2613228_2613792_+	NifU family protein	NA	A0A218MN08	uncultured_virus	37.8	8.2e-10
>prophage 219
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2617881	2618937	4238533		Erwinia_phage(100.0%)	1	NA	NA
WP_163903107.1|2617881_2618937_+	AAA family ATPase	NA	A0A223LII3	Erwinia_phage	46.0	2.2e-48
>prophage 220
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2622474	2624321	4238533		Sinorhizobium_phage(50.0%)	2	NA	NA
WP_099056392.1|2622474_2622894_+	helix-turn-helix transcriptional regulator	NA	Q8W6G2	Sinorhizobium_phage	59.4	8.0e-34
WP_163903115.1|2623058_2624321_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	48.1	3.8e-95
>prophage 221
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2635295	2635811	4238533		Synechococcus_phage(100.0%)	1	NA	NA
WP_163903132.1|2635295_2635811_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	44.6	3.5e-23
>prophage 222
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2640873	2645055	4238533		Synechococcus_phage(50.0%)	5	NA	NA
WP_163903146.1|2640873_2641755_+	LOG family protein	NA	A0A1D8KU27	Synechococcus_phage	32.4	3.1e-11
WP_163903148.1|2641818_2642610_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_163903150.1|2642722_2643433_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_163903152.1|2643536_2644439_+	EamA family transporter	NA	NA	NA	NA	NA
WP_163903154.1|2644518_2645055_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	47.6	3.5e-18
>prophage 223
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2669356	2673806	4238533		Aureococcus_anophage(50.0%)	4	NA	NA
WP_163903195.1|2669356_2670139_+	ATP-binding cassette domain-containing protein	NA	A0A076FI99	Aureococcus_anophage	27.5	6.3e-08
WP_163906055.1|2670147_2670768_+	nucleoside/nucleotide kinase family protein	NA	NA	NA	NA	NA
WP_163903197.1|2671013_2671406_+	response regulator	NA	NA	NA	NA	NA
WP_163906057.1|2671580_2673806_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	33.9	5.2e-47
>prophage 224
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2677388	2685002	4238533		Pandoravirus(33.33%)	6	NA	NA
WP_163903205.1|2677388_2678081_+	orotate phosphoribosyltransferase	NA	S4W4D9	Pandoravirus	33.1	3.4e-13
WP_163903207.1|2678227_2679154_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_163903209.1|2679219_2680845_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_163903211.1|2680977_2682693_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.5	3.3e-33
WP_163903213.1|2683013_2683406_+	PRC-barrel domain containing protein	NA	NA	NA	NA	NA
WP_163903215.1|2683691_2685002_+	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	40.0	3.4e-83
>prophage 225
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2689072	2700116	4238533		Bacillus_phage(50.0%)	10	NA	NA
WP_163903222.1|2689072_2690356_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.2	4.8e-29
WP_163903223.1|2690603_2691629_+	phosphonate ABC transporter substrate-binding protein	NA	A0A1B1IWY0	uncultured_Mediterranean_phage	42.0	1.3e-64
WP_163903225.1|2691801_2693289_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_163903227.1|2693285_2694614_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_163903229.1|2694627_2695443_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	7.5e-12
WP_163903231.1|2695490_2696204_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_112827844.1|2696237_2696921_+	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	38.5	7.9e-39
WP_163903233.1|2697013_2697544_-	GcrA cell cycle regulator	NA	NA	NA	NA	NA
WP_163903235.1|2697982_2699194_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.8	2.1e-26
WP_163903237.1|2699198_2700116_+	ornithine carbamoyltransferase	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	28.5	2.0e-21
>prophage 226
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2738270	2749308	4238533		Clanis_bilineata_nucleopolyhedrovirus(33.33%)	7	NA	NA
WP_163903284.1|2738270_2739683_-	universal stress protein	NA	Q0N495	Clanis_bilineata_nucleopolyhedrovirus	32.6	7.6e-12
WP_163903285.1|2739685_2740426_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_163903286.1|2741082_2742570_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_163903287.1|2742606_2746116_-	response regulator	NA	Q8QNA2	Ectocarpus_siliculosus_virus	32.4	4.2e-19
WP_163903288.1|2746332_2746758_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_163903289.1|2746911_2748081_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_163903290.1|2748273_2749308_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	34.7	2.5e-44
>prophage 227
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2760769	2761822	4238533		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_163903314.1|2760769_2761822_+	acyltransferase family protein	NA	A0A2H4JA46	uncultured_Caudovirales_phage	31.2	4.8e-19
>prophage 228
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2772521	2774978	4238533		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_163903345.1|2772521_2774180_+	globin-coupled sensor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.4	2.2e-10
WP_163903346.1|2774316_2774613_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_099056616.1|2774612_2774978_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	35.9	3.0e-13
>prophage 229
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2779725	2780115	4238533		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_099056621.1|2779725_2780115_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	32.3	3.1e-08
>prophage 230
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2783199	2783946	4238533		Aeromonas_phage(100.0%)	1	NA	NA
WP_163903362.1|2783199_2783946_+	helix-turn-helix transcriptional regulator	NA	A0A1I9KF49	Aeromonas_phage	49.2	3.9e-07
>prophage 231
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2826072	2833078	4238533		Yellowstone_lake_phycodnavirus(40.0%)	5	NA	NA
WP_163903437.1|2826072_2827176_+	FkbM family methyltransferase	NA	A0A0A0V284	uncultured_virus	34.2	5.8e-07
WP_163903439.1|2827325_2828684_-	lipopolysaccharide biosynthesis protein RfbH	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	36.2	5.4e-47
WP_163906080.1|2828789_2830598_-	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	37.6	4.6e-94
WP_163906082.1|2830599_2831646_-	NAD-dependent epimerase/dehydratase family protein	NA	M1GXM0	Acanthocystis_turfacea_Chlorella_virus	26.9	1.3e-19
WP_163903441.1|2831926_2833078_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	44.0	2.7e-76
>prophage 232
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2844560	2845460	4238533		Enterococcus_phage(100.0%)	1	NA	NA
WP_163903459.1|2844560_2845460_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.6	2.0e-29
>prophage 233
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2852156	2853245	4238533		Bacillus_phage(100.0%)	1	NA	NA
WP_163903466.1|2852156_2853245_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	W8CYL7	Bacillus_phage	31.3	3.7e-14
>prophage 234
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2864676	2867005	4238533		Phage_NCTB(50.0%)	3	NA	NA
WP_163903488.1|2864676_2865276_-	NUDIX domain-containing protein	NA	A0A1C3NEZ8	Phage_NCTB	30.4	3.1e-07
WP_163903490.1|2865356_2866001_+	DUF47 domain-containing protein	NA	NA	NA	NA	NA
WP_099056690.1|2866000_2867005_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	29.5	1.4e-12
>prophage 235
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2871183	2872656	4238533		Cyanophage(100.0%)	1	NA	NA
WP_163903499.1|2871183_2872656_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.1	2.3e-75
>prophage 236
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2885251	2886412	4238533		Bacillus_virus(100.0%)	1	NA	NA
WP_163903522.1|2885251_2886412_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	1.1e-27
>prophage 237
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2898614	2908071	4238533		Hokovirus(33.33%)	5	NA	NA
WP_163903538.1|2898614_2902370_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	25.4	6.5e-26
WP_163903540.1|2902626_2903076_+	phasin	NA	NA	NA	NA	NA
WP_163906086.1|2903445_2905785_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	41.9	9.0e-127
WP_163906088.1|2906112_2907138_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_163903542.1|2907138_2908071_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.3	1.0e-20
>prophage 238
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2923833	2928513	4238533	holin	Catovirus(33.33%)	4	NA	NA
WP_163903567.1|2923833_2925432_+|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0S9J5	Catovirus	29.5	1.3e-47
WP_163906096.1|2925565_2926054_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_163903577.1|2926079_2927426_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	6.8e-18
WP_163903579.1|2927640_2928513_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	50.0	8.7e-83
>prophage 239
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2938837	2941096	4238533		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_163906098.1|2938837_2941096_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	32.0	6.0e-19
>prophage 240
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2946880	2950771	4238533		Tupanvirus(66.67%)	3	NA	NA
WP_163903602.1|2946880_2947912_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9KZK0	Tupanvirus	45.4	5.6e-73
WP_163903604.1|2947913_2948897_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	34.4	3.4e-43
WP_163903606.1|2948893_2950771_+	glycosyltransferase	NA	M1ID39	Paramecium_bursaria_Chlorella_virus	37.7	1.6e-81
>prophage 241
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2960247	2965388	4238533		Klosneuvirus(33.33%)	5	NA	NA
WP_163903624.1|2960247_2961738_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.1	1.6e-92
WP_163903626.1|2961827_2962244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163903628.1|2962354_2963230_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_163903630.1|2963426_2964452_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	28.6	3.9e-34
WP_163903632.1|2964482_2965388_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.8	7.5e-13
>prophage 242
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2976307	2978481	4238533		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_163903648.1|2976307_2977813_-	inorganic phosphate transporter	NA	V5LQA0	Emiliania_huxleyi_virus	37.0	7.1e-16
WP_163906106.1|2978013_2978481_-	NUDIX domain-containing protein	NA	A0A1C3NEZ8	Phage_NCTB	28.6	1.3e-05
>prophage 243
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	2999360	3003233	4238533	tRNA	uncultured_virus(50.0%)	5	NA	NA
WP_164490797.1|2999360_2999759_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	60.0	6.0e-15
WP_163903689.1|2999832_3000222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163903691.1|3000304_3001057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163903693.1|3001083_3001527_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_163903695.1|3001706_3003233_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	26.2	3.0e-30
>prophage 244
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3008983	3018649	4238533	tRNA	uncultured_virus(50.0%)	8	NA	NA
WP_163903708.1|3008983_3010624_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.0	6.9e-174
WP_099056823.1|3010683_3010980_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	58.7	1.9e-21
WP_163906112.1|3011348_3012200_+	TIGR01459 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_163903710.1|3012214_3013195_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_163903712.1|3013494_3016377_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	23.9	9.0e-52
WP_163903714.1|3016512_3017142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163903715.1|3017267_3017747_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_163903717.1|3017848_3018649_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.8	3.9e-13
>prophage 245
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3026986	3027238	4238533		Caulobacter_phage(100.0%)	1	NA	NA
WP_163903732.1|3026986_3027238_+	DUF4170 domain-containing protein	NA	K4JVU0	Caulobacter_phage	39.7	1.6e-05
>prophage 246
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3030940	3037394	4238533		Wolbachia_phage(33.33%)	4	NA	NA
WP_163903740.1|3030940_3032779_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	38.3	3.1e-98
WP_163903741.1|3033221_3034925_+	response regulator	NA	B5LWA6	Feldmannia_species_virus	34.9	2.5e-09
WP_163903743.1|3035052_3036417_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_163903745.1|3036470_3037394_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	32.2	5.1e-33
>prophage 247
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3044396	3045134	4238533		Aeromonas_phage(100.0%)	1	NA	NA
WP_163903753.1|3044396_3045134_+	LuxR family transcriptional regulator	NA	A0A1I9KF49	Aeromonas_phage	28.6	2.6e-11
>prophage 248
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3049920	3053154	4238533		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_163903763.1|3049920_3051822_+	potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.3	1.2e-68
WP_163903764.1|3051981_3053154_+	cell wall hydrolase	NA	A0A218MLD1	uncultured_virus	45.0	2.5e-24
>prophage 249
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3056422	3057091	4238533		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_163903771.1|3056422_3057091_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	43.2	8.8e-27
>prophage 250
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3066418	3067285	4238533		Vibrio_phage(100.0%)	1	NA	NA
WP_163903789.1|3066418_3067285_+	S49 family peptidase	NA	A0A2I7REP4	Vibrio_phage	29.7	6.7e-11
>prophage 251
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3086318	3087575	4238533		Orpheovirus(100.0%)	1	NA	NA
WP_163903812.1|3086318_3087575_+	methyltransferase domain-containing protein	NA	A0A2I2L5L3	Orpheovirus	34.8	1.5e-48
>prophage 252
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3094453	3098453	4238533		Planktothrix_phage(50.0%)	4	NA	NA
WP_163903834.1|3094453_3095539_+	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	1.5e-20
WP_163903836.1|3095640_3096036_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163903838.1|3096032_3097463_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_163903840.1|3097472_3098453_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	39.2	8.4e-42
>prophage 253
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3110851	3112105	4238533		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_163903863.1|3110851_3112105_-	methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	26.0	5.7e-19
>prophage 254
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3119758	3120361	4238533		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_163903877.1|3119758_3120361_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	44.6	2.8e-40
>prophage 255
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3127851	3136520	4238533		Tupanvirus(33.33%)	6	NA	NA
WP_163903891.1|3127851_3128787_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.3	1.2e-50
WP_163906124.1|3128961_3129363_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_163903893.1|3129695_3131285_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	43.7	1.2e-82
WP_163903895.1|3131509_3131899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163906126.1|3131985_3133731_-	chloride channel protein	NA	NA	NA	NA	NA
WP_163903897.1|3134003_3136520_-	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.7	1.5e-47
>prophage 256
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3142129	3143823	4238533		Indivirus(50.0%)	2	NA	NA
WP_163903911.1|3142129_3142954_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	32.2	7.3e-31
WP_163903913.1|3143067_3143823_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	3.4e-11
>prophage 257
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3165668	3166370	4238533		Streptococcus_phage(100.0%)	1	NA	NA
WP_163903963.1|3165668_3166370_+	HTH domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	29.1	4.2e-11
>prophage 258
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3170491	3171250	4238533		Streptococcus_phage(100.0%)	1	NA	NA
WP_163903971.1|3170491_3171250_-	ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	29.4	5.5e-09
>prophage 259
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3190503	3191184	4238533		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_163904000.1|3190503_3191184_-	ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	23.1	8.4e-09
>prophage 260
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3198170	3207020	4238533		Staphylococcus_phage(25.0%)	7	NA	NA
WP_163904013.1|3198170_3199271_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	36.7	1.4e-58
WP_163904014.1|3199280_3200375_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	39.6	1.2e-65
WP_163906143.1|3200498_3203549_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	34.7	9.0e-18
WP_099056998.1|3203886_3204147_+	DUF1344 domain-containing protein	NA	NA	NA	NA	NA
WP_163904016.1|3204187_3204778_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_163904018.1|3204798_3205617_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_163904020.1|3205739_3207020_-	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	47.5	2.3e-07
>prophage 261
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3213456	3214842	4238533		Stx2-converting_phage(100.0%)	1	NA	NA
WP_163904031.1|3213456_3214842_+	peptidase M15	NA	B6DZZ7	Stx2-converting_phage	36.2	1.4e-31
>prophage 262
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3218761	3220435	4238533		Flavobacterium_phage(100.0%)	1	NA	NA
WP_163904037.1|3218761_3220435_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	33.6	3.5e-08
>prophage 263
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3229459	3232211	4238533		Salmonella_phage(50.0%)	3	NA	NA
WP_099057024.1|3229459_3229930_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	55.8	4.0e-42
WP_163904056.1|3230086_3230395_+	Dabb family protein	NA	NA	NA	NA	NA
WP_163904057.1|3230732_3232211_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.2	2.3e-27
>prophage 264
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3237854	3243469	4238533	holin	Bacillus_virus(50.0%)	6	NA	NA
WP_163904070.1|3237854_3238895_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	2.1e-27
WP_163904072.1|3239053_3239338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163904074.1|3239401_3239677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163906157.1|3239970_3240180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163904076.1|3240314_3241667_-	chloride channel protein	NA	NA	NA	NA	NA
WP_163904078.1|3241816_3243469_-|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.8	3.1e-65
>prophage 265
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3261459	3263283	4238533		Pseudomonas_phage(100.0%)	1	NA	NA
WP_163906163.1|3261459_3263283_-	EAL domain-containing protein	NA	A0A1B0Z064	Pseudomonas_phage	37.5	3.6e-06
>prophage 266
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3266988	3268536	4238533		Mycobacterium_phage(100.0%)	1	NA	NA
WP_163904118.1|3266988_3268536_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	29.1	5.9e-26
>prophage 267
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3277599	3284253	4238533	protease	uncultured_Mediterranean_phage(50.0%)	6	NA	NA
WP_163904143.1|3277599_3277839_-	30S ribosomal protein S21	NA	M1HLV7	Pelagibacter_phage	55.6	5.2e-06
WP_163904145.1|3278435_3278645_-	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	56.0	1.8e-10
WP_163906167.1|3279078_3279867_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_163904147.1|3280039_3281512_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_163904149.1|3281618_3282959_+	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	25.4	2.1e-11
WP_163904151.1|3283047_3284253_+|protease	trypsin-like serine protease	protease	A0A1B1IRH0	uncultured_Mediterranean_phage	36.9	3.7e-15
>prophage 268
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3301021	3301450	4238533		Erythrobacter_phage(100.0%)	1	NA	NA
WP_163904191.1|3301021_3301450_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	47.0	2.1e-21
>prophage 269
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3304592	3310939	4238533		Hokovirus(33.33%)	5	NA	NA
WP_163904198.1|3304592_3306143_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	33.0	2.1e-23
WP_163904200.1|3306114_3307179_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_163904202.1|3307304_3308753_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	51.0	2.2e-14
WP_163906171.1|3308800_3309256_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_163904204.1|3309289_3310939_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.5	4.0e-28
>prophage 270
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3334366	3336805	4238533		uncultured_virus(100.0%)	1	NA	NA
WP_163906184.1|3334366_3336805_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.9	2.3e-88
>prophage 271
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3341198	3359528	4238533	capsid,tail,portal,protease,head	Paracoccus_phage(30.0%)	21	NA	NA
WP_163906186.1|3341198_3342413_+	DNA-packaging protein	NA	A0A0U4IJ26	Arthrobacter_phage	42.6	2.8e-71
WP_163904246.1|3342897_3343518_+	hypothetical protein	NA	L7TN10	Rhizobium_phage	33.5	1.1e-26
WP_163904248.1|3343492_3343918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113457560.1|3344005_3344314_+	Dabb family protein	NA	NA	NA	NA	NA
WP_163904250.1|3344385_3345567_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	38.3	4.6e-63
WP_163904251.1|3345837_3346161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163904253.1|3346457_3347033_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	45.9	2.6e-27
WP_163906188.1|3347047_3348334_+|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	43.7	3.0e-84
WP_163904255.1|3348606_3349176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163904257.1|3349178_3349514_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_163904259.1|3349510_3349699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163904261.1|3349679_3350096_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_163904263.1|3350084_3351281_-	MFS transporter	NA	NA	NA	NA	NA
WP_163904264.1|3351388_3351796_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_163904266.1|3351795_3352215_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_163904268.1|3352211_3352421_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_163904270.1|3352733_3353321_+|tail	phage tail tape measure protein	tail	K7YBG2	uncultured_Mediterranean_phage	56.6	8.9e-07
WP_163906190.1|3353333_3353975_+	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.8	2.6e-44
WP_163904272.1|3353971_3354865_+	DUF2163 domain-containing protein	NA	A0A0B5A5B8	Paracoccus_phage	40.5	7.3e-53
WP_163904274.1|3355238_3355676_+	peptidase P60	NA	F4YXU4	Roseobacter_phage	46.9	3.5e-32
WP_163904276.1|3355685_3359528_+	hypothetical protein	NA	A0A0K1LL82	Rhodobacter_phage	40.2	2.5e-219
>prophage 272
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3367522	3369091	4238533		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_163904292.1|3367522_3369091_+	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.9	2.7e-26
>prophage 273
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3374954	3375767	4238533		Staphylococcus_phage(100.0%)	1	NA	NA
WP_163906194.1|3374954_3375767_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	1.4e-21
>prophage 274
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3379560	3381906	4238533		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_163904305.1|3379560_3381906_-	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	34.1	8.2e-27
>prophage 275
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3438831	3439758	4238533	integrase	Mesorhizobium_phage(100.0%)	1	3431371:3431385	3442447:3442461
3431371:3431385	attL	TCGCCGTTCAGGCCG	NA	NA	NA	NA
WP_163906204.1|3438831_3439758_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A076YL28	Mesorhizobium_phage	35.6	1.4e-30
WP_163906204.1|3438831_3439758_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A076YL28	Mesorhizobium_phage	35.6	1.4e-30
3442447:3442461	attR	CGGCCTGAACGGCGA	NA	NA	NA	NA
>prophage 276
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3444331	3450478	4238533		Pseudomonas_phage(33.33%)	5	NA	NA
WP_163904411.1|3444331_3446410_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	33.3	2.6e-24
WP_163904413.1|3446617_3447502_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_163904416.1|3447637_3448117_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.6	1.1e-26
WP_163904418.1|3448267_3449146_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163904421.1|3449401_3450478_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	43.8	7.8e-17
>prophage 277
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3453823	3459145	4238533		Aggregatibacter_phage(50.0%)	6	NA	NA
WP_163904428.1|3453823_3456049_+	RelA/SpoT family protein	NA	D0UIJ3	Aggregatibacter_phage	30.9	8.3e-05
WP_099057250.1|3456289_3456442_+	DUF3563 family protein	NA	NA	NA	NA	NA
WP_163904430.1|3456569_3457157_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_163904432.1|3457184_3457589_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_163904434.1|3457682_3458426_+	signal peptidase I	NA	NA	NA	NA	NA
WP_163904436.1|3458422_3459145_+	ribonuclease III	NA	M1HJV4	Acanthocystis_turfacea_Chlorella_virus	31.4	1.9e-11
>prophage 278
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3464962	3466722	4238533		Golden_Marseillevirus(50.0%)	2	NA	NA
WP_163906206.1|3464962_3465601_-	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	32.0	5.7e-07
WP_163904450.1|3465699_3466722_-	acyltransferase family protein	NA	A0A2H4IYS5	uncultured_Caudovirales_phage	24.1	2.0e-06
>prophage 279
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3477002	3477629	4238533		Cellulophaga_phage(100.0%)	1	NA	NA
WP_163904467.1|3477002_3477629_-	HD domain-containing protein	NA	R9ZX56	Cellulophaga_phage	39.0	3.0e-13
>prophage 280
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3485166	3487053	4238533		Bacillus_phage(100.0%)	1	NA	NA
WP_163904478.1|3485166_3487053_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.1	1.2e-41
>prophage 281
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3499370	3505565	4238533	tRNA	Terra1_virus(33.33%)	6	NA	NA
WP_163904502.1|3499370_3500792_-|tRNA	cysteine--tRNA ligase	tRNA	F1C979	Terra1_virus	36.2	2.1e-49
WP_164490792.1|3501006_3501411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163904504.1|3501619_3502372_+	glycoside hydrolase family 25 protein	NA	A0A0A0RMY8	Bacillus_phage	45.9	2.2e-05
WP_163904506.1|3502374_3503262_-	EamA family transporter	NA	NA	NA	NA	NA
WP_163904508.1|3503306_3504047_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_163904510.1|3504074_3505565_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.9	5.3e-48
>prophage 282
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3511630	3513127	4238533		Streptococcus_phage(100.0%)	1	NA	NA
WP_163904522.1|3511630_3513127_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	36.0	7.4e-74
>prophage 283
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3523970	3524207	4238533		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_099059947.1|3523970_3524207_+	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	53.6	1.4e-08
>prophage 284
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3527848	3528514	4238533		Cowpox_virus(100.0%)	1	NA	NA
WP_163904538.1|3527848_3528514_+	guanylate kinase	NA	G0XXC0	Cowpox_virus	30.1	1.4e-16
>prophage 285
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3537309	3538809	4238533		Mycoplasma_phage(100.0%)	1	NA	NA
WP_163904551.1|3537309_3538809_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	35.9	2.7e-47
>prophage 286
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3542982	3544869	4238533		Tupanvirus(100.0%)	1	NA	NA
WP_163904561.1|3542982_3544869_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	34.0	1.6e-73
>prophage 287
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3549248	3560230	4238533		Bacillus_virus(40.0%)	10	NA	NA
WP_163904573.1|3549248_3549671_+	nucleoside-diphosphate kinase	NA	L7Y4C4	Megavirus	39.4	1.5e-16
WP_163904575.1|3549815_3550301_-	redoxin family protein	NA	M1I839	Pelagibacter_phage	43.1	4.3e-23
WP_163906226.1|3550370_3551138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163904577.1|3551379_3551985_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_163904580.1|3552018_3554931_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	31.2	4.9e-13
WP_163904582.1|3554927_3555542_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_163904584.1|3555620_3556922_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	30.8	1.4e-44
WP_163904586.1|3556943_3558350_-	threonine synthase	NA	NA	NA	NA	NA
WP_163906228.1|3558654_3559212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163904588.1|3559336_3560230_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	27.2	2.7e-23
>prophage 288
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3565715	3568745	4238533		Enterococcus_phage(50.0%)	3	NA	NA
WP_163904605.1|3565715_3566846_+	site-specific DNA-methyltransferase	NA	A0A249XUJ2	Enterococcus_phage	31.7	1.9e-29
WP_163904607.1|3567013_3567376_-	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_163906232.1|3567689_3568745_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L7I1	Tupanvirus	45.1	3.1e-82
>prophage 289
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3579362	3582041	4238533		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_163904629.1|3579362_3582041_+	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	42.2	1.2e-93
>prophage 290
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3591542	3596715	4238533		Acanthocystis_turfacea_Chlorella_virus(50.0%)	4	NA	NA
WP_163904640.1|3591542_3592481_-	NAD-dependent epimerase/dehydratase family protein	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	58.7	6.2e-103
WP_163906237.1|3592484_3593570_-	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	69.0	4.8e-139
WP_163904641.1|3593579_3594590_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1D8KUT0	Synechococcus_phage	39.0	9.5e-65
WP_163904642.1|3594624_3596715_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	36.2	1.2e-08
>prophage 291
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3603073	3604175	4238533	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_163904651.1|3603073_3604175_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.1	2.5e-42
>prophage 292
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3618163	3618808	4238533		Bartonella_henselae_phage(100.0%)	1	NA	NA
WP_163904679.1|3618163_3618808_+	outer membrane beta-barrel protein	NA	O11861	Bartonella_henselae_phage	29.6	2.2e-06
>prophage 293
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3623819	3624416	4238533		Vibrio_phage(100.0%)	1	NA	NA
WP_163904690.1|3623819_3624416_+	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	29.7	4.9e-13
>prophage 294
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3627701	3629431	4238533		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_163904698.1|3627701_3628361_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	33.3	2.2e-22
WP_163904700.1|3628357_3629431_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	42.9	4.4e-60
>prophage 295
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3650015	3652292	4238533		Bacillus_virus(100.0%)	1	NA	NA
WP_163904734.1|3650015_3652292_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	39.2	3.7e-93
>prophage 296
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3659465	3666852	4238533		Emiliania_huxleyi_virus(25.0%)	6	NA	NA
WP_163904752.1|3659465_3660839_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	28.8	3.2e-23
WP_163904754.1|3660994_3663049_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_163904756.1|3663187_3664477_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.3	1.8e-100
WP_099057418.1|3664486_3664963_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_163904758.1|3664966_3666052_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	33.7	9.9e-36
WP_163904760.1|3666393_3666852_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2I2L4Y7	Orpheovirus	33.0	2.0e-06
>prophage 297
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3675071	3675410	4238533		Sodalis_phage(100.0%)	1	NA	NA
WP_099057427.1|3675071_3675410_+	integration host factor subunit alpha	NA	Q2A099	Sodalis_phage	32.6	5.5e-09
>prophage 298
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3683772	3685599	4238533	protease	Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_163904776.1|3683772_3685599_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	A9YVR1	Ostreococcus_tauri_virus	41.7	6.4e-104
>prophage 299
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3702445	3703729	4238533		Pandoravirus(100.0%)	1	NA	NA
WP_163904810.1|3702445_3703729_+	O-acetylhomoserine aminocarboxypropyltransferase	NA	A0A0B5JD48	Pandoravirus	27.1	2.7e-16
>prophage 300
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3711065	3720306	4238533	protease	Agrobacterium_phage(20.0%)	6	NA	NA
WP_163904828.1|3711065_3711698_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	60.7	1.5e-63
WP_163904830.1|3711995_3713273_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.1	4.6e-133
WP_163904832.1|3713699_3716117_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	48.1	2.1e-195
WP_163904834.1|3716322_3716598_+	HU family DNA-binding protein	NA	A0A172Q061	Acinetobacter_phage	35.6	9.3e-07
WP_163904836.1|3717073_3718021_+	EamA family transporter	NA	NA	NA	NA	NA
WP_163904838.1|3718107_3720306_+	esterase-like activity of phytase family protein	NA	E3SII1	Synechococcus_phage	42.1	3.1e-76
>prophage 301
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3748395	3751887	4238533		Streptomyces_phage(100.0%)	1	NA	NA
WP_163904880.1|3748395_3751887_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	37.6	5.8e-186
>prophage 302
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3759332	3761092	4238533		Hokovirus(50.0%)	2	NA	NA
WP_099057498.1|3759332_3759704_+	response regulator	NA	A0A1V0SGR9	Hokovirus	25.2	1.3e-06
WP_163904894.1|3759718_3761092_+	PleD family two-component system response regulator	NA	W8CYM9	Bacillus_phage	43.2	6.9e-18
>prophage 303
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3764585	3774110	4238533		Lactococcus_phage(25.0%)	7	NA	NA
WP_163904898.1|3764585_3766949_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	1.1e-55
WP_163904900.1|3766951_3769615_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	32.1	2.5e-104
WP_163906267.1|3769883_3770111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163904902.1|3770063_3771218_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	40.6	9.2e-24
WP_099057506.1|3771222_3771840_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_163904904.1|3771864_3773157_-	dihydroorotase	NA	NA	NA	NA	NA
WP_163904906.1|3773153_3774110_-	aspartate carbamoyltransferase catalytic subunit	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	35.2	1.6e-29
>prophage 304
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3798795	3799923	4238533		Pseudomonas_phage(100.0%)	1	NA	NA
WP_163904949.1|3798795_3799923_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	44.8	5.0e-06
>prophage 305
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3806605	3821314	4238533		Tupanvirus(25.0%)	10	NA	NA
WP_163904961.1|3806605_3807781_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	25.7	2.2e-12
WP_163904963.1|3807978_3808785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112831869.1|3809183_3809384_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_099057544.1|3809402_3809933_+	transcription termination/antitermination protein NusG	NA	A0A068C9G5	Rhizobium_phage	29.6	4.9e-12
WP_099057545.1|3810082_3810514_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_163904965.1|3810516_3811212_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_099057547.1|3811558_3812077_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_163904966.1|3812138_3812519_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_163904968.1|3812779_3816916_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	31.7	7.1e-26
WP_163904970.1|3817099_3821314_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.7	1.1e-66
>prophage 306
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3824371	3827740	4238533		Streptococcus_phage(50.0%)	2	NA	NA
WP_163904976.1|3824371_3826471_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	1.6e-61
WP_163904961.1|3826564_3827740_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	25.7	2.2e-12
>prophage 307
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3854940	3857660	4238533		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_163905020.1|3854940_3856347_+	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	3.2e-18
WP_163905023.1|3856343_3857660_+	AAA family ATPase	NA	G3MBE0	Bacillus_virus	39.6	2.4e-76
>prophage 308
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3860747	3864560	4238533		Bradyrhizobium_phage(100.0%)	1	NA	NA
WP_163905030.1|3860747_3864560_-	vitamin B12-dependent ribonucleotide reductase	NA	A0A1X9SGV9	Bradyrhizobium_phage	53.5	0.0e+00
>prophage 309
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3879537	3883975	4238533		Bacillus_phage(100.0%)	2	NA	NA
WP_163906274.1|3879537_3882591_+	ammonium transporter	NA	A0A127AWB9	Bacillus_phage	35.4	2.6e-17
WP_163905059.1|3882712_3883975_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.4	2.4e-17
>prophage 310
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3896362	3897805	4238533		Hokovirus(100.0%)	1	NA	NA
WP_163905083.1|3896362_3897805_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	29.7	2.6e-55
>prophage 311
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3903407	3906251	4238533	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_163905097.1|3903407_3906251_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.3	5.1e-132
>prophage 312
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3910016	3910349	4238533		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_163906276.1|3910016_3910349_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	48.6	1.4e-20
>prophage 313
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3917672	3930936	4238533	tRNA	uncultured_Mediterranean_phage(77.78%)	13	NA	NA
WP_163906278.1|3917672_3918524_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	35.0	4.0e-32
WP_163906280.1|3918532_3919270_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	47.5	8.5e-39
WP_163905112.1|3919369_3920476_+	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	27.6	1.1e-10
WP_163905114.1|3920509_3920707_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	63.0	7.1e-09
WP_163905116.1|3920758_3921433_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_163905124.1|3921429_3922251_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	42.8	2.3e-45
WP_163905126.1|3922365_3923649_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.6	1.3e-95
WP_163905128.1|3923666_3924440_+	5'/3'-nucleotidase SurE	NA	NA	NA	NA	NA
WP_163905130.1|3924436_3925090_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	NA	NA	NA	NA
WP_163905133.1|3925233_3926799_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV24	Clostridium_phage	32.5	1.0e-12
WP_163905135.1|3926880_3927753_-	DUF815 domain-containing protein	NA	NA	NA	NA	NA
WP_163905137.1|3927967_3928318_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	30.4	4.1e-07
WP_163905139.1|3928383_3930936_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.4	2.5e-53
>prophage 314
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3939546	3943019	4238533		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_163905152.1|3939546_3940977_-	Si-specific NAD(P)(+) transhydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.0	2.8e-38
WP_163905154.1|3941159_3943019_+	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	34.8	1.4e-77
>prophage 315
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	3951878	4006830	4238533	capsid,tail,portal,integrase,head,terminase	Rhizobium_phage(76.19%)	70	3958069:3958115	4011955:4012001
WP_163905174.1|3951878_3953681_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	27.7	2.7e-54
WP_163905176.1|3954335_3955136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163905178.1|3955297_3955738_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_099057687.1|3955923_3956502_+	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	40.7	6.7e-07
WP_163906289.1|3956515_3956992_+	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_163905181.1|3957669_3957975_+	ETC complex I subunit	NA	NA	NA	NA	NA
3958069:3958115	attL	GCCTTCTAAGCAGGTTGTCGCAGGTTCGATTCCTGCAGGGGTCGCCA	NA	NA	NA	NA
WP_163905183.1|3958185_3959217_-|integrase	tyrosine-type recombinase/integrase	integrase	F8TUV0	EBPR_podovirus	38.1	1.5e-62
WP_163905185.1|3959424_3959637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163905187.1|3959633_3960890_-	DUF5131 family protein	NA	A0A291AUR0	Sinorhizobium_phage	54.0	1.1e-115
WP_163905189.1|3961346_3961949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163905191.1|3961945_3962137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163906291.1|3962146_3962557_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0B5A0C6	Paracoccus_phage	58.8	4.9e-36
WP_163905193.1|3962811_3963921_-	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	59.1	2.2e-115
WP_163905195.1|3963981_3964899_-	DUF2303 family protein	NA	R9TSA8	Rhizobium_phage	57.2	1.6e-95
WP_163905197.1|3964926_3965286_-	hypothetical protein	NA	R9TQI8	Rhizobium_phage	82.3	1.4e-47
WP_163905199.1|3965327_3965834_-	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	57.1	3.4e-47
WP_162760627.1|3965833_3966058_-	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_163905201.1|3966057_3966540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164490807.1|3966536_3966692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163905202.1|3966691_3966943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163905204.1|3966935_3967670_-	hypothetical protein	NA	R9TQJ1	Rhizobium_phage	50.0	3.3e-51
WP_163905206.1|3967666_3967948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163905208.1|3967947_3968601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163905210.1|3968602_3968839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163905212.1|3969296_3970289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163905214.1|3970994_3971189_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_163905216.1|3971353_3971854_+	hypothetical protein	NA	A0A068CCD6	Rhizobium_phage	60.2	1.7e-43
WP_163905218.1|3971850_3972042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163905220.1|3972038_3972614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163905222.1|3972640_3973663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163905224.1|3973782_3974379_+	adenine methyltransferase	NA	H8YJC7	Vibrio_phage	37.2	2.6e-30
WP_163905225.1|3974375_3974828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163905227.1|3974830_3975328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163905229.1|3975324_3975645_+	hypothetical protein	NA	R9TQK2	Rhizobium_phage	41.3	1.9e-11
WP_163905231.1|3975641_3975788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163905233.1|3975777_3977631_+	DNA methyltransferase	NA	A0A291AUL2	Sinorhizobium_phage	72.4	1.6e-256
WP_163905235.1|3977687_3978113_-	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	41.1	2.2e-15
WP_163905236.1|3978167_3978362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163905238.1|3978496_3979774_+	hypothetical protein	NA	R9TNC4	Rhizobium_phage	52.4	1.8e-116
WP_163905240.1|3979763_3980951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163905242.1|3981004_3982813_+	DNA primase	NA	A0A0P0IX98	Lactobacillus_phage	38.7	4.8e-51
WP_163905244.1|3983122_3983920_+	hypothetical protein	NA	R9TRT9	Rhizobium_phage	46.6	1.2e-62
WP_163905246.1|3984106_3984676_+	hypothetical protein	NA	A0A068CHB9	Rhizobium_phage	66.0	1.0e-60
WP_163905248.1|3984849_3985458_+	hypothetical protein	NA	R9TNC8	Rhizobium_phage	71.3	2.5e-73
WP_163905250.1|3985454_3987449_+|terminase	terminase	terminase	A0A068CDC0	Rhizobium_phage	71.8	9.9e-292
WP_163905252.1|3987445_3989062_+|portal	phage portal protein	portal	R9TN54	Rhizobium_phage	75.8	9.3e-240
WP_163905254.1|3989058_3989328_+	hypothetical protein	NA	R9TS76	Rhizobium_phage	75.3	8.1e-32
WP_163905256.1|3989337_3990258_+	S49 family peptidase	NA	A0A068CE01	Rhizobium_phage	63.8	9.7e-109
WP_163905258.1|3990260_3990845_+	hypothetical protein	NA	A0A068C988	Rhizobium_phage	44.5	8.6e-10
WP_163905260.1|3990847_3991231_+|head	head decoration protein	head	NA	NA	NA	NA
WP_163905262.1|3991242_3992253_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	35.8	3.4e-46
WP_163905264.1|3992351_3992702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163905266.1|3992704_3993106_+	hypothetical protein	NA	R9TS80	Rhizobium_phage	50.8	2.8e-36
WP_163905268.1|3993092_3993824_+	hypothetical protein	NA	A0A068C993	Rhizobium_phage	59.6	1.3e-60
WP_163905270.1|3993847_3994018_+	hypothetical protein	NA	R9TP51	Rhizobium_phage	55.6	8.5e-11
WP_163905272.1|3994007_3995492_+	hypothetical protein	NA	A0A068CC80	Rhizobium_phage	59.2	6.7e-160
WP_163905274.1|3995551_3995926_+	hypothetical protein	NA	R9TN68	Rhizobium_phage	64.8	1.5e-36
WP_163905275.1|3995928_3996303_+	hypothetical protein	NA	R9TS84	Rhizobium_phage	39.4	2.4e-13
WP_163905277.1|3996361_3998248_+|tail	phage tail tape measure protein	tail	R9TP54	Rhizobium_phage	60.5	1.6e-166
WP_163905279.1|3998265_3998724_+	hypothetical protein	NA	R9TN75	Rhizobium_phage	63.8	7.3e-49
WP_163905281.1|3998723_3999347_+	hypothetical protein	NA	R9TS88	Rhizobium_phage	68.4	2.1e-67
WP_163905282.1|3999347_4000415_+	hypothetical protein	NA	R9TQG2	Rhizobium_phage	69.5	1.2e-137
WP_163905283.1|4000411_4000831_+	hypothetical protein	NA	R9TP58	Rhizobium_phage	76.6	9.1e-38
WP_163906295.1|4000836_4001370_+	hypothetical protein	NA	R9TRP7	Rhizobium_phage	69.9	6.1e-71
WP_163905285.1|4001341_4002421_+	hypothetical protein	NA	R9TN81	Rhizobium_phage	64.6	3.3e-124
WP_163905286.1|4002424_4003129_+	DUF2313 domain-containing protein	NA	A0A068CH63	Rhizobium_phage	62.7	4.0e-70
WP_163905288.1|4003154_4004390_+	hypothetical protein	NA	R9TQG5	Rhizobium_phage	50.3	1.1e-27
WP_163905289.1|4004382_4004940_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_163905291.1|4004923_4006024_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_163905293.1|4006128_4006830_+	TIGR02594 family protein	NA	R9TRQ2	Rhizobium_phage	45.8	8.9e-46
4011955:4012001	attR	GCCTTCTAAGCAGGTTGTCGCAGGTTCGATTCCTGCAGGGGTCGCCA	NA	NA	NA	NA
>prophage 316
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	4010449	4010800	4238533		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_163905309.1|4010449_4010800_+	DUF1515 family protein	NA	A0A291AUW4	Sinorhizobium_phage	38.6	7.6e-14
>prophage 317
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	4014111	4018381	4238533		Planktothrix_phage(50.0%)	4	NA	NA
WP_163905316.1|4014111_4014885_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	40.5	7.3e-33
WP_163905318.1|4014902_4016060_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_163905320.1|4016061_4017255_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_163905321.1|4017352_4018381_-	transporter substrate-binding domain-containing protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	44.1	3.8e-77
>prophage 318
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	4025155	4027987	4238533	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_099057701.1|4025155_4025506_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	4.9e-13
WP_163905337.1|4025515_4027987_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	5.5e-175
>prophage 319
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	4033701	4034436	4238533		Escherichia_phage(100.0%)	1	NA	NA
WP_163905351.1|4033701_4034436_-	glycerophosphodiester phosphodiesterase	NA	A0A2H4PGQ5	Escherichia_phage	23.5	6.5e-07
>prophage 320
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	4039475	4040219	4238533		Flavobacterium_phage(100.0%)	1	NA	NA
WP_163905365.1|4039475_4040219_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	39.5	2.6e-19
>prophage 321
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	4051749	4058033	4238533		Staphylococcus_phage(33.33%)	8	NA	NA
WP_163905383.1|4051749_4052673_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	3.9e-09
WP_163905385.1|4052665_4053481_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_163905387.1|4053486_4053882_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_163905389.1|4053903_4054431_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_099057728.1|4054458_4054728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163906304.1|4054774_4056220_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	31.6	6.4e-22
WP_163905391.1|4056362_4057148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163905393.1|4057421_4058033_-	transglutaminase-like cysteine peptidase	NA	V9QJI1	Rhizobium_phage	36.2	8.9e-18
>prophage 322
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	4062602	4066466	4238533	tRNA	Pandoravirus(50.0%)	4	NA	NA
WP_163905405.1|4062602_4063208_-	GTP cyclohydrolase I FolE	NA	S4VV34	Pandoravirus	50.8	4.2e-44
WP_163905407.1|4063486_4063936_+	iron-sulfur cluster assembly scaffold protein	NA	NA	NA	NA	NA
WP_163905409.1|4063940_4064327_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_163905411.1|4064444_4066466_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.6	3.1e-115
>prophage 323
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	4072857	4089328	4238533		Acinetobacter_phage(33.33%)	12	NA	NA
WP_163905427.1|4072857_4074588_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.7	9.2e-60
WP_163905429.1|4074722_4078286_-	autotransporter domain-containing protein	NA	F8S0S2	Gordonia_phage	52.3	2.9e-07
WP_163905430.1|4078808_4080878_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	39.7	1.3e-108
WP_163905432.1|4081097_4081985_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_163905434.1|4082145_4082916_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_163905436.1|4083009_4083429_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_163905438.1|4083563_4085201_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.2	5.5e-155
WP_163905439.1|4085334_4085757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163905441.1|4085777_4086998_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_163905443.1|4086998_4087484_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_163905445.1|4087480_4088296_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.4	1.4e-58
WP_163905447.1|4088305_4089328_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	39.7	3.4e-62
>prophage 324
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	4095639	4099786	4238533		Phage_Wrath(33.33%)	4	NA	NA
WP_099057759.1|4095639_4096350_-	transcriptional repressor LexA	NA	A0A1B2APZ3	Phage_Wrath	36.0	4.0e-09
WP_163905453.1|4096565_4097459_+	VOC family protein	NA	NA	NA	NA	NA
WP_163905455.1|4097455_4098304_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.2	2.5e-50
WP_163905456.1|4098511_4099786_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	62.7	5.8e-144
>prophage 325
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	4108104	4117336	4238533	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_163905465.1|4108104_4108722_+	AAA family ATPase	NA	A0A097BYE2	Leuconostoc_phage	35.5	6.7e-29
WP_163905467.1|4108932_4109382_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_163905469.1|4109390_4109888_-	nicotinamide-nucleotide amidohydrolase family protein	NA	B5TK85	Pseudomonas_phage	47.1	2.2e-22
WP_163906310.1|4109884_4111099_-	bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_163905471.1|4111286_4112291_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_163906312.1|4112320_4113421_+	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	25.1	3.6e-09
WP_163905473.1|4113420_4114872_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_163905475.1|4115065_4117336_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	21.5	7.0e-07
>prophage 326
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	4138393	4139434	4238533		Ralstonia_phage(100.0%)	1	NA	NA
WP_163905515.1|4138393_4139434_+	TAXI family TRAP transporter solute-binding subunit	NA	A0A1L7N115	Ralstonia_phage	26.4	4.9e-08
>prophage 327
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	4145901	4158393	4238533	tRNA	uncultured_Mediterranean_phage(71.43%)	10	NA	NA
WP_163905527.1|4145901_4148823_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	61.5	0.0e+00
WP_163905529.1|4149087_4149618_+	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	75.0	5.1e-46
WP_163905531.1|4149795_4150425_-	NAAT family transporter	NA	NA	NA	NA	NA
WP_163905533.1|4150613_4153433_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.0	4.5e-96
WP_164490805.1|4153855_4154005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163905535.1|4154459_4154954_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	38.5	1.4e-24
WP_163905537.1|4154986_4155556_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	55.8	6.5e-47
WP_163905540.1|4155587_4156097_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	60.6	5.8e-47
WP_163905542.1|4156172_4157258_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_163905544.1|4157262_4158393_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	54.3	6.1e-105
>prophage 328
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	4163966	4169751	4238533	tRNA	Streptococcus_phage(50.0%)	5	NA	NA
WP_163905560.1|4163966_4165523_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	38.7	2.8e-100
WP_163905562.1|4165662_4166691_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	28.1	5.0e-05
WP_163905573.1|4166687_4167380_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	39.9	1.7e-33
WP_163905574.1|4167490_4168648_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_163905576.1|4168704_4169751_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	53.9	3.1e-18
>prophage 329
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	4180348	4181401	4238533	holin	Bacillus_virus(100.0%)	1	NA	NA
WP_163905588.1|4180348_4181401_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	35.6	9.6e-28
>prophage 330
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	4184618	4185332	4238533		Planktothrix_phage(100.0%)	1	NA	NA
WP_163905596.1|4184618_4185332_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.4	4.4e-32
>prophage 331
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	4194449	4196276	4238533		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_163905611.1|4194449_4196276_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	40.6	1.0e-109
>prophage 332
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	4200989	4202552	4238533		Staphylococcus_phage(100.0%)	1	NA	NA
WP_163905620.1|4200989_4202552_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	9.3e-19
>prophage 333
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	4207653	4212788	4238533		Rhizobium_phage(40.0%)	9	NA	NA
WP_163906321.1|4207653_4208292_-	deoxynucleotide monophosphate kinase	NA	A0A0K1LM09	Rhodobacter_phage	41.4	1.7e-27
WP_163905634.1|4208354_4208636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163906323.1|4208862_4209066_-	hypothetical protein	NA	A0A0F6SJ45	Sinorhizobium_phage	82.1	3.1e-28
WP_163905636.1|4209067_4209259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163905638.1|4209258_4209693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163906324.1|4209910_4210660_-	hypothetical protein	NA	B4UTT6	Rhizobium_phage	54.0	4.2e-70
WP_163906326.1|4210695_4211046_-	hypothetical protein	NA	Q6QIE3	Burkholderia_phage	60.4	5.4e-28
WP_163905639.1|4211320_4211470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163905641.1|4211477_4212788_-	hypothetical protein	NA	B4UTT2	Rhizobium_phage	36.8	2.3e-71
>prophage 334
NZ_CP048427	Rhizobium daejeonense strain KACC 13094 chromosome, complete genome	4238533	4217072	4238005	4238533	capsid,tail,portal,protease,head	Rhizobium_phage(70.0%)	27	NA	NA
WP_163905657.1|4217072_4217381_-	hypothetical protein	NA	B4UTS1	Rhizobium_phage	47.7	4.8e-20
WP_164490804.1|4217377_4217677_-	dehydrogenase	NA	NA	NA	NA	NA
WP_163905661.1|4217597_4217969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163905663.1|4217970_4218591_-	glycoside hydrolase family protein	NA	L7TM06	Rhizobium_phage	50.7	5.6e-44
WP_163905665.1|4218577_4218787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163905667.1|4218902_4219856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163905669.1|4219859_4221374_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	40.6	4.7e-92
WP_163905671.1|4221516_4222911_-	hypothetical protein	NA	H2BD96	Pseudomonas_phage	44.0	6.0e-09
WP_163905673.1|4222915_4224472_-	hypothetical protein	NA	A0A291AUU8	Sinorhizobium_phage	53.1	3.4e-45
WP_163905675.1|4224500_4226633_-	hypothetical protein	NA	A0A291AUU6	Sinorhizobium_phage	57.0	1.9e-232
WP_163905677.1|4226650_4227064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163905679.1|4227060_4227642_-	transcriptional regulator	NA	A0A291AUU9	Sinorhizobium_phage	69.9	2.3e-79
WP_163905680.1|4227651_4227804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163905682.1|4227859_4228582_-	hypothetical protein	NA	A0A291AUU7	Sinorhizobium_phage	51.7	4.0e-65
WP_163905684.1|4228598_4230983_-|tail	phage tail tape-measure protein	tail	B4UTQ6	Rhizobium_phage	50.1	5.0e-165
WP_163898893.1|4230983_4231172_-	hypothetical protein	NA	B4UTQ5	Rhizobium_phage	70.0	1.1e-14
WP_163905685.1|4231189_4231540_-	gene transfer agent family protein	NA	B4UTQ4	Rhizobium_phage	75.7	6.4e-45
WP_163905687.1|4231539_4231989_-	hypothetical protein	NA	B4UTQ3	Rhizobium_phage	84.5	8.4e-66
WP_163905689.1|4232244_4232661_-	DUF3168 domain-containing protein	NA	B4UTQ1	Rhizobium_phage	73.1	7.4e-48
WP_163905691.1|4232660_4233152_-	HK97 gp10 family phage protein	NA	B4UTQ0	Rhizobium_phage	62.3	9.0e-45
WP_163905693.1|4233163_4233499_-|head	phage head closure protein	head	B4UTP9	Rhizobium_phage	57.9	1.6e-29
WP_163905694.1|4233498_4233924_-	hypothetical protein	NA	B4UTP8	Rhizobium_phage	69.5	2.3e-44
WP_163906328.1|4233942_4234485_-	hypothetical protein	NA	B4UTP7	Rhizobium_phage	55.8	1.2e-53
WP_163905695.1|4234447_4234657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163905696.1|4234706_4235987_-|capsid	phage major capsid protein	capsid	B4UTP3	Rhizobium_phage	65.0	6.9e-145
WP_163905697.1|4236080_4236713_-|head,protease	HK97 family phage prohead protease	head,protease	B4UTP2	Rhizobium_phage	52.2	8.9e-45
WP_163905698.1|4236709_4238005_-|portal	phage portal protein	portal	B4UTP1	Rhizobium_phage	74.2	1.7e-167
>prophage 1
NZ_CP048426	Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence	236493	0	7461	236493		Acinetobacter_phage(50.0%)	5	NA	NA
WP_163898839.1|285_1215_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_163898340.1|1706_4025_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_163898343.1|4017_4491_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	A0A0P0IVM8	Acinetobacter_phage	36.9	1.5e-12
WP_163898346.1|4504_5803_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_163898348.1|5964_7461_-	aromatic amino acid lyase	NA	A0A1V0S940	Catovirus	31.3	5.2e-51
>prophage 2
NZ_CP048426	Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence	236493	23339	24437	236493		Bacillus_virus(100.0%)	1	NA	NA
WP_163898375.1|23339_24437_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	32.8	3.7e-22
>prophage 3
NZ_CP048426	Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence	236493	29762	32809	236493		Enterobacteria_phage(50.0%)	3	NA	NA
WP_163898387.1|29762_30758_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	27.5	1.0e-26
WP_099061186.1|30781_31330_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_163898390.1|31474_32809_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	A0A2D1G879	Mycobacterium_phage	26.8	1.8e-07
>prophage 4
NZ_CP048426	Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence	236493	36647	40221	236493		Amsacta_moorei_entomopoxvirus(50.0%)	3	NA	NA
WP_163898405.1|36647_38180_-	ATP-binding cassette domain-containing protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	26.0	6.3e-12
WP_163898408.1|38357_39353_-	rhamnose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_112826959.1|39408_40221_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.9	3.9e-21
>prophage 5
NZ_CP048426	Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence	236493	44191	45838	236493		Planktothrix_phage(100.0%)	1	NA	NA
WP_163898417.1|44191_45838_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	4.9e-18
>prophage 6
NZ_CP048426	Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence	236493	56380	57475	236493		Planktothrix_phage(100.0%)	1	NA	NA
WP_163898449.1|56380_57475_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.3	2.7e-25
>prophage 7
NZ_CP048426	Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence	236493	71201	72245	236493		Bacillus_virus(100.0%)	1	NA	NA
WP_163898482.1|71201_72245_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.0	1.1e-28
>prophage 8
NZ_CP048426	Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence	236493	76219	77518	236493		Chrysodeixis_chalcites_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_163898492.1|76219_77518_+	glycosyltransferase	NA	Q4KSU0	Chrysodeixis_chalcites_nucleopolyhedrovirus	33.8	1.9e-09
>prophage 9
NZ_CP048426	Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence	236493	90240	97577	236493		Ochrobactrum_phage(40.0%)	6	NA	NA
WP_163898522.1|90240_91455_-	replication initiation protein RepC	NA	L7TKN6	Rhizobium_phage	27.2	9.4e-19
WP_163898525.1|91607_92588_-	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	43.1	1.6e-64
WP_163898856.1|92644_93847_-	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	65.1	1.6e-143
WP_163898529.1|94441_94840_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_163898532.1|94874_95921_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	45.4	7.2e-76
WP_163898535.1|95978_97577_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	4.9e-23
>prophage 10
NZ_CP048426	Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence	236493	108746	124254	236493		Streptococcus_phage(20.0%)	10	NA	NA
WP_163898566.1|108746_111023_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.1	3.2e-84
WP_163898569.1|112127_112925_+	alpha/beta hydrolase fold domain-containing protein	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	22.5	1.1e-10
WP_163898571.1|112980_114168_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_163898574.1|114282_117492_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.3	9.3e-66
WP_163898577.1|117544_118807_-	DUF4147 domain-containing protein	NA	NA	NA	NA	NA
WP_163898580.1|118808_119129_-	Dabb family protein	NA	NA	NA	NA	NA
WP_163898583.1|119130_120786_-	alanine-phosphoribitol ligase	NA	A0A1V0SI18	Klosneuvirus	32.9	7.7e-64
WP_163898586.1|120837_121611_-	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_163898589.1|121607_123116_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_163898591.1|123138_124254_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.1	8.6e-27
>prophage 11
NZ_CP048426	Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence	236493	136264	137823	236493		Planktothrix_phage(50.0%)	2	NA	NA
WP_163898616.1|136264_137017_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.2	5.8e-19
WP_163898619.1|137013_137823_-	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	24.7	2.5e-07
>prophage 12
NZ_CP048426	Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence	236493	147297	148362	236493		Paenibacillus_phage(100.0%)	1	NA	NA
WP_163898646.1|147297_148362_-	glycosyl hydrolase	NA	D0R7H8	Paenibacillus_phage	32.7	1.4e-21
>prophage 13
NZ_CP048426	Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence	236493	155596	157126	236493		Staphylococcus_phage(100.0%)	1	NA	NA
WP_163898667.1|155596_157126_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	5.3e-19
>prophage 14
NZ_CP048426	Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence	236493	163342	169479	236493		Bacillus_phage(33.33%)	4	NA	NA
WP_163898688.1|163342_164035_-	response regulator	NA	W8CYM9	Bacillus_phage	31.7	4.0e-22
WP_163898690.1|164031_166737_-	DUF4118 domain-containing protein	NA	Q8QNA2	Ectocarpus_siliculosus_virus	31.1	4.0e-09
WP_163898693.1|166812_167379_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_163898696.1|167391_169479_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	28.2	5.9e-37
>prophage 15
NZ_CP048426	Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence	236493	175508	176555	236493		Tupanvirus(100.0%)	1	NA	NA
WP_163898720.1|175508_176555_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	27.8	4.7e-27
>prophage 16
NZ_CP048426	Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence	236493	180832	182536	236493		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_163898730.1|180832_182536_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	A0A2H4N7Z5	Lake_Baikal_phage	28.0	3.8e-18
>prophage 17
NZ_CP048426	Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence	236493	191406	193296	236493		Planktothrix_phage(100.0%)	1	NA	NA
WP_163898743.1|191406_193296_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	6.2e-17
>prophage 18
NZ_CP048426	Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence	236493	196478	197819	236493		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_163898747.1|196478_197819_+	nucleotide sugar dehydrogenase	NA	M1I178	Paramecium_bursaria_Chlorella_virus	30.3	1.4e-31
>prophage 19
NZ_CP048426	Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence	236493	220985	222614	236493		Planktothrix_phage(100.0%)	1	NA	NA
WP_163898806.1|220985_222614_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	3.4e-16
>prophage 20
NZ_CP048426	Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence	236493	228375	230196	236493		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_163898825.1|228375_230196_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	A9YVT5	Ostreococcus_tauri_virus	23.6	4.9e-19
>prophage 1
NZ_CP048428	Rhizobium daejeonense strain KACC 13094 plasmid unnamed4, complete sequence	105062	23087	32171	105062		Ochrobactrum_phage(33.33%)	8	NA	NA
WP_163906377.1|23087_23771_+	AAA family ATPase	NA	A0A0A8IL09	Aurantimonas_phage	24.3	7.9e-07
WP_163906379.1|23767_24148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163906381.1|24168_25383_-	replication initiation protein RepC	NA	L7TKN6	Rhizobium_phage	28.1	2.5e-19
WP_163906383.1|25545_26556_-	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	36.7	6.6e-42
WP_163906385.1|26552_27770_-	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	52.9	3.1e-110
WP_163906387.1|28359_28737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163906389.1|29174_29993_-	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	33.8	2.1e-22
WP_163906391.1|30137_32171_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.8	2.9e-28
