The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048439	Escherichia coli strain NBRC 3301 chromosome, complete genome	4656310	999004	1006143	4656310		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|999004_999643_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001393459.1|999734_1000901_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_000848004.1|1000897_1001806_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001300386.1|1002001_1002769_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141337.1|1002819_1003476_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272928.1|1003581_1006143_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP048439	Escherichia coli strain NBRC 3301 chromosome, complete genome	4656310	1386725	1397935	4656310	tail,integrase	Enterobacteria_phage(53.33%)	16	1383035:1383051	1399945:1399961
1383035:1383051	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001163428.1|1386725_1386926_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000206809.1|1387057_1387363_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001242717.1|1387362_1387725_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000008183.1|1387715_1388252_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_000081278.1|1388379_1389204_-	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000135673.1|1389269_1389632_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_001393497.1|1390354_1390849_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000066913.1|1390848_1391124_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_011443597.1|1391173_1391692_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_001106835.1|1391718_1392159_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_047792215.1|1392457_1392739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030215.1|1392773_1394105_-	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_000703651.1|1394101_1395022_-	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_000915541.1|1395018_1395381_-	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000958671.1|1395533_1396691_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000368140.1|1397002_1397935_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
1399945:1399961	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP048439	Escherichia coli strain NBRC 3301 chromosome, complete genome	4656310	2202038	2221249	4656310	tail,lysis	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000379575.1|2202038_2202194_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|2202360_2202768_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2202851_2203082_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_011443592.1|2203378_2203528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2203964_2204297_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2204499_2204805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2204829_2205069_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2205068_2205356_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2205427_2205583_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2205799_2206051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2206117_2206396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|2206397_2207447_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047135.1|2207460_2208213_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2208490_2208580_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2208634_2208847_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2209147_2209363_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2210116_2210332_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2210336_2210648_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2210644_2211178_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2211174_2211672_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2212034_2212247_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2212257_2212446_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2212448_2212514_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2212592_2212748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2212919_2213093_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2213244_2213655_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2213712_2213946_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453612.1|2214334_2214904_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001027733.1|2214854_2215817_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000885611.1|2215816_2216392_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000078177.1|2216489_2217080_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2217396_2217630_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2217698_2217812_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2218416_2219700_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527743.1|2219788_2221249_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
>prophage 4
NZ_CP048439	Escherichia coli strain NBRC 3301 chromosome, complete genome	4656310	2345836	2444139	4656310	tRNA,lysis,tail,transposase,integrase	Escherichia_phage(41.67%)	85	2423087:2423105	2453462:2453480
WP_000826416.1|2345836_2347045_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.7e-206
WP_001261013.1|2347576_2348245_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586732.1|2348546_2349140_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001301046.1|2349136_2350129_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234042.1|2350252_2351233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000140873.1|2351224_2351764_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2351826_2352051_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375961.1|2352190_2353846_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013789.1|2354070_2355414_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414567.1|2355630_2356554_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098559.1|2356591_2358232_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|2358630_2358780_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2358851_2359025_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|2359269_2359800_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000115943.1|2361030_2362470_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027942.1|2362666_2363467_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139543.1|2363738_2367641_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048950.1|2367841_2368447_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627368.1|2368500_2369817_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000431845.1|2369806_2371564_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000890941.1|2371579_2372476_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000177515.1|2372475_2373081_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000910026.1|2373251_2375558_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000097801.1|2375620_2376481_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_032313496.1|2376688_2379100_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001254932.1|2380192_2381344_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_088895425.1|2381552_2382780_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_010723099.1|2385471_2385537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001123464.1|2385640_2386231_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039887.1|2386212_2387163_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|2387263_2388577_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206197.1|2388603_2389809_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|2389808_2390231_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973360.1|2390220_2391648_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969784.1|2391649_2392438_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|2392437_2393205_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206388.1|2393201_2394272_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189201.1|2394279_2394777_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|2394791_2395538_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2395546_2395834_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191077.1|2395845_2396775_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186469.1|2397059_2399105_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535469.1|2399352_2401626_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|2401683_2403183_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067514.1|2403418_2404324_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001300734.1|2404495_2404822_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|2404829_2405015_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900941.1|2405011_2407651_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762236.1|2407858_2408848_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_001298828.1|2408958_2409381_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2409377_2409644_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628244.1|2409917_2413442_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837921.1|2413808_2414942_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_001300461.1|2415082_2415517_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_120795384.1|2416295_2416409_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|2416477_2416711_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000086527.1|2417027_2417618_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001698950.1|2417715_2418291_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000279097.1|2418290_2421653_-|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000019448.1|2421975_2422956_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
2423087:2423105	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000091628.1|2424721_2425081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350510.1|2425061_2425325_-	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_001097895.1|2425462_2426920_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228696.1|2427116_2427302_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_000450663.1|2427389_2427950_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_000788970.1|2427972_2428719_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000899748.1|2428725_2429583_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000693797.1|2429595_2430018_-	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000712069.1|2430040_2430337_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000948459.1|2430460_2430937_+	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_001169151.1|2431390_2431546_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2431542_2432031_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|2432472_2432694_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|2432693_2432864_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2432938_2433214_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105143.1|2433315_2435916_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000166319.1|2435908_2436718_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2436774_2436969_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2436961_2437171_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2437249_2437465_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2437466_2438702_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157406.1|2438753_2439689_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123737.1|2439817_2441191_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2441668_2442652_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|2442906_2444139_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2453462:2453480	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
>prophage 5
NZ_CP048439	Escherichia coli strain NBRC 3301 chromosome, complete genome	4656310	2636642	2651023	4656310	portal,tail,integrase,plate	Escherichia_phage(26.32%)	25	2634018:2634031	2652049:2652062
2634018:2634031	attL	AAAATAAGATGAAT	NA	NA	NA	NA
WP_000332303.1|2636642_2637374_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|2637594_2637999_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032082692.1|2638051_2638162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295666.1|2638698_2639022_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_000539894.1|2639124_2639277_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.0	1.4e-20
WP_000557907.1|2639522_2640356_-	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000905001.1|2640462_2641017_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_024184299.1|2641088_2641583_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000548498.1|2641582_2642185_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_010723096.1|2642156_2642570_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000554703.1|2642571_2643201_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_000383574.1|2643204_2643789_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_001350503.1|2643779_2644571_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_001350502.1|2644497_2644971_-|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_000605606.1|2644970_2645153_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000104929.1|2645164_2646532_-	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_001250269.1|2646521_2646701_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515837.1|2646876_2647434_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_000649480.1|2647477_2647678_-	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000848748.1|2647768_2648443_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001005353.1|2648617_2648926_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_010723095.1|2648863_2649205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011443584.1|2649321_2649633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939945.1|2649669_2649915_+	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_000741310.1|2649895_2651023_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
2652049:2652062	attR	AAAATAAGATGAAT	NA	NA	NA	NA
>prophage 6
NZ_CP048439	Escherichia coli strain NBRC 3301 chromosome, complete genome	4656310	3041625	3091970	4656310	portal,protease,holin,head,lysis,terminase,tail,capsid,integrase	Enterobacteria_phage(75.0%)	69	3068878:3068893	3093678:3093693
WP_001295303.1|3041625_3042915_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
WP_000767389.1|3042973_3043450_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_000889231.1|3044305_3045883_+	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	100.0	2.3e-304
WP_000735931.1|3045879_3046770_+	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	100.0	6.2e-177
WP_000162952.1|3047360_3048593_+	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	100.0	2.7e-239
WP_016063193.1|3048721_3049306_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	100.0	1.2e-109
WP_001407643.1|3049305_3051630_-	short-chain dehydrogenase	NA	A0A0K2FIZ6	Escherichia_phage	100.0	6.0e-224
WP_001246632.1|3051694_3052315_-	outer membrane beta-barrel protein Lom	NA	A0A1U8QHD6	Enterobacteria_phage	100.0	8.3e-112
WP_000515496.1|3052376_3055775_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	100.0	0.0e+00
WP_000090889.1|3055835_3056468_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	100.0	5.9e-97
WP_000194780.1|3056404_3057148_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152639.1|3057153_3057852_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|3057851_3058181_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840207.1|3058177_3060739_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	100.0	0.0e+00
WP_000459457.1|3060731_3061166_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|3061147_3061570_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|3061585_3062326_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683105.1|3062333_3062729_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975070.1|3062725_3063304_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752979.1|3063315_3063669_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000158919.1|3063680_3064079_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_000063280.1|3064120_3065146_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_001297109.1|3065201_3065534_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000123343.1|3065543_3066863_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	100.0	7.9e-237
WP_001359455.1|3066843_3068445_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000198149.1|3068441_3068648_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027292.1|3068644_3070570_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
3068878:3068893	attL	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
WP_000453580.1|3070544_3071090_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001421937.1|3071478_3071673_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|3071837_3072044_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_012775990.1|3072329_3072740_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	100.0	2.5e-72
WP_000738492.1|3073029_3073323_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_012738274.1|3073413_3073596_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_000229403.1|3073812_3074289_-	glycoside hydrolase family protein	NA	A0A0K2FIS2	Enterobacteria_phage	100.0	4.4e-89
WP_000783735.1|3074272_3074596_-|holin	phage holin, lambda family	holin	A0A0K2FJ23	Enterobacteria_phage	100.0	1.3e-52
WP_001235459.1|3075272_3075896_-	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_001271136.1|3075892_3076558_-	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	100.0	1.7e-131
WP_000144614.1|3076535_3076742_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001108044.1|3076738_3077350_-	recombination protein NinG	NA	K7P8B1	Enterobacteria_phage	100.0	3.5e-99
WP_000566997.1|3077342_3077513_-	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
WP_000113775.1|3077509_3077692_-	NinE family protein	NA	C6ZR57	Salmonella_phage	96.7	8.2e-28
WP_000984218.1|3077658_3077832_-	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000611491.1|3077828_3078701_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0K2FIH3	Escherichia_phage	100.0	9.3e-178
WP_000736903.1|3078697_3079138_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000145933.1|3079211_3079502_-	protein ren	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
WP_000788910.1|3079498_3080200_-	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
WP_000185505.1|3080196_3081096_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000251069.1|3081128_3081422_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|3081540_3081741_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000104863.1|3081841_3082555_+	LexA family transcriptional regulator	NA	M1FN96	Enterobacteria_phage	100.0	1.6e-127
WP_000788349.1|3082667_3083507_+	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
WP_001245922.1|3083522_3083957_+	protein rexB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
WP_001564525.1|3084421_3084745_+	antitermination protein	NA	A0A0K2FII1	Escherichia_phage	100.0	4.5e-53
WP_000281856.1|3084745_3085228_-	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_000213975.1|3085494_3085695_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000065374.1|3085877_3086246_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198861.1|3086318_3086483_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3086451_3086595_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995451.1|3086669_3086966_+	host-nuclease inhibitor protein Gam	NA	C6ZCV5	Enterobacteria_phage	100.0	2.1e-49
WP_000100844.1|3086971_3087757_+	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000186853.1|3087753_3088434_+	YqaJ viral recombinase family protein	NA	A0A0K2FIU4	Escherichia_phage	100.0	2.7e-132
WP_000149542.1|3088430_3088613_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
WP_000548551.1|3088585_3088777_+	DUF1382 family protein	NA	A0A0K2FJ42	Enterobacteria_phage	100.0	2.8e-26
WP_000763367.1|3089168_3089390_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_001289873.1|3089386_3089935_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000026224.1|3090126_3090408_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_000545733.1|3090496_3090664_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_002414258.1|3090703_3090922_+	excisionase	NA	C6ZCU6	Enterobacteria_phage	100.0	1.3e-35
WP_000533640.1|3090899_3091970_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PMH8	Enterobacteria_phage	100.0	3.9e-202
3093678:3093693	attR	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
>prophage 7
NZ_CP048439	Escherichia coli strain NBRC 3301 chromosome, complete genome	4656310	3290208	3334461	4656310	protease,lysis,terminase,transposase,integrase	Enterobacteria_phage(56.0%)	48	3313283:3313329	3334475:3334521
WP_001300563.1|3290208_3291321_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|3291397_3291550_-	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001130654.1|3292002_3293121_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682509.1|3293186_3293435_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|3293499_3293868_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351487.1|3293961_3294615_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|3294722_3295970_+	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000786319.1|3296050_3297427_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573945.1|3297528_3300672_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000717157.1|3300683_3301907_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709870.1|3301922_3302255_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074234.1|3302412_3303786_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|3303942_3304626_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253839.1|3304615_3306058_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_000383932.1|3306207_3308445_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662357.1|3308431_3311404_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224604.1|3311404_3312295_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177471.1|3312477_3313239_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3313283:3313329	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201845.1|3313752_3314706_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|3314955_3315705_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_026089880.1|3316607_3317234_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001027248.1|3317288_3318032_-|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
WP_000453566.1|3318006_3318552_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001421937.1|3318940_3319135_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|3319299_3319506_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079503.1|3319791_3320202_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_000738500.1|3320492_3320786_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|3320876_3321059_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|3321275_3321773_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000839596.1|3321772_3321988_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737282.1|3322560_3323628_+	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_010723085.1|3323632_3324649_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001204791.1|3324936_3325320_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971055.1|3325405_3325546_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3325542_3325905_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774486.1|3325901_3326192_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_000224915.1|3326184_3326355_-	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001054340.1|3326354_3326810_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_001303586.1|3326806_3326908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|3327024_3327822_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001306955.1|3327831_3328383_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|3328847_3330374_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001372443.1|3330431_3330581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070439.1|3330628_3330961_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_085947771.1|3331271_3332434_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000145909.1|3332496_3332592_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000672150.1|3332914_3333178_+	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_001350488.1|3333297_3334461_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
3334475:3334521	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 8
NZ_CP048439	Escherichia coli strain NBRC 3301 chromosome, complete genome	4656310	3567779	3619252	4656310	transposase,holin,integrase	Acinetobacter_phage(28.57%)	47	3559207:3559223	3621535:3621551
3559207:3559223	attL	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_000131044.1|3567779_3569813_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3569941_3570529_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3570542_3572015_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3572028_3573699_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3573911_3574580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3574822_3575518_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3575510_3576938_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3576948_3577668_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3578194_3579049_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046307.1|3579274_3580600_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|3580708_3580945_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3580956_3581550_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_085947771.1|3582822_3583985_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000020224.1|3584031_3584919_-	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_000662258.1|3586033_3586135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3586498_3586762_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3586761_3586902_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3586936_3587164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|3587987_3588530_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3588604_3589192_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3589249_3589918_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|3589943_3592469_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|3592458_3594102_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|3594070_3594781_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3595093_3595423_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3595670_3596285_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|3596702_3597392_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|3597388_3598345_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667026.1|3598341_3600540_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121359.1|3600549_3601506_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111342.1|3601484_3601895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|3602179_3603580_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_000224818.1|3603696_3604137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|3604133_3604358_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072039.1|3604476_3605331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214248.1|3605357_3606056_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000860996.1|3606327_3606954_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000388269.1|3607044_3607776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281825.1|3608970_3609975_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_001121657.1|3610113_3610872_+	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_000406871.1|3610876_3612487_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_000192863.1|3612498_3613881_-	MFS transporter	NA	NA	NA	NA	NA
WP_000151261.1|3614107_3616075_-	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_001136613.1|3616089_3616998_-	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_010723086.1|3617292_3618447_+|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001030800.1|3618540_3618891_+	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_000015532.1|3618913_3619252_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
3621535:3621551	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 1
NZ_CP048440	Escherichia coli strain NBRC 3301 plasmid putative_pEcol1, complete sequence	98786	1262	44442	98786	tRNA,protease,transposase,integrase	Acinetobacter_phage(25.0%)	26	NA	NA
WP_001066941.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_072145210.1|2759_4247_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001193612.1|4351_5299_-|protease	omptin family outer membrane protease OmpP	protease	NA	NA	NA	NA
WP_000995793.1|6019_10135_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	37.1	1.6e-126
WP_064754094.1|10770_15708_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000286435.1|16460_17153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|18347_19575_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_085955200.1|20928_22091_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	4.4e-50
WP_000131420.1|22997_23186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000483319.1|23788_24202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001351581.1|24307_24772_+	membrane protein	NA	NA	NA	NA	NA
WP_001351580.1|24935_25349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001092154.1|25458_26520_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001143750.1|27110_30119_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.4	0.0e+00
WP_001235704.1|30282_30834_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	81.8	1.7e-76
WP_000422420.1|30849_32946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001442103.1|33324_33399_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083834.1|33632_33890_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001312851.1|34173_34323_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000802277.1|34723_35035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001345829.1|35499_35688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|36020_37183_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000205776.1|37698_38445_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	28.1	2.5e-06
WP_000987005.1|38464_43735_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000450532.1|43816_44044_+	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000911324.1|44043_44442_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
