The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	0	17661	2848798	integrase	Staphylococcus_phage(96.88%)	32	5414:5427	19663:19676
WP_000265252.1|1773_1974_-	DUF1514 family protein	NA	A0A2I6PEP5	Staphylococcus_phage	100.0	4.9e-26
WP_000595263.1|2041_2194_-	transcriptional activator RinB	NA	A0A2I6PEM5	Staphylococcus_phage	100.0	2.0e-19
WP_000195810.1|2190_2397_-	DUF1381 domain-containing protein	NA	S4V684	Staphylococcus_phage	100.0	7.6e-30
WP_063653166.1|2433_2967_-	dUTPase	NA	U5U798	Staphylococcus_phage	98.3	1.5e-93
WP_031267622.1|3306_3558_-	DUF1024 family protein	NA	M9NRI5	Staphylococcus_phage	100.0	1.1e-38
WP_000979209.1|3853_4201_-	hypothetical protein	NA	D2JGL4	Staphylococcus_phage	100.0	5.9e-59
WP_001668982.1|4197_4578_-	hypothetical protein	NA	A0A2K9VBT5	Staphylococcus_phage	100.0	8.4e-67
WP_000693989.1|4580_4787_-	hypothetical protein	NA	A0A2K9VBT9	Staphylococcus_phage	100.0	3.0e-34
WP_060474161.1|4800_5049_-	hypothetical protein	NA	A0A2K9VBX5	Staphylococcus_phage	100.0	1.2e-40
WP_000022722.1|5048_5303_-	DUF3310 domain-containing protein	NA	A0A2K9VBW1	Staphylococcus_phage	100.0	1.6e-42
WP_044426014.1|5299_5704_-	phage DNA polymerase	NA	A0A2K9VBY6	Staphylococcus_phage	100.0	3.3e-69
5414:5427	attL	CTTTCTTTCTTCTT	NA	NA	NA	NA
WP_001164629.1|5703_5889_-	DUF3113 family protein	NA	A0A2I6PEM8	Staphylococcus_phage	100.0	7.0e-27
WP_161081393.1|5901_7854_-	DNA polymerase	NA	A0A2I6PF18	Staphylococcus_phage	99.5	0.0e+00
WP_000645042.1|7922_8480_-	DUF2815 family protein	NA	A0A2I6PF05	Staphylococcus_phage	100.0	1.8e-97
WP_000762547.1|8505_9672_-	DUF2800 domain-containing protein	NA	A0A2D1G5B8	Staphylococcus_phage	100.0	8.3e-222
WP_000985976.1|9668_10031_-	hypothetical protein	NA	A0A2I6PF03	Staphylococcus_phage	100.0	4.9e-56
WP_000174994.1|10045_10369_-	hypothetical protein	NA	A0A2I6PF12	Staphylococcus_phage	100.0	5.9e-53
WP_001285963.1|10447_10609_-	DUF1270 family protein	NA	A0A2I6PEZ9	Staphylococcus_phage	100.0	5.0e-21
WP_001124159.1|10621_10885_-	helix-turn-helix domain-containing protein	NA	A0A2I6PDM6	Staphylococcus_phage	98.9	1.4e-44
WP_000642492.1|10939_11149_+	hypothetical protein	NA	W5R9J5	Staphylococcus_phage	100.0	1.2e-30
WP_000939498.1|11138_11282_-	hypothetical protein	NA	W5R8I6	Staphylococcus_phage	100.0	2.5e-16
WP_001097552.1|11372_11588_-	hypothetical protein	NA	A0A2I6PF01	Staphylococcus_phage	100.0	1.9e-31
WP_001128433.1|11642_12008_+	hypothetical protein	NA	A0A2I6PF07	Staphylococcus_phage	100.0	2.4e-63
WP_001025401.1|11976_12222_-	DUF2829 domain-containing protein	NA	A0A2I6PF15	Staphylococcus_phage	100.0	5.1e-41
WP_001001383.1|12271_12490_-	hypothetical protein	NA	B5WZL5	Staphylococcus_phage	100.0	7.8e-33
WP_061389040.1|12505_13282_-	phage antirepressor	NA	M1RZB2	Staphylococcus_phage	96.5	1.4e-137
WP_024936995.1|13656_14379_+	helix-turn-helix transcriptional regulator	NA	A0A1X9H038	Staphylococcus_phage	76.1	7.7e-93
WP_024936996.1|14533_14719_+	hypothetical protein	NA	Q9G041	Staphylococcus_virus	98.4	5.1e-25
WP_161081411.1|14774_15359_+	hypothetical protein	NA	A0A2I6PD77	Staphylococcus_phage	97.4	3.2e-65
WP_078367450.1|15588_15735_+	hypothetical protein	NA	A0A2I6PEK8	Staphylococcus_phage	91.7	4.9e-15
WP_031808062.1|15731_16346_-	hypothetical protein	NA	A0A2I6PEZ0	Staphylococcus_phage	99.5	8.8e-106
WP_099560862.1|16455_17661_+|integrase	site-specific integrase	integrase	A0A1X9H094	Staphylococcus_phage	99.3	5.5e-221
19663:19676	attR	CTTTCTTTCTTCTT	NA	NA	NA	NA
>prophage 2
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	31839	32517	2848798		Planktothrix_phage(100.0%)	1	NA	NA
WP_000911017.1|31839_32517_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	1.6e-31
>prophage 3
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	48187	52627	2848798		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000549287.1|48187_52627_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	25.6	6.3e-28
>prophage 4
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	63232	64894	2848798		Amsacta_moorei_entomopoxvirus(50.0%)	2	NA	NA
WP_000570070.1|63232_63892_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	37.2	7.6e-23
WP_000736784.1|63943_64894_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 5
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	73693	75130	2848798		Pandoravirus(100.0%)	1	NA	NA
WP_000164003.1|73693_75130_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.7	1.1e-29
>prophage 6
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	78890	83429	2848798		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000925394.1|78890_80630_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	1.5e-62
WP_000608818.1|80889_81564_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_000975351.1|81707_83429_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 7
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	92756	93800	2848798		Synechococcus_phage(100.0%)	1	NA	NA
WP_000645608.1|92756_93800_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.9	3.5e-14
>prophage 8
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	101014	102544	2848798		Vibrio_phage(100.0%)	1	NA	NA
WP_000838205.1|101014_102544_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	50.7	4.5e-10
>prophage 9
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	111419	112925	2848798		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001008400.1|111419_112925_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	6.0e-39
>prophage 10
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	124031	129390	2848798		Tetraselmis_virus(50.0%)	3	NA	NA
WP_000894660.1|124031_126281_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
WP_000837116.1|126868_127837_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000127990.1|127833_129390_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
>prophage 11
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	139599	141659	2848798		Planktothrix_phage(50.0%)	2	NA	NA
WP_000818915.1|139599_140697_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
WP_000166920.1|141080_141659_-	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	39.1	9.7e-14
>prophage 12
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	150208	153396	2848798		Planktothrix_phage(33.33%)	3	NA	NA
WP_000067352.1|150208_151801_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	4.1e-22
WP_000794565.1|152310_152508_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	43.3	2.1e-05
WP_000960712.1|152673_153396_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.8	4.1e-22
>prophage 13
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	157268	157949	2848798		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571407.1|157268_157949_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	2.9e-33
>prophage 14
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	174755	175940	2848798		Klosneuvirus(100.0%)	1	NA	NA
WP_001084442.1|174755_175940_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	2.0e-34
>prophage 15
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	180776	191060	2848798		Tupanvirus(50.0%)	3	NA	NA
WP_000605281.1|180776_187952_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.7	4.5e-68
WP_000826862.1|188398_189649_-	MFS transporter	NA	NA	NA	NA	NA
WP_000706135.1|190034_191060_-	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.5	8.5e-29
>prophage 16
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	194596	197827	2848798		Bacillus_virus(50.0%)	4	NA	NA
WP_000590854.1|194596_195337_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.1	2.5e-38
WP_000171919.1|195678_196191_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_000356963.1|196369_196573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013485.1|196867_197827_-	cation transporter	NA	A0A1V0SED0	Indivirus	34.2	1.2e-11
>prophage 17
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	201168	203653	2848798		Catovirus(50.0%)	2	NA	NA
WP_000723436.1|201168_202314_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	25.9	4.6e-23
WP_000779504.1|202390_203653_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.5	4.3e-22
>prophage 18
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	210488	217053	2848798		Catovirus(50.0%)	6	NA	NA
WP_000413171.1|210488_211613_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	6.7e-128
WP_001028283.1|211616_212726_-	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000459062.1|212738_213767_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.3	1.1e-41
WP_000940790.1|213756_215580_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.1	5.2e-29
WP_000565304.1|215599_216364_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000037332.1|216366_217053_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	3.7e-28
>prophage 19
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	227689	228463	2848798		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078092.1|227689_228463_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	3.8e-13
>prophage 20
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	236495	237095	2848798		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000874681.1|236495_237095_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 21
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	242032	247129	2848798		Catovirus(50.0%)	6	NA	NA
WP_001793242.1|242032_243013_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	37.0	1.0e-47
WP_001789407.1|243082_243205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000183771.1|243348_244125_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_000414629.1|244336_244963_-	MFS transporter	NA	NA	NA	NA	NA
WP_001015549.1|245158_245923_-	bifunctional transcriptional regulator/O-phospho-L-serine synthase SbnI	NA	NA	NA	NA	NA
WP_001223713.1|245926_247129_-	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	21.1	3.9e-09
>prophage 22
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	255395	259605	2848798		Lactococcus_phage(50.0%)	4	NA	NA
WP_000570808.1|255395_256376_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
WP_001045111.1|256606_257599_+	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_000924990.1|257614_258610_+	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_000136633.1|258606_259605_+	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.8	5.2e-15
>prophage 23
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	292537	293602	2848798		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000816133.1|292537_293602_-	persulfide response sulfurtransferase CstA	NA	A0A2H4PQR9	Staphylococcus_phage	41.8	7.7e-09
>prophage 24
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	304289	306311	2848798		Streptococcus_phage(100.0%)	1	NA	NA
WP_000852430.1|304289_306311_-	K(+)-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	29.0	6.6e-41
>prophage 25
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	318724	325056	2848798	integrase	Bacillus_phage(66.67%)	7	315293:315307	325371:325385
315293:315307	attL	AGGATACTTTAAATC	NA	NA	NA	NA
WP_000815646.1|318724_320074_+	recombinase family protein	NA	Q9T200	Bacillus_phage	25.1	1.4e-18
WP_001186602.1|320095_321724_+	recombinase family protein	NA	A0A0S2SXR4	Bacillus_phage	31.4	2.4e-46
WP_000859155.1|322241_322592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000700853.1|322678_322990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001092169.1|323007_323514_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_061641403.1|323534_323852_+	RadC family protein	NA	NA	NA	NA	NA
WP_000868132.1|323970_325056_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	28.3	4.5e-12
325371:325385	attR	GATTTAAAGTATCCT	NA	NA	NA	NA
>prophage 26
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	328387	329119	2848798		Streptococcus_phage(100.0%)	1	NA	NA
WP_001072201.1|328387_329119_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
>prophage 27
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	342516	343191	2848798	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001106057.1|342516_343191_+|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	99.1	2.6e-127
>prophage 28
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	347573	348536	2848798	transposase	Streptococcus_phage(50.0%)	2	NA	NA
WP_001817892.1|347573_347771_+	protein rep	NA	A0A286QS97	Streptococcus_phage	62.0	1.2e-08
WP_001106057.1|347861_348536_+|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	99.1	2.6e-127
>prophage 29
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	354191	364200	2848798		Bacteriophage(25.0%)	6	NA	NA
WP_000088649.1|354191_354992_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
WP_001104165.1|355380_356169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060140.1|356169_357504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871607.1|357496_359323_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	1.6e-30
WP_000095328.1|361238_362522_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
WP_000375647.1|362799_364200_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 30
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	370890	377965	2848798	tRNA	uncultured_Mediterranean_phage(33.33%)	4	NA	NA
WP_000884332.1|370890_372177_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	4.5e-88
WP_000177465.1|372555_374070_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	1.2e-90
WP_000449218.1|374395_375208_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_000819067.1|375295_377965_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.9	4.6e-119
>prophage 31
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	390035	396592	2848798		Faecalibacterium_phage(25.0%)	8	NA	NA
WP_000742837.1|390035_390875_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.8	2.2e-06
WP_000491382.1|391325_391679_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000779134.1|391746_392142_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001054128.1|392401_392971_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	33.3	6.2e-05
WP_001059079.1|393088_393289_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
WP_000672033.1|393680_393872_-	peptide resistance ABC transporter activity modulator VraH	NA	NA	NA	NA	NA
WP_042109909.1|393963_395844_-	peptide resistance ABC transporter permease subunit VraE	NA	NA	NA	NA	NA
WP_000154162.1|395833_396592_-	peptide resistance ABC transporter ATP-binding subunit VraD	NA	G9BWD6	Planktothrix_phage	39.5	9.0e-36
>prophage 32
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	410844	412557	2848798		Planktothrix_phage(100.0%)	1	NA	NA
WP_000138654.1|410844_412557_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.4e-20
>prophage 33
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	418184	419198	2848798		Faustovirus(100.0%)	1	NA	NA
WP_000639184.1|418184_419198_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	25.9	9.6e-09
>prophage 34
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	431536	432229	2848798		Streptococcus_phage(100.0%)	1	NA	NA
WP_000185863.1|431536_432229_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 35
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	458327	460187	2848798		Enterococcus_phage(100.0%)	1	NA	NA
WP_001125628.1|458327_460187_-	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 36
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	485798	487549	2848798		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000143425.1|485798_486686_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	2.5e-05
WP_000923760.1|486793_487549_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	3.0e-31
>prophage 37
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	490969	491467	2848798		Canarypox_virus(100.0%)	1	NA	NA
WP_001065268.1|490969_491467_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	1.8e-21
>prophage 38
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	496461	498845	2848798		Enterococcus_phage(100.0%)	2	NA	NA
WP_001071729.1|496461_498312_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.3	9.3e-236
WP_000173331.1|498308_498845_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	48.0	3.9e-41
>prophage 39
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	506837	513835	2848798		Staphylococcus_phage(33.33%)	6	NA	NA
WP_001172341.1|506837_508436_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	36.8	5.3e-78
WP_001791980.1|508495_508825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130051.1|509120_510617_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001031409.1|510810_511701_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	1.2e-07
WP_001237629.1|511823_512240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030072.1|512497_513835_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.0e-18
>prophage 40
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	544168	547958	2848798		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000751263.1|544168_544870_+	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.4	5.2e-38
WP_000996739.1|545145_545634_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000379821.1|546146_547958_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
>prophage 41
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	556391	560633	2848798		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_000161369.1|556391_557390_+	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.2	1.0e-34
WP_000076661.1|557480_557687_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000024139.1|558224_560633_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.8	3.2e-127
>prophage 42
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	569874	572910	2848798	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001058993.1|569874_571980_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.5	3.1e-118
WP_000455988.1|572388_572910_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.1	2.0e-26
>prophage 43
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	579336	585720	2848798		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_001062663.1|579336_581076_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	6.0e-35
WP_000473678.1|581376_583443_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_000206031.1|583822_584233_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000240663.1|584274_584631_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001228167.1|584751_585720_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	4.0e-12
>prophage 44
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	595009	596002	2848798		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000161545.1|595009_596002_-	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.7	3.7e-37
>prophage 45
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	605280	605976	2848798		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000538625.1|605280_605976_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.6	3.0e-38
>prophage 46
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	626372	627239	2848798		Bacillus_phage(100.0%)	1	NA	NA
WP_000721336.1|626372_627239_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.6	1.3e-78
>prophage 47
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	635038	636847	2848798		Streptococcus_phage(100.0%)	1	NA	NA
WP_001835549.1|635038_636847_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	37.3	3.9e-93
>prophage 48
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	648077	648773	2848798		Bacillus_phage(100.0%)	1	NA	NA
WP_000217456.1|648077_648773_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	35.6	4.3e-08
>prophage 49
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	653327	654146	2848798		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_000824948.1|653327_654146_+	SDR family oxidoreductase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	27.2	1.3e-08
>prophage 50
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	662198	663756	2848798		Planktothrix_phage(50.0%)	2	NA	NA
WP_000173871.1|662198_663014_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	8.8e-13
WP_000598772.1|663006_663756_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	9.0e-20
>prophage 51
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	671027	675456	2848798		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_000923526.1|671027_671690_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.8	5.5e-21
WP_000072149.1|671682_672459_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_063653202.1|672854_674042_+	MFS transporter	NA	NA	NA	NA	NA
WP_000700925.1|674103_675456_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	2.5e-12
>prophage 52
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	678850	680709	2848798		Mycoplasma_phage(50.0%)	2	NA	NA
WP_000948974.1|678850_680077_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
WP_000569120.1|680073_680709_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	26.2	9.0e-05
>prophage 53
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	698437	704699	2848798		Bacillus_phage(66.67%)	5	NA	NA
WP_164094421.1|698437_699580_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	43.9	2.6e-55
WP_000779360.1|699847_700234_+	GtrA family protein	NA	NA	NA	NA	NA
WP_000482652.1|700367_700475_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_001064825.1|701177_702941_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.7	2.5e-36
WP_063653200.1|702965_704699_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.0	9.0e-31
>prophage 54
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	708160	713931	2848798		Staphylococcus_phage(75.0%)	6	NA	NA
WP_000971550.1|708160_709276_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.7	1.6e-20
WP_063653199.1|709286_709979_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_000200956.1|709989_710457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783428.1|710508_711486_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	7.1e-142
WP_000916704.1|711487_712435_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.5	3.2e-139
WP_000594519.1|713001_713931_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.1	3.2e-120
>prophage 55
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	721943	722675	2848798		Bacillus_virus(100.0%)	1	NA	NA
WP_000615461.1|721943_722675_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	4.1e-25
>prophage 56
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	739324	740884	2848798		Escherichia_phage(100.0%)	1	NA	NA
WP_000692648.1|739324_740884_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	4.4e-21
>prophage 57
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	762212	763247	2848798		Bacillus_virus(100.0%)	1	NA	NA
WP_000655971.1|762212_763247_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.6	5.8e-17
>prophage 58
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	773092	776989	2848798		Hokovirus(50.0%)	3	NA	NA
WP_000477338.1|773092_774466_-	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.8	2.3e-13
WP_000761395.1|775268_776324_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001229920.1|776323_776989_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.6e-36
>prophage 59
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	780728	781937	2848798		Salmonella_phage(100.0%)	1	NA	NA
WP_000999131.1|780728_781937_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.3	3.9e-33
>prophage 60
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	794027	794927	2848798		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524830.1|794027_794927_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	1.2e-15
>prophage 61
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	802296	802716	2848798		Bacillus_phage(100.0%)	1	NA	NA
WP_000920239.1|802296_802716_-	FosB1/FosB3 family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	61.9	2.6e-37
>prophage 62
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	808408	809290	2848798		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000235289.1|808408_809290_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.3	3.8e-62
>prophage 63
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	817167	817803	2848798		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285450.1|817167_817803_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.1	1.6e-09
>prophage 64
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	830745	834725	2848798		Staphylococcus_phage(50.0%)	4	NA	NA
WP_011447058.1|830745_831384_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JQU5	Staphylococcus_phage	48.1	2.6e-36
WP_000684147.1|831694_832819_+	NAD(P)-binding protein	NA	A0A2K9L3K5	Tupanvirus	22.8	9.3e-13
WP_063653196.1|832910_833864_-	hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.6	1.4e-30
WP_000737705.1|834224_834725_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
>prophage 65
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	838642	839446	2848798		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000717381.1|838642_839446_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.3e-07
>prophage 66
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	858425	859031	2848798		Pithovirus(100.0%)	1	NA	NA
WP_000913024.1|858425_859031_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.1	4.3e-12
>prophage 67
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	871000	874168	2848798		Leptospira_phage(100.0%)	1	NA	NA
WP_000592307.1|871000_874168_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.8	1.1e-61
>prophage 68
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	898654	899515	2848798		Bacillus_phage(100.0%)	1	NA	NA
WP_063653195.1|898654_899515_+	energy-coupling factor transporter ATPase	NA	W8CYL7	Bacillus_phage	28.7	6.7e-11
>prophage 69
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	908299	915955	2848798		Enterobacteria_phage(33.33%)	7	NA	NA
WP_000411031.1|908299_909316_+	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	29.7	1.0e-18
WP_000655241.1|909889_910072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130149.1|910565_912230_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.9	8.0e-45
WP_000186134.1|912266_912971_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_000769705.1|913354_913780_-	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000044362.1|914074_914890_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001044441.1|915100_915955_+	M23 family metallopeptidase	NA	E5G070	Clostridium_phage	37.9	4.9e-06
>prophage 70
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	919336	921646	2848798		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001015500.1|919336_920185_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.2	2.0e-44
WP_000875476.1|920417_920621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001791678.1|920707_920869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001557494.1|920905_921646_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	29.9	1.5e-14
>prophage 71
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	926124	927537	2848798		Pandoravirus(100.0%)	1	NA	NA
WP_000169224.1|926124_927537_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.9	3.0e-48
>prophage 72
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	931500	933063	2848798		Vibrio_phage(100.0%)	1	NA	NA
WP_000792342.1|931500_933063_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	1.2e-18
>prophage 73
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	943263	944232	2848798		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000989088.1|943263_944232_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.0e-15
>prophage 74
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	960098	961007	2848798		Klosneuvirus(100.0%)	1	NA	NA
WP_000167867.1|960098_961007_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.0	3.2e-27
>prophage 75
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	964598	972044	2848798		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001048266.1|964598_972044_+	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	31.5	3.9e-22
>prophage 76
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	978300	981120	2848798		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334463.1|978300_980106_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.8	5.2e-98
WP_000908182.1|980337_981120_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	3.3e-09
>prophage 77
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	992299	992743	2848798		Clostridium_phage(100.0%)	1	NA	NA
WP_000070866.1|992299_992743_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
>prophage 78
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1004068	1005679	2848798		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000159960.1|1004068_1005679_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.7e-146
>prophage 79
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1013481	1021230	2848798		Bacillus_virus(25.0%)	9	NA	NA
WP_000273358.1|1013481_1014081_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
WP_000460242.1|1014081_1015158_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_000248732.1|1015144_1015981_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_015445903.1|1016013_1017111_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.3	2.3e-40
WP_000697334.1|1017107_1017527_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_000654184.1|1017632_1018157_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_000120494.1|1018183_1019422_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
WP_000048712.1|1019449_1020079_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000723418.1|1020102_1021230_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.9	1.0e-27
>prophage 80
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1031634	1032030	2848798		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000932694.1|1031634_1032030_+	single-stranded DNA-binding protein	NA	A0A1J0MFK5	Staphylococcus_phage	38.5	1.3e-14
>prophage 81
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1038301	1038949	2848798		Moumouvirus(100.0%)	1	NA	NA
WP_001187630.1|1038301_1038949_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	8.0e-09
>prophage 82
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1046149	1047670	2848798		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001178942.1|1046149_1047670_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 83
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1053336	1055364	2848798		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000546611.1|1053336_1055364_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.5	2.3e-25
>prophage 84
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1060513	1063898	2848798		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
WP_000621175.1|1060513_1060876_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
WP_000390829.1|1061225_1062227_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001052491.1|1062345_1062672_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_011447044.1|1062643_1063153_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001041111.1|1063127_1063898_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	2.2e-21
>prophage 85
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1078014	1082738	2848798		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_000094583.1|1078014_1079544_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.1	5.5e-08
WP_072399972.1|1079573_1080593_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000196911.1|1080714_1080969_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_000047811.1|1080968_1082738_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.6	7.0e-63
>prophage 86
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1086498	1100558	2848798	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_000159041.1|1086498_1087524_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.6	3.4e-62
WP_000106332.1|1087838_1089449_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	28.1	1.9e-19
WP_001792272.1|1089537_1089666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602057.1|1089810_1091739_-	ABC-F type ribosomal protection protein	NA	A0A2K9L0W2	Tupanvirus	30.2	9.3e-53
WP_001283612.1|1091991_1092627_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_072414299.1|1092981_1094010_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000581076.1|1094069_1094294_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_001052270.1|1094501_1095752_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	4.5e-40
WP_164094427.1|1095924_1096884_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_000141432.1|1097032_1098517_+	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	26.5	2.3e-19
WP_001253312.1|1098513_1099473_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_000688492.1|1099841_1100558_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	2.3e-25
>prophage 87
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1107649	1121276	2848798	integrase,coat,terminase	Staphylococcus_phage(64.71%)	19	1107686:1107701	1125861:1125876
WP_000917289.1|1107649_1107934_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
1107686:1107701	attL	AAAAAAGAACAAGAAC	NA	NA	NA	NA
WP_000240642.1|1108009_1109626_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	3.4e-157
WP_000179343.1|1109694_1110867_-|integrase	site-specific integrase	integrase	A0A1W6JQD3	Staphylococcus_phage	96.2	5.8e-215
WP_000620857.1|1110880_1111555_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JGT9	uncultured_Caudovirales_phage	45.8	1.6e-39
WP_000153640.1|1111727_1111946_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JB11	uncultured_Caudovirales_phage	66.7	1.3e-19
WP_000481967.1|1111950_1112268_+	helix-turn-helix domain-containing protein	NA	A0A1W6JQE0	Staphylococcus_phage	98.1	9.2e-51
WP_000784885.1|1112264_1112411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025175789.1|1112463_1112613_+	hypothetical protein	NA	Q4ZE76	Staphylococcus_phage	93.9	2.5e-19
WP_001078344.1|1112615_1112942_+	DUF1474 family protein	NA	Q4ZE75	Staphylococcus_phage	89.8	1.5e-48
WP_001002689.1|1113006_1113876_+	hypothetical protein	NA	Q4ZE74	Staphylococcus_phage	96.2	1.5e-164
WP_000356942.1|1115907_1116288_+	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	96.8	1.7e-67
WP_001047698.1|1116284_1116926_+	hypothetical protein	NA	Q4ZE67	Staphylococcus_phage	93.0	7.2e-111
WP_001190615.1|1117375_1117717_+	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	99.1	1.4e-57
WP_000846280.1|1117728_1118307_+	hypothetical protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.9	4.8e-29
WP_000448770.1|1118324_1118543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000771368.1|1118593_1119121_+|coat	spore coat protein	coat	A0A1W6JQH7	Staphylococcus_phage	97.1	3.5e-87
WP_000358774.1|1119123_1119465_+	hypothetical protein	NA	A0A1W6JQM3	Staphylococcus_phage	99.1	1.4e-57
WP_063653148.1|1119461_1120031_+|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	98.4	1.6e-101
WP_000801979.1|1120307_1121276_+	Abi family protein	NA	A0A0H4U080	Erysipelothrix_phage	27.3	5.9e-24
1125861:1125876	attR	GTTCTTGTTCTTTTTT	NA	NA	NA	NA
>prophage 88
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1125801	1126530	2848798		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000757397.1|1125801_1126530_-	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	37.5	1.3e-18
>prophage 89
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1135844	1137088	2848798		Bacillus_phage(50.0%)	2	NA	NA
WP_000141557.1|1135844_1136531_+	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	54.2	1.7e-33
WP_001059082.1|1136887_1137088_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
>prophage 90
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1140488	1145666	2848798		Streptococcus_phage(50.0%)	8	NA	NA
WP_001802951.1|1140488_1141049_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.4	3.8e-31
WP_000255551.1|1141121_1141739_-	amino acid transporter	NA	NA	NA	NA	NA
WP_000569884.1|1141893_1142388_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000974460.1|1142786_1143209_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000150011.1|1143356_1144073_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.1	1.5e-16
WP_000422908.1|1144155_1144695_+	nitroreductase	NA	NA	NA	NA	NA
WP_001147952.1|1144845_1145166_-	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000589549.1|1145309_1145666_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
>prophage 91
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1148983	1150009	2848798		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571207.1|1148983_1150009_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	9.4e-28
>prophage 92
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1153496	1157019	2848798		Indivirus(50.0%)	3	NA	NA
WP_000168845.1|1153496_1154258_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
WP_000205567.1|1154355_1155663_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_001006450.1|1155768_1157019_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.8	1.1e-110
>prophage 93
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1171833	1174502	2848798		Tupanvirus(50.0%)	2	NA	NA
WP_000129659.1|1171833_1173291_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.5	2.6e-39
WP_000613541.1|1173287_1174502_+	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
>prophage 94
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1178545	1182173	2848798		Lake_Baikal_phage(50.0%)	3	NA	NA
WP_001143495.1|1178545_1178905_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.7e-14
WP_000046076.1|1179358_1180567_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001009692.1|1180697_1182173_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.9	4.5e-47
>prophage 95
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1192093	1199085	2848798		Aureococcus_anophage(33.33%)	6	NA	NA
WP_000035058.1|1192093_1192687_+	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
WP_001067294.1|1193101_1193479_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_063653151.1|1193840_1194968_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000167314.1|1195275_1196466_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.7	1.3e-33
WP_000138487.1|1196574_1197819_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_000185319.1|1198155_1199085_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.9	3.7e-39
>prophage 96
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1209239	1212893	2848798		Bacillus_phage(100.0%)	1	NA	NA
WP_000154921.1|1209239_1212893_+	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.5	2.0e-24
>prophage 97
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1218012	1224822	2848798		Pseudomonas_phage(33.33%)	4	NA	NA
WP_001044230.1|1218012_1219827_+	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	33.9	6.7e-37
WP_000353954.1|1220029_1222639_+	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.3	5.5e-117
WP_001047069.1|1222697_1223567_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000619360.1|1223676_1224822_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.0	1.5e-05
>prophage 98
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1233412	1235426	2848798		Planktothrix_phage(50.0%)	2	NA	NA
WP_000140050.1|1233412_1234495_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.4e-19
WP_000786734.1|1234484_1235426_+	ATP-binding cassette domain-containing protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	1.6e-05
>prophage 99
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1240062	1241043	2848798		Bacillus_virus(100.0%)	1	NA	NA
WP_000427767.1|1240062_1241043_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	1.3e-15
>prophage 100
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1246855	1248664	2848798		Streptococcus_phage(100.0%)	1	NA	NA
WP_000082725.1|1246855_1248664_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	5.5e-47
>prophage 101
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1267594	1272805	2848798	protease	Streptococcus_phage(33.33%)	3	NA	NA
WP_001049950.1|1267594_1269157_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	1.7e-36
WP_000928413.1|1269458_1270262_+	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001795272.1|1270480_1272805_+|protease	serine protease	protease	W5SAB9	Pithovirus	27.4	2.8e-11
>prophage 102
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1286424	1286715	2848798		Enterococcus_phage(100.0%)	1	NA	NA
WP_001788574.1|1286424_1286715_-	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	38.0	7.5e-07
>prophage 103
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1295020	1296049	2848798		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000676539.1|1295020_1296049_-	Glu-specific serine endopeptidase SspA	NA	A0A2H4PQP7	Staphylococcus_phage	32.3	6.3e-16
>prophage 104
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1299715	1303462	2848798		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001074534.1|1299715_1303462_-	bifunctional autolysin	NA	A0A1J0MFB0	Staphylococcus_phage	37.6	1.1e-54
>prophage 105
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1313916	1328678	2848798		Synechococcus_phage(22.22%)	14	NA	NA
WP_000225836.1|1313916_1314777_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.8	4.4e-39
WP_000861572.1|1314977_1315460_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	6.2e-22
WP_001010413.1|1315446_1316571_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000174053.1|1316574_1317279_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	7.3e-48
WP_000848350.1|1317278_1317542_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666806.1|1317543_1318215_+	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
WP_000032740.1|1318207_1320397_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.8	3.5e-141
WP_000483720.1|1320375_1321860_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	1.9e-45
WP_000030811.1|1321852_1322881_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.7	3.4e-62
WP_000238669.1|1322883_1323450_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	6.1e-29
WP_000709277.1|1323464_1324943_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.8	3.2e-77
WP_001101899.1|1324964_1326212_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000273253.1|1326478_1327285_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000921965.1|1327277_1328678_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.1e-10
>prophage 106
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1332109	1336489	2848798		Streptococcus_phage(50.0%)	5	NA	NA
WP_000685067.1|1332109_1333282_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.8	4.0e-75
WP_000505966.1|1333335_1333878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000437472.1|1334031_1334298_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_000040051.1|1334300_1336019_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_001289618.1|1336255_1336489_-	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	8.4e-09
>prophage 107
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1342501	1351334	2848798		Synechococcus_phage(25.0%)	9	NA	NA
WP_000957037.1|1342501_1343053_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.0	1.6e-13
WP_000668336.1|1343417_1344044_+	cell-wall-binding lipoprotein	NA	NA	NA	NA	NA
WP_000035320.1|1344214_1345327_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	A0A0K0KW14	Prochlorococcus_phage	27.8	1.4e-05
WP_000068176.1|1345330_1346308_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000863439.1|1346398_1347691_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_000260117.1|1347694_1349101_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.2e-46
WP_000455597.1|1349268_1349544_+	UPF0223 family protein	NA	NA	NA	NA	NA
WP_001020625.1|1349687_1350227_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000433551.1|1350239_1351334_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
>prophage 108
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1359455	1361303	2848798		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000182654.1|1359455_1361303_+	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	26.2	1.8e-21
>prophage 109
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1372820	1375728	2848798		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000757575.1|1372820_1373747_-	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	2.2e-12
WP_001049150.1|1373985_1374240_+	YlbG family protein	NA	NA	NA	NA	NA
WP_000814565.1|1374242_1374632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001263796.1|1374701_1375244_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_000401377.1|1375245_1375728_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
>prophage 110
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1387674	1388733	2848798	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000003566.1|1387674_1388733_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 111
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1393735	1398293	2848798		Bodo_saltans_virus(33.33%)	3	NA	NA
WP_000161938.1|1393735_1395448_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	6.8e-15
WP_161081401.1|1395457_1397806_+	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.4	3.2e-15
WP_001018928.1|1397978_1398293_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
>prophage 112
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1413922	1415882	2848798		Staphylococcus_phage(100.0%)	3	NA	NA
WP_000857488.1|1413922_1414882_-	beta-channel forming cytolysin	NA	A0A2H4PQH7	Staphylococcus_phage	30.3	7.4e-35
WP_000765708.1|1415554_1415701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001802045.1|1415657_1415882_+	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	71.4	5.6e-18
>prophage 113
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1424898	1425087	2848798		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245796.1|1424898_1425087_+	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	85.2	2.5e-19
>prophage 114
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1444669	1447423	2848798	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000384691.1|1444669_1447423_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	3.6e-90
>prophage 115
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1451887	1456498	2848798		Enterobacteria_phage(33.33%)	4	NA	NA
WP_001178619.1|1451887_1453195_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
WP_001016166.1|1453222_1454104_+	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_000767028.1|1454121_1455396_+	dihydroorotase	NA	NA	NA	NA	NA
WP_001190913.1|1455397_1456498_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	5.6e-63
>prophage 116
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1460465	1461077	2848798		Pandoravirus(100.0%)	1	NA	NA
WP_001040248.1|1460465_1461077_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 117
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1464391	1466648	2848798		Abalone_herpesvirus(50.0%)	3	NA	NA
WP_000368226.1|1464391_1465015_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.1	1.0e-21
WP_000933956.1|1465014_1465233_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000722165.1|1465448_1466648_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
>prophage 118
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1471660	1472596	2848798	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_063653155.1|1471660_1472596_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.0	4.7e-10
>prophage 119
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1475743	1477738	2848798		Moumouvirus(100.0%)	1	NA	NA
WP_000579563.1|1475743_1477738_+	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 120
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1488108	1490358	2848798		Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
WP_000167269.1|1488108_1488843_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
WP_000426914.1|1489277_1489511_+	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_000043237.1|1489626_1490358_+	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
>prophage 121
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1503742	1517413	2848798	tRNA,protease	Emiliania_huxleyi_virus(16.67%)	11	NA	NA
WP_000176393.1|1503742_1504510_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	2.5e-25
WP_001020801.1|1504618_1505785_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000110253.1|1505806_1506715_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	3.0e-17
WP_001041666.1|1506941_1508060_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A1W6JQB6	Staphylococcus_phage	61.1	9.5e-50
WP_000672869.1|1508087_1509332_+	FemA/FemB family glycyltransferase FmhC	NA	NA	NA	NA	NA
WP_000593194.1|1509504_1510377_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_001557331.1|1510550_1512626_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	1.7e-105
WP_000195254.1|1512781_1514089_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_001015601.1|1514505_1515402_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.9	3.6e-31
WP_000072681.1|1515398_1515944_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_164094431.1|1516009_1517413_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.6	2.9e-27
>prophage 122
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1522192	1522963	2848798		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000473699.1|1522192_1522963_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 123
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1527236	1539049	2848798	tRNA	Clostridium_phage(33.33%)	9	NA	NA
WP_001801936.1|1527236_1531547_+	DNA polymerase III subunit alpha	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
WP_000036633.1|1531836_1532304_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000097460.1|1532324_1533500_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000727423.1|1533520_1533805_+	YlxR family protein	NA	NA	NA	NA	NA
WP_000020853.1|1533801_1534119_+	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000043635.1|1534123_1536241_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	2.4e-25
WP_000097322.1|1536626_1536977_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000282298.1|1537145_1538063_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000864185.1|1538077_1539049_+	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
>prophage 124
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1544188	1549729	2848798		Mycobacterium_phage(33.33%)	4	NA	NA
WP_001811366.1|1544188_1546429_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
WP_001293312.1|1546433_1547147_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000089941.1|1547177_1548443_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	1.2e-40
WP_000664775.1|1548442_1549729_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	28.4	7.9e-16
>prophage 125
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1553927	1554971	2848798		Bacillus_phage(100.0%)	1	NA	NA
WP_000368166.1|1553927_1554971_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 126
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1564385	1570867	2848798		Cafeteria_roenbergensis_virus(33.33%)	4	NA	NA
WP_000073352.1|1564385_1567004_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	8.5e-41
WP_000516269.1|1567016_1569026_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.0	4.8e-60
WP_001077635.1|1569031_1569574_+	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_001103743.1|1570048_1570867_+	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	2.4e-26
>prophage 127
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1576809	1577286	2848798		Fowlpox_virus(100.0%)	1	NA	NA
WP_000448078.1|1576809_1577286_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.2e-22
>prophage 128
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1582355	1586658	2848798	capsid	Staphylococcus_phage(75.0%)	7	NA	NA
WP_001793526.1|1582355_1582553_+	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	50.0	9.9e-11
WP_001795785.1|1583239_1583464_+	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	72.5	5.0e-19
WP_001002340.1|1583757_1583964_+	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	59.7	1.3e-13
WP_001788716.1|1584663_1584774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000477492.1|1585892_1585997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956747.1|1586124_1586376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000899334.1|1586421_1586658_+|capsid	minor capsid protein	capsid	Q4ZE35	Staphylococcus_virus	70.6	2.3e-22
>prophage 129
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1591041	1595317	2848798		Anomala_cuprea_entomopoxvirus(50.0%)	6	NA	NA
WP_000593436.1|1591041_1591950_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	3.1e-22
WP_000603970.1|1591918_1592650_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000670307.1|1592653_1593745_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000202390.1|1593741_1594344_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001027143.1|1594456_1594645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000841351.1|1594783_1595317_+	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
>prophage 130
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1605454	1611110	2848798		Tupanvirus(25.0%)	7	NA	NA
WP_000082539.1|1605454_1606972_+	catalase	NA	A0A2K9L0T1	Tupanvirus	43.2	2.3e-91
WP_001265708.1|1607062_1607212_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001085655.1|1607665_1607935_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_042108939.1|1608091_1609069_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	99.4	4.0e-185
WP_001791425.1|1609065_1609170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380730.1|1609243_1610107_+	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	9.1e-16
WP_001208755.1|1610486_1611110_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	5.9e-17
>prophage 131
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1615260	1616382	2848798		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000691301.1|1615260_1616382_+	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.7	4.3e-10
>prophage 132
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1620051	1621698	2848798		Vibrio_phage(100.0%)	1	NA	NA
WP_001088978.1|1620051_1621698_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.4	2.5e-22
>prophage 133
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1627628	1632022	2848798		Bacillus_virus(50.0%)	2	NA	NA
WP_001557340.1|1627628_1629620_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	1.0e-115
WP_001289591.1|1629619_1632022_+	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.2	5.1e-93
>prophage 134
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1641680	1642943	2848798		Bacillus_phage(100.0%)	1	NA	NA
WP_000283016.1|1641680_1642943_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.3	2.6e-96
>prophage 135
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1647261	1649616	2848798		Acinetobacter_phage(100.0%)	3	NA	NA
WP_000604816.1|1647261_1647828_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	32.1	1.3e-23
WP_000173833.1|1647833_1648832_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.9	8.5e-34
WP_000153613.1|1648833_1649616_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	35.9	2.7e-27
>prophage 136
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1657714	1658416	2848798		Tupanvirus(100.0%)	1	NA	NA
WP_161081372.1|1657714_1658416_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.3	3.4e-13
>prophage 137
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1661830	1665284	2848798		Streptococcus_phage(50.0%)	3	NA	NA
WP_000077571.1|1661830_1663645_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.1	5.1e-154
WP_000974847.1|1663784_1664426_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000079447.1|1664432_1665284_-	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	8.9e-16
>prophage 138
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1670373	1671975	2848798		Klosneuvirus(100.0%)	1	NA	NA
WP_000942303.1|1670373_1671975_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 139
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1680021	1685052	2848798	lysis	Yellowstone_lake_phycodnavirus(33.33%)	7	NA	NA
WP_000216946.1|1680021_1681287_+	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.2	6.2e-13
WP_000876201.1|1681526_1681928_-	sarA expression modulator protein Msa	NA	NA	NA	NA	NA
WP_000809131.1|1682124_1682325_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_000269923.1|1682495_1682804_-	DUF1033 family protein	NA	NA	NA	NA	NA
WP_001215907.1|1682966_1683236_+	acylphosphatase	NA	NA	NA	NA	NA
WP_001788788.1|1683254_1683884_+|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_000138415.1|1683915_1685052_+	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	9.7e-34
>prophage 140
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1688592	1689384	2848798		Halovirus(100.0%)	1	NA	NA
WP_001185421.1|1688592_1689384_-	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 141
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1695547	1697559	2848798		Hokovirus(50.0%)	2	NA	NA
WP_000166801.1|1695547_1696903_-	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
WP_000192137.1|1696899_1697559_-	response regulator transcription factor ArlR	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
>prophage 142
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1700968	1710358	2848798		Staphylococcus_phage(60.0%)	13	NA	NA
WP_000342131.1|1700968_1702459_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.2	2.3e-22
WP_000801007.1|1702650_1702872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000473653.1|1702871_1703372_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000913317.1|1703383_1703812_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000159900.1|1703804_1704338_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000166063.1|1704423_1705263_-	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	76.5	1.5e-47
WP_000175746.1|1705277_1705757_-	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
WP_000934894.1|1705956_1706913_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
WP_000995287.1|1707336_1707774_-	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000404645.1|1707789_1708914_-	virulence factor C	NA	NA	NA	NA	NA
WP_000691942.1|1708951_1709203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031888515.1|1709214_1709409_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000282171.1|1709653_1710358_+	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.8	8.4e-12
>prophage 143
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1759167	1759845	2848798		Bacillus_phage(100.0%)	1	NA	NA
WP_001795446.1|1759167_1759845_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.9e-24
>prophage 144
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1763585	1771091	2848798	tRNA	Temperate_phage(25.0%)	5	NA	NA
WP_000362218.1|1763585_1764272_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	1.2e-07
WP_000858779.1|1764599_1765892_-|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	31.3	8.7e-55
WP_000525078.1|1766213_1768907_-	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
WP_000049921.1|1768930_1769902_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000361540.1|1769888_1771091_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	43.3	4.2e-35
>prophage 145
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1774463	1775039	2848798		Bacillus_virus(100.0%)	1	NA	NA
WP_000005212.1|1774463_1775039_-	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	2.1e-08
>prophage 146
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1780660	1784166	2848798		Anguillid_herpesvirus(33.33%)	5	NA	NA
WP_000442480.1|1780660_1781110_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_001817755.1|1781201_1782146_-	heptaprenyl diphosphate synthase subunit II	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000774684.1|1782162_1782888_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_000450555.1|1782890_1783463_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_001043863.1|1783893_1784166_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
>prophage 147
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1793590	1796269	2848798		Moumouvirus(50.0%)	3	NA	NA
WP_000902099.1|1793590_1794970_-	ATP-dependent DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	33.6	1.4e-55
WP_001163801.1|1794959_1795913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151997.1|1796020_1796269_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
>prophage 148
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1800697	1812307	2848798		Staphylococcus_phage(16.67%)	12	NA	NA
WP_001033761.1|1800697_1802860_-	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	100.0	2.7e-109
WP_001557355.1|1802852_1803779_-	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_000987774.1|1804022_1805774_-	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.2	2.2e-21
WP_000064078.1|1805754_1806480_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000159577.1|1806612_1807350_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000368656.1|1807342_1807885_-	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_000273371.1|1807877_1808609_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	21.8	7.9e-05
WP_001183429.1|1808700_1809207_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000447733.1|1809284_1810172_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
WP_000392691.1|1810220_1810670_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_000365240.1|1810774_1811317_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_001171335.1|1811398_1812307_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	32.0	4.4e-05
>prophage 149
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1815834	1817319	2848798		Cyanophage(100.0%)	1	NA	NA
WP_000105070.1|1815834_1817319_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 150
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1823744	1825151	2848798		Synechococcus_phage(100.0%)	1	NA	NA
WP_000193707.1|1823744_1825151_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 151
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1831977	1838548	2848798		Indivirus(66.67%)	6	NA	NA
WP_001291533.1|1831977_1833399_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	5.1e-40
WP_000942210.1|1833549_1835229_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001124985.1|1835244_1835697_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000183383.1|1836128_1837010_-	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.8	2.0e-10
WP_000159865.1|1836987_1837218_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_001286928.1|1837210_1838548_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
>prophage 152
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1846047	1848859	2848798		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_000202188.1|1846047_1847520_-	glycine dehydrogenase subunit 2	NA	E3SN07	Prochlorococcus_phage	41.3	2.8e-81
WP_063653170.1|1847512_1848859_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.2	1.7e-61
>prophage 153
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1854403	1855027	2848798		Streptococcus_phage(100.0%)	1	NA	NA
WP_001223008.1|1854403_1855027_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 154
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1861200	1874946	2848798	tRNA	Klosneuvirus(28.57%)	13	NA	NA
WP_000863556.1|1861200_1861800_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
WP_063653171.1|1862075_1862486_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_000564315.1|1862472_1863336_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001213908.1|1863377_1864163_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
WP_063653172.1|1864288_1865179_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	36.0	1.3e-25
WP_001062176.1|1865188_1866535_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	2.4e-55
WP_000683940.1|1866648_1867749_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_000624577.1|1867751_1868429_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_001283055.1|1868559_1869666_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_001217257.1|1869889_1871707_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.3	7.9e-54
WP_000411298.1|1871767_1872586_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_001797828.1|1872596_1873220_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001030080.1|1873554_1874946_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
>prophage 155
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1877999	1878947	2848798		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117767.1|1877999_1878947_-	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	6.4e-47
>prophage 156
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1885417	1888525	2848798		Catovirus(50.0%)	2	NA	NA
WP_001119021.1|1885417_1886557_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.8	1.2e-26
WP_000034716.1|1886692_1888525_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
>prophage 157
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1892018	1898182	2848798		Streptococcus_phage(33.33%)	5	NA	NA
WP_000368338.1|1892018_1893842_-	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
WP_001274017.1|1894187_1894439_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_001282563.1|1894483_1895458_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_000953309.1|1895514_1897662_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	1.6e-32
WP_000439693.1|1897720_1898182_-	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
>prophage 158
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1906968	1908189	2848798		Lactococcus_phage(100.0%)	1	NA	NA
WP_000542320.1|1906968_1908189_-	Fic family protein	NA	Q9AZ49	Lactococcus_phage	33.3	2.2e-52
>prophage 159
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1914861	1950472	2848798	tRNA	uncultured_Mediterranean_phage(18.75%)	30	NA	NA
WP_000648617.1|1914861_1915485_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
WP_000848304.1|1915484_1916753_-	U32 family peptidase	NA	Q6DW11	Phage_TP	31.7	4.0e-36
WP_000137774.1|1916764_1917688_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_000342258.1|1917690_1918329_-	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	3.2e-10
WP_000134779.1|1918613_1918922_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000939059.1|1918936_1919365_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000426912.1|1919368_1919629_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000734075.1|1919691_1922322_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
WP_001283312.1|1922664_1925142_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.0	1.1e-66
WP_000567017.1|1925143_1925812_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_000066097.1|1926506_1927625_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000409157.1|1927625_1928768_-	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	30.8	5.4e-32
WP_000985878.1|1929079_1930093_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000009238.1|1930329_1930476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000752909.1|1930515_1930698_-	CsbD family protein	NA	NA	NA	NA	NA
WP_000102729.1|1931303_1932578_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.7	1.4e-105
WP_000682646.1|1932738_1933512_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_001790559.1|1933511_1933640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000044799.1|1933972_1935739_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
WP_000590826.1|1935754_1937017_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_042109189.1|1937477_1938353_-	cell wall amidase	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
WP_000869983.1|1938349_1938802_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001058587.1|1938813_1941003_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000364542.1|1941430_1941949_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_164094432.1|1941987_1944243_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	8.0e-64
WP_000749795.1|1944445_1946725_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_001160682.1|1946999_1947260_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_001112045.1|1947278_1948418_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_063653175.1|1948440_1949466_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001005768.1|1949467_1950472_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
>prophage 160
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1959014	1959746	2848798		Streptococcus_phage(100.0%)	1	NA	NA
WP_001072201.1|1959014_1959746_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
>prophage 161
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1963077	1969725	2848798	tRNA,integrase	Clostridium_phage(50.0%)	5	1956532:1956548	1968738:1968754
1956532:1956548	attL	AATCTTGTTCTTTTAAA	NA	NA	NA	NA
WP_000868132.1|1963077_1964163_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	28.3	4.5e-12
WP_000692869.1|1964281_1964836_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000261115.1|1964832_1965540_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_063653176.1|1965810_1967082_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000425353.1|1967094_1969725_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.7	3.7e-153
1968738:1968754	attR	AATCTTGTTCTTTTAAA	NA	NA	NA	NA
>prophage 162
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1979292	1990445	2848798	tRNA,protease	Bacillus_virus(20.0%)	12	NA	NA
WP_000472302.1|1979292_1980555_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.0	5.0e-140
WP_000127573.1|1980705_1982007_-	trigger factor	NA	NA	NA	NA	NA
WP_001790560.1|1982054_1982165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280022.1|1982169_1983099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000032657.1|1983117_1983726_-	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	35.9	6.6e-21
WP_001138360.1|1983867_1984224_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001125540.1|1984270_1984471_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001791162.1|1984499_1985027_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	4.1e-11
WP_000049145.1|1985255_1986749_-	amino acid permease	NA	NA	NA	NA	NA
WP_000435143.1|1987174_1989112_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.8	5.0e-115
WP_001790562.1|1989309_1989432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000808621.1|1989524_1990445_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
>prophage 163
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	1994360	2002524	2848798		Bacillus_virus(25.0%)	5	NA	NA
WP_001114454.1|1994360_1995233_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.1	2.6e-42
WP_001038317.1|1995248_1997879_-	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	33.0	6.1e-47
WP_000849428.1|1998172_1999660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015445861.1|2000158_2001820_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.4	5.8e-35
WP_000080028.1|2001819_2002524_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
>prophage 164
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2007408	2009166	2848798		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001232648.1|2007408_2009166_-	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	2.6e-41
>prophage 165
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2014099	2017297	2848798		Streptomyces_phage(100.0%)	1	NA	NA
WP_000226919.1|2014099_2017297_-	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.5	4.2e-135
>prophage 166
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2036409	2040542	2848798		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_000174284.1|2036409_2037153_-	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	30.4	1.7e-18
WP_000553924.1|2037232_2037679_+	OsmC family protein	NA	NA	NA	NA	NA
WP_000291420.1|2037793_2038951_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_042109270.1|2038937_2040542_+	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	99.5	1.7e-113
>prophage 167
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2044311	2046942	2848798	tRNA,protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001279338.1|2044311_2045586_+|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
WP_000186029.1|2045679_2046942_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
>prophage 168
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2063992	2069320	2848798		Mycobacterium_phage(50.0%)	3	NA	NA
WP_000118314.1|2063992_2067817_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.6e-83
WP_001048368.1|2067837_2068434_-	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_001091387.1|2068462_2069320_-	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
>prophage 169
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2072707	2146466	2848798	tRNA,protease	Staphylococcus_phage(95.65%)	66	NA	NA
WP_001266161.1|2072707_2073352_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_000434765.1|2073366_2074158_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_000411084.1|2074707_2075556_-	D-amino-acid transaminase	NA	NA	NA	NA	NA
WP_063653182.1|2075559_2076969_-	Mn(2+)-dependent dipeptidase Sapep	NA	NA	NA	NA	NA
WP_001051856.1|2077526_2077949_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_001217125.1|2077965_2078661_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000004335.1|2078657_2080319_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_000285020.1|2080725_2081994_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	9.1e-57
WP_000836461.1|2088995_2089307_-	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	99.0	4.8e-52
WP_001108730.1|2089328_2091743_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.5	0.0e+00
WP_001025067.1|2092033_2093215_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	7.3e-218
WP_000526539.1|2093324_2094278_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
WP_000764419.1|2094274_2094838_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	99.5	8.3e-103
WP_000757543.1|2094960_2095362_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000266096.1|2095932_2096760_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001790712.1|2096762_2096882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001196362.1|2096992_2097994_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.4	2.6e-184
WP_001008549.1|2098115_2098580_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	100.0	4.5e-70
WP_001159037.1|2098592_2099774_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	99.5	5.6e-226
WP_000493887.1|2099784_2100417_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	98.6	5.5e-111
WP_000384185.1|2100423_2101455_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.8	4.0e-196
WP_001261668.1|2101947_2103450_-	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	1.9e-29
WP_000221177.1|2103972_2104287_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	98.1	9.8e-53
WP_000989121.1|2104286_2105579_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	99.5	5.0e-228
WP_161081379.1|2105665_2106520_-	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.1	2.9e-38
WP_000384171.1|2106794_2107019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000671057.1|2107217_2107688_+	RNA polymerase sigma factor	NA	A0A2H4PQT5	Staphylococcus_phage	98.1	8.8e-82
WP_001153742.1|2107800_2108244_+	competence protein ComK	NA	NA	NA	NA	NA
WP_001030469.1|2108230_2108674_-	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	98.6	2.4e-57
WP_001168903.1|2108969_2109605_+|protease	CPBP family intramembrane metalloprotease SdpA	protease	NA	NA	NA	NA
WP_001096495.1|2110044_2110758_-	transaldolase	NA	M1PR54	Cyanophage	35.3	9.4e-19
WP_000091442.1|2111017_2111320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001200542.1|2111575_2111941_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
WP_000623470.1|2111937_2112291_+	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	94.0	3.8e-21
WP_000453306.1|2114287_2115121_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.3	7.8e-158
WP_000366163.1|2115332_2116241_-	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	100.0	3.4e-138
WP_000933820.1|2116362_2117559_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
WP_000109906.1|2117930_2119523_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	100.0	0.0e+00
WP_001822900.1|2119900_2120647_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	98.8	1.4e-142
WP_000672013.1|2120651_2121125_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.7	7.2e-84
WP_000718107.1|2121190_2121448_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000778528.1|2121444_2122446_-	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.3	5.3e-185
WP_000348364.1|2122450_2123929_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.6	2.8e-283
WP_012840523.1|2124087_2124543_-	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	99.3	3.6e-80
WP_001795210.1|2124845_2125496_+	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	94.0	2.9e-51
WP_000669024.1|2126645_2127272_+	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	79.8	3.1e-74
WP_000627540.1|2127312_2127654_+	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	1.1e-54
WP_000414216.1|2127754_2128327_+	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	93.1	2.3e-23
WP_001801861.1|2129681_2129777_+	type I toxin-antitoxin system Fst family toxin PepA1	NA	NA	NA	NA	NA
WP_001792025.1|2129899_2130001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000072627.1|2131076_2132306_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	64.7	4.0e-134
WP_001793440.1|2132298_2134038_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	100.0	2.4e-289
WP_001791797.1|2134018_2134153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038752.1|2134215_2134935_-|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	99.6	1.9e-131
WP_011447030.1|2135036_2135144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038704.1|2135092_2135812_-|protease	serine protease SplD	protease	A0A2H4PQP9	Staphylococcus_phage	99.6	4.6e-130
WP_001038872.1|2135932_2136652_-|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	98.7	1.3e-129
WP_001039454.1|2136709_2137432_-|protease	serine protease SplB	protease	A0A2H4PQN0	Staphylococcus_phage	98.3	3.5e-130
WP_001039427.1|2137556_2138264_-|protease	serine protease SplA	protease	A0A2H4PQN3	Staphylococcus_phage	97.0	7.9e-127
WP_001092780.1|2139226_2139808_+	DUF4888 domain-containing protein	NA	A0A2H4PQH6	Staphylococcus_phage	64.8	9.6e-54
WP_000469591.1|2140280_2140499_-	hypothetical protein	NA	A0A2H4PQH0	Staphylococcus_phage	80.6	2.0e-25
WP_000550252.1|2140754_2141228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543854.1|2141232_2142024_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000782463.1|2142393_2143377_-	bi-component leukocidin LukED subunit D	NA	A0A2H4PQH7	Staphylococcus_phage	99.4	1.8e-185
WP_000473596.1|2143378_2144314_-	beta-channel forming cytolysin	NA	A0A2H4PQI5	Staphylococcus_phage	100.0	1.4e-174
WP_000206343.1|2145677_2146466_+	DUF1828 domain-containing protein	NA	A0A2H4PQI0	Staphylococcus_phage	98.5	3.6e-144
>prophage 170
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2150513	2154778	2848798		Staphylococcus_phage(100.0%)	4	NA	NA
WP_001236362.1|2150513_2151269_-	staphylococcal enterotoxin type N	NA	A0A075M4C7	Staphylococcus_phage	41.4	6.0e-40
WP_000713847.1|2152232_2152961_-	staphylococcal enterotoxin type I	NA	A0A1X9H080	Staphylococcus_phage	39.2	1.1e-27
WP_000821658.1|2152995_2153715_-	staphylococcal enterotoxin type M	NA	A0A1X9H080	Staphylococcus_phage	35.8	2.3e-25
WP_010922839.1|2153995_2154778_-	staphylococcal enterotoxin type O	NA	A0A1X9H080	Staphylococcus_phage	36.7	1.1e-31
>prophage 171
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2162562	2163303	2848798		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000216874.1|2162562_2163303_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
>prophage 172
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2172933	2173278	2848798		Streptococcus_phage(100.0%)	1	NA	NA
WP_000290301.1|2172933_2173278_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
>prophage 173
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2183875	2184604	2848798		Planktothrix_phage(100.0%)	1	NA	NA
WP_001144055.1|2183875_2184604_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
>prophage 174
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2202669	2204406	2848798		Bacillus_phage(100.0%)	1	NA	NA
WP_000597238.1|2202669_2204406_-	SAV1866 family putative multidrug efflux ABC transporter	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
>prophage 175
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2219886	2220516	2848798		Bacillus_phage(100.0%)	1	NA	NA
WP_000153535.1|2219886_2220516_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 176
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2225570	2225984	2848798		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001557448.1|2225570_2225984_-	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	38.3	6.7e-17
>prophage 177
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2229436	2350596	2848798	tRNA,terminase,integrase,coat,tail,protease,capsid,portal,holin,head	Staphylococcus_phage(83.33%)	143	2234616:2234638	2356961:2356983
WP_000613738.1|2229436_2229991_+	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
WP_000140172.1|2230058_2231129_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000548781.1|2231375_2231906_-	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_001147865.1|2232075_2233437_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	43.6	1.4e-103
WP_001231451.1|2233517_2234465_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.2e-16
2234616:2234638	attL	TTGGGGCCCCACCCCAACTTGCA	NA	NA	NA	NA
WP_001789566.1|2234990_2235137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545370.1|2235176_2236604_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_000027919.1|2236616_2238074_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_000170162.1|2238075_2238378_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_000957020.1|2238744_2240283_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000831700.1|2240371_2241571_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_000774556.1|2241583_2243587_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.2	1.2e-114
WP_000992924.1|2243590_2245783_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_000272056.1|2245779_2246472_-	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_001165363.1|2246643_2246946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000572878.1|2247054_2248350_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_000827746.1|2249209_2250376_+|protease	cysteine protease staphopain A	protease	NA	NA	NA	NA
WP_000434933.1|2250406_2250733_+	staphostatin A	NA	NA	NA	NA	NA
WP_000669862.1|2251024_2251198_-	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_000011542.1|2251178_2251781_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_000040866.1|2252051_2252873_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
WP_000284436.1|2252865_2254335_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.1	5.9e-108
WP_000897635.1|2254518_2255595_+	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
WP_001177828.1|2255614_2256409_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_001802312.1|2256480_2256588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323161.1|2256598_2258161_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_000275727.1|2258365_2259463_-	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	3.3e-47
WP_000149686.1|2259831_2260392_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_001140871.1|2260444_2261374_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_001792184.1|2261566_2261740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001021210.1|2261791_2263171_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000181315.1|2263290_2264319_-	lactonase family protein	NA	NA	NA	NA	NA
WP_000205106.1|2264588_2264990_+	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
WP_000267034.1|2265562_2265736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001188043.1|2266186_2267227_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_000713072.1|2267283_2268126_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_001033971.1|2268122_2268680_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_000966288.1|2268739_2269264_-	membrane protein	NA	NA	NA	NA	NA
WP_000182842.1|2269384_2269948_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001221651.1|2270013_2270754_-	phenol-soluble modulin export ABC transporter permease subunit PmtD	NA	NA	NA	NA	NA
WP_000763043.1|2270753_2271626_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	36.0	1.0e-27
WP_000645727.1|2271622_2272303_-	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000991306.1|2272303_2273200_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	5.0e-17
WP_000691584.1|2273196_2273577_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000681968.1|2273834_2274011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000990056.1|2274253_2274352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068542.1|2274551_2275838_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000671712.1|2276116_2276407_-	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_001558588.1|2276417_2277851_-	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000669789.1|2278808_2278988_+	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
WP_001791826.1|2279298_2279559_+	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_000702262.1|2279611_2279962_-	complement inhibitor SCIN-A	NA	A7TWS0	Staphylococcus_phage	100.0	7.5e-54
WP_096784214.1|2280471_2280930_-	amidase	NA	R9QTN8	Staphylococcus_phage	98.7	2.4e-84
WP_000920041.1|2281459_2281951_-	staphylokinase	NA	A7TWR8	Staphylococcus_phage	100.0	8.0e-86
WP_000861038.1|2282141_2282897_-	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
WP_000611512.1|2282908_2283163_-|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_072482930.1|2283374_2283551_-|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	96.6	3.8e-22
WP_000750412.1|2283658_2284432_-	staphylococcal enterotoxin type A	NA	A0A1X9H080	Staphylococcus_phage	100.0	1.1e-145
WP_000340977.1|2284804_2285179_-	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
WP_001262621.1|2285234_2285522_-	hypothetical protein	NA	A0A1X9H0N7	Staphylococcus_phage	100.0	7.6e-44
WP_001000058.1|2285567_2285720_-	hypothetical protein	NA	A0A1W6JPL6	Staphylococcus_phage	100.0	7.6e-19
WP_000582173.1|2285712_2289495_-	hypothetical protein	NA	A0A1X9H096	Staphylococcus_phage	99.7	0.0e+00
WP_000567408.1|2289510_2290995_-|tail	phage tail protein	tail	A0A2I6PDJ0	Staphylococcus_phage	100.0	1.2e-297
WP_001795393.1|2290991_2295521_-|tail	phage tail tape measure protein	tail	A0A1X9H084	Staphylococcus_phage	100.0	0.0e+00
WP_001096355.1|2295765_2296116_-	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
WP_072050172.1|2296165_2296390_-	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	98.6	8.8e-32
WP_000268741.1|2296431_2297076_-|tail	phage tail protein	tail	W5R9H4	Staphylococcus_phage	100.0	6.5e-120
WP_000565498.1|2297076_2297484_-	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
WP_000114225.1|2297480_2297885_-	hypothetical protein	NA	A0A2I6PDJ6	Staphylococcus_phage	100.0	4.3e-69
WP_000755147.1|2297881_2298244_-|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	99.2	8.3e-64
WP_000150936.1|2298227_2298512_-|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000238236.1|2298501_2298786_-	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
WP_000154555.1|2298805_2299951_-|capsid	phage major capsid protein	capsid	A0A1X9H072	Staphylococcus_phage	100.0	5.6e-215
WP_000861914.1|2299974_2300712_-|protease	Clp protease ClpP	protease	C8CH20	Staphylococcus_phage	100.0	2.3e-129
WP_000025274.1|2300695_2301883_-|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
WP_000625088.1|2301898_2303560_-|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
WP_000402904.1|2303556_2303901_-	hypothetical protein	NA	G4KNP9	Staphylococcus_phage	100.0	9.4e-57
WP_000988336.1|2304030_2304330_-	HNH endonuclease	NA	A0EWY8	Staphylococcus_phage	100.0	4.6e-52
WP_000590126.1|2304561_2304978_-	hypothetical protein	NA	A0A1X9H0U8	Staphylococcus_phage	100.0	2.9e-76
WP_000265039.1|2305005_2305206_-	DUF1514 family protein	NA	R9QT57	Staphylococcus_phage	98.5	1.4e-28
WP_000595265.1|2305205_2305355_-	transcriptional activator RinB	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
WP_000195820.1|2305351_2305558_-	DUF1381 domain-containing protein	NA	A0A1X9H0C2	Staphylococcus_phage	100.0	1.3e-21
WP_001066444.1|2305594_2306131_-	hypothetical protein	NA	A0A1X9H0S5	Staphylococcus_phage	100.0	1.4e-96
WP_138273640.1|2306123_2306534_-	acetyltransferase	NA	C8CH13	Staphylococcus_phage	99.3	6.7e-70
WP_001105598.1|2306530_2307040_-	hypothetical protein	NA	A0A1X9H0D4	Staphylococcus_phage	100.0	3.2e-93
WP_000982711.1|2307036_2307486_-	hypothetical protein	NA	A0A2I6PDH2	Staphylococcus_phage	99.3	2.1e-80
WP_000131366.1|2307550_2307793_-	hypothetical protein	NA	A0EWX8	Staphylococcus_phage	100.0	3.9e-41
WP_000101274.1|2307796_2308165_-	hypothetical protein	NA	W5RAK8	Staphylococcus_phage	100.0	8.2e-51
WP_000401964.1|2308177_2308582_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0E3XBN4	Staphylococcus_phage	100.0	1.4e-72
WP_000338528.1|2308590_2308809_-	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	100.0	1.4e-37
WP_000148301.1|2308815_2309700_-	DnaD domain protein	NA	S4V6D4	Staphylococcus_phage	95.9	3.1e-136
WP_000934770.1|2309729_2310200_-	single-stranded DNA-binding protein	NA	A0A0E3T9H6	Staphylococcus_phage	99.4	4.8e-80
WP_071621397.1|2310200_2310818_-	MBL fold metallo-hydrolase	NA	S4SWA4	Staphylococcus_phage	100.0	9.1e-87
WP_000138481.1|2310898_2311819_-	recombinase	NA	A0A1V0E5D7	Staphylococcus_phage	100.0	1.0e-166
WP_000700547.1|2311820_2313764_-	AAA family ATPase	NA	A0A2I6PDH3	Staphylococcus_phage	98.9	0.0e+00
WP_001205732.1|2313772_2314036_-	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_000291489.1|2314044_2314305_-	DUF1108 family protein	NA	A0A1W6JQ03	Staphylococcus_phage	100.0	7.6e-43
WP_000066020.1|2314397_2314559_-	DUF1270 domain-containing protein	NA	A0A2I6PDF7	Staphylococcus_phage	100.0	1.9e-20
WP_001120197.1|2314555_2314876_-	DUF771 domain-containing protein	NA	A0A2I6PDH6	Staphylococcus_phage	100.0	1.5e-56
WP_000275058.1|2314934_2315567_+	hypothetical protein	NA	A7TW95	Staphylococcus_phage	100.0	1.5e-113
WP_000939496.1|2315581_2315722_-	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	100.0	1.9e-16
WP_000388066.1|2315752_2315947_-	hypothetical protein	NA	A0A1X9H0A2	Staphylococcus_phage	100.0	1.5e-19
WP_001148618.1|2315963_2316716_-	oxidoreductase	NA	A0A1X9H0A0	Staphylococcus_phage	100.0	8.7e-140
WP_000351243.1|2316772_2317312_+	hypothetical protein	NA	A7TW92	Staphylococcus_phage	100.0	1.7e-97
WP_000435341.1|2317335_2317596_-	transcriptional regulator	NA	A7TW91	Staphylococcus_phage	100.0	2.7e-40
WP_000548578.1|2317608_2317848_-	helix-turn-helix transcriptional regulator	NA	G4KNM9	Staphylococcus_phage	100.0	2.3e-38
WP_000094093.1|2318018_2318726_+	helix-turn-helix transcriptional regulator	NA	G4KNM8	Staphylococcus_phage	100.0	7.7e-130
WP_001089804.1|2318879_2319065_+	hypothetical protein	NA	A0A2I6PDS4	Staphylococcus_phage	100.0	2.3e-25
WP_000705238.1|2319264_2319432_+	hypothetical protein	NA	Q4ZDJ4	Staphylococcus_virus	100.0	1.7e-24
WP_000391618.1|2319571_2320111_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	U5U4R0	Staphylococcus_phage	33.1	9.0e-14
WP_000857198.1|2320283_2321321_+|integrase	site-specific integrase	integrase	A0A1X9H022	Staphylococcus_phage	100.0	2.6e-179
WP_000595392.1|2322439_2323456_-	bi-component leukocidin LukGH subunit G	NA	A0A1X9IGW5	Staphylococcus_phage	30.2	6.7e-26
WP_000791411.1|2323477_2324533_-	bi-component leukocidin LukGH subunit H	NA	A0A1X9IGW5	Staphylococcus_phage	34.3	2.8e-35
WP_000206625.1|2324968_2326192_+	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_001045079.1|2326635_2327943_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_000746599.1|2328959_2329682_+	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	34.9	2.1e-26
WP_000278088.1|2329850_2330651_-	staphylococcal enterotoxin type C3	NA	A0A097PAT7	Streptococcus_pyogenes_phage	47.5	6.1e-51
WP_001035616.1|2331438_2331999_+	DUF4888 domain-containing protein	NA	Q4ZBG8	Staphylococcus_virus	68.1	5.4e-62
WP_164094433.1|2332893_2333580_+	toxic shock syndrome toxin TSST-1	NA	NA	NA	NA	NA
WP_063653148.1|2333734_2334304_-|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	98.4	1.6e-101
WP_000358774.1|2334300_2334642_-	hypothetical protein	NA	A0A1W6JQM3	Staphylococcus_phage	99.1	1.4e-57
WP_000771368.1|2334644_2335172_-|coat	spore coat protein	coat	A0A1W6JQH7	Staphylococcus_phage	97.1	3.5e-87
WP_000448770.1|2335222_2335441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000846280.1|2335458_2336037_-	hypothetical protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.9	4.8e-29
WP_001190615.1|2336048_2336390_-	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	99.1	1.4e-57
WP_001019810.1|2336839_2337481_-	hypothetical protein	NA	Q4ZE67	Staphylococcus_phage	87.8	2.3e-104
WP_000998179.1|2337477_2337762_-	hypothetical protein	NA	A0A1W6JQE4	Staphylococcus_phage	100.0	1.2e-49
WP_001039169.1|2337763_2338126_-	hypothetical protein	NA	A0A1W6JQD5	Staphylococcus_phage	98.3	5.8e-65
WP_001668899.1|2338411_2339881_-	hypothetical protein	NA	A0A1W6JQD6	Staphylococcus_phage	99.6	3.4e-289
WP_001002695.1|2339897_2340767_-	hypothetical protein	NA	A0A1W6JQL5	Staphylococcus_phage	96.9	3.2e-162
WP_001103933.1|2340833_2341151_-	DUF1474 family protein	NA	Q4ZE75	Staphylococcus_phage	48.1	1.2e-18
WP_001058487.1|2341153_2341363_-	hypothetical protein	NA	Q4ZE76	Staphylococcus_phage	92.8	2.2e-29
WP_000784893.1|2341355_2341502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000164237.1|2341498_2341726_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001060953.1|2341761_2341968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072474260.1|2342125_2342773_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000121223.1|2342778_2343885_+|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	44.2	5.9e-76
WP_001085183.1|2344446_2344911_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	98.7	1.6e-80
WP_001050048.1|2344932_2347305_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.8	4.3e-92
WP_001165959.1|2347338_2348079_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_000556760.1|2348194_2348428_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000785252.1|2348494_2348953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121760.1|2349291_2350596_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
2356961:2356983	attR	TGCAAGTTGGGGTGGGGCCCCAA	NA	NA	NA	NA
>prophage 178
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2359990	2365979	2848798		Streptococcus_phage(40.0%)	5	NA	NA
WP_001049165.1|2359990_2360578_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
WP_000006551.1|2361140_2362085_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_001248939.1|2362195_2363191_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
WP_000369722.1|2363187_2364099_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_000134963.1|2365043_2365979_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	2.9e-84
>prophage 179
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2370426	2373273	2848798		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000662676.1|2370426_2373273_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.1	0.0e+00
>prophage 180
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2383507	2386605	2848798		Streptococcus_phage(100.0%)	3	NA	NA
WP_001557172.1|2383507_2384590_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.2	9.9e-44
WP_000686344.1|2384953_2385820_-	DegV family protein	NA	NA	NA	NA	NA
WP_000192949.1|2385963_2386605_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	47.7	5.3e-37
>prophage 181
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2398490	2421907	2848798		uncultured_Caudovirales_phage(35.71%)	19	NA	NA
WP_000616840.1|2398490_2399252_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	6.5e-18
WP_001245577.1|2399248_2400205_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
WP_000876318.1|2400191_2401163_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.9	4.3e-139
WP_000499195.1|2401201_2401357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562498.1|2401537_2402509_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000855514.1|2402626_2404732_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000692521.1|2404694_2405093_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_001068501.1|2405893_2406760_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000930014.1|2406779_2407280_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
WP_000193751.1|2407620_2409126_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_031760357.1|2409203_2409305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429006.1|2409395_2410313_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	2.1e-07
WP_000197262.1|2411135_2411678_-	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_000663030.1|2412016_2413075_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.7	7.9e-22
WP_000180991.1|2413314_2414829_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_000589248.1|2414821_2415799_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	7.1e-25
WP_000983677.1|2416020_2417802_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
WP_000525106.1|2417813_2419697_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.6	2.0e-55
WP_000098285.1|2419966_2421907_-	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 182
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2425046	2434893	2848798		Pandoravirus(12.5%)	12	NA	NA
WP_001217796.1|2425046_2426198_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	35.7	6.0e-23
WP_000604514.1|2426181_2426775_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	4.4e-38
WP_000446724.1|2427125_2427794_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000941336.1|2427795_2428215_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_001062972.1|2428218_2428932_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_000604990.1|2429030_2429615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093562.1|2429894_2430335_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001037807.1|2430677_2431151_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000149344.1|2431125_2431812_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000244415.1|2431811_2432867_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
WP_000702778.1|2432938_2433922_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	43.3	1.1e-62
WP_000931238.1|2434053_2434893_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.5	9.6e-55
>prophage 183
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2446504	2447878	2848798		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000952038.1|2446504_2447878_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	33.6	2.3e-45
>prophage 184
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2452855	2459135	2848798		Bacillus_phage(33.33%)	6	NA	NA
WP_000857598.1|2452855_2454529_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	23.2	3.4e-11
WP_000737160.1|2454525_2456157_-	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	27.8	6.7e-12
WP_000469894.1|2456375_2457251_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000358498.1|2457422_2458106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148826.1|2458108_2458567_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_000820897.1|2458568_2459135_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	4.7e-21
>prophage 185
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2465925	2466399	2848798		Pandoravirus(100.0%)	1	NA	NA
WP_000833486.1|2465925_2466399_-	cupin	NA	A0A291AU44	Pandoravirus	39.4	1.6e-14
>prophage 186
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2471661	2472459	2848798		Bacillus_phage(100.0%)	1	NA	NA
WP_000731644.1|2471661_2472459_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A223LD43	Bacillus_phage	30.2	1.2e-06
>prophage 187
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2477288	2478050	2848798		Planktothrix_phage(100.0%)	1	NA	NA
WP_000985996.1|2477288_2478050_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	7.2e-33
>prophage 188
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2482424	2483468	2848798		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001030772.1|2482424_2483468_-	alpha/beta hydrolase	NA	A0A0G2YDK2	Acanthamoeba_polyphaga_mimivirus	26.6	2.0e-17
>prophage 189
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2489991	2490789	2848798		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|2489991_2490789_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 190
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2494014	2497973	2848798		Bacillus_phage(33.33%)	3	NA	NA
WP_000817954.1|2494014_2495742_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
WP_000793067.1|2496162_2497458_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
WP_000832260.1|2497574_2497973_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 191
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2504907	2505651	2848798		Indivirus(100.0%)	1	NA	NA
WP_000894464.1|2504907_2505651_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	1.2e-11
>prophage 192
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2518188	2518749	2848798	integrase	Streptococcus_phage(100.0%)	1	2512343:2512357	2522339:2522353
2512343:2512357	attL	TTTTGATACCATTTC	NA	NA	NA	NA
WP_001044915.1|2518188_2518749_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	5.7e-19
WP_001044915.1|2518188_2518749_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	5.7e-19
2522339:2522353	attR	TTTTGATACCATTTC	NA	NA	NA	NA
>prophage 193
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2531577	2534931	2848798		Tupanvirus(50.0%)	3	NA	NA
WP_001200747.1|2531577_2532588_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.6	1.9e-33
WP_001792725.1|2533086_2533608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180234.1|2533635_2534931_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	1.2e-24
>prophage 194
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2542503	2543826	2848798		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_111739821.1|2542503_2543826_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.8	2.0e-107
>prophage 195
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2555130	2555787	2848798		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455256.1|2555130_2555787_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	1.1e-45
>prophage 196
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2559428	2562749	2848798		Staphylococcus_phage(50.0%)	2	NA	NA
WP_001100835.1|2559428_2560805_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.5	3.9e-21
WP_000347061.1|2561348_2562749_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.8	9.4e-55
>prophage 197
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2586162	2586825	2848798		Enterococcus_phage(100.0%)	1	NA	NA
WP_001067261.1|2586162_2586825_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.4e-24
>prophage 198
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2593408	2594596	2848798		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000250823.1|2593408_2594596_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	4.4e-45
>prophage 199
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2597624	2608578	2848798		Streptococcus_phage(33.33%)	6	NA	NA
WP_000090315.1|2597624_2599706_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
WP_001137495.1|2599828_2600299_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142337.1|2600364_2600778_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000031892.1|2600875_2601130_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_001788197.1|2601266_2604863_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	3.3e-67
WP_000918667.1|2605026_2608578_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.3	2.1e-50
>prophage 200
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2612259	2617042	2848798	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001288302.1|2612259_2612808_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
WP_001074473.1|2612820_2613003_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001788193.1|2613058_2613202_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000872882.1|2613316_2613886_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000664737.1|2613966_2614491_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000390332.1|2614490_2615237_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000370182.1|2615244_2615649_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_000631969.1|2615641_2617042_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.8	1.2e-54
>prophage 201
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2623053	2625510	2848798	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_000897132.1|2623053_2625510_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 202
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2639137	2649408	2848798	tRNA	Catovirus(16.67%)	10	NA	NA
WP_001288202.1|2639137_2640625_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
WP_001790128.1|2640677_2640770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613722.1|2641163_2641640_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001154302.1|2641636_2642002_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000167944.1|2641979_2642783_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.0	3.0e-21
WP_000057594.1|2642998_2643931_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_000148598.1|2644109_2644991_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_063653135.1|2645218_2647312_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	3.1e-110
WP_000551283.1|2647568_2648108_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_001176709.1|2648112_2649408_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.5	4.8e-13
>prophage 203
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2658664	2661129	2848798		Hokovirus(50.0%)	2	NA	NA
WP_000933774.1|2658664_2659630_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
WP_001252543.1|2659776_2661129_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	30.4	8.3e-24
>prophage 204
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2667033	2670131	2848798	tRNA	Klosneuvirus(50.0%)	2	NA	NA
WP_001051129.1|2667033_2669007_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.2	1.5e-93
WP_000279926.1|2669291_2670131_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 205
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2674037	2674655	2848798		Streptococcus_phage(100.0%)	1	NA	NA
WP_001272126.1|2674037_2674655_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 206
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2683792	2685490	2848798		Streptococcus_virus(100.0%)	1	NA	NA
WP_001109040.1|2683792_2685490_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	1.9e-54
>prophage 207
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2702138	2708376	2848798		Lactobacillus_phage(33.33%)	6	NA	NA
WP_029644453.1|2702138_2703128_-	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	41.2	1.6e-24
WP_000825530.1|2703473_2704316_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_000467994.1|2704352_2705012_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569281.1|2705015_2706041_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	3.7e-32
WP_001036648.1|2706335_2707478_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	NA	NA	NA	NA
WP_000634098.1|2707470_2708376_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.7	3.8e-49
>prophage 208
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2734321	2737082	2848798		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000072584.1|2734321_2735533_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.2	2.2e-44
WP_000028663.1|2735525_2737082_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	99.2	1.2e-287
>prophage 209
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2749619	2755067	2848798	transposase	Paenibacillus_phage(25.0%)	5	NA	NA
WP_000159787.1|2749619_2749892_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	50.6	1.3e-13
WP_000041880.1|2750290_2750995_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	U5U4R0	Staphylococcus_phage	37.1	5.8e-29
WP_001826985.1|2751445_2751922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424963.1|2752034_2753576_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000264071.1|2753600_2755067_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 210
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2765547	2767071	2848798		Enterococcus_phage(100.0%)	1	NA	NA
WP_000930514.1|2765547_2767071_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.6	1.4e-40
>prophage 211
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2775385	2781714	2848798		Staphylococcus_phage(50.0%)	8	NA	NA
WP_000934799.1|2775385_2775889_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
WP_001261460.1|2775909_2776206_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001052484.1|2776449_2776641_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	1.1e-22
WP_001218732.1|2776726_2777824_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000157348.1|2777835_2778039_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_000373073.1|2778068_2778950_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001557587.1|2779103_2779949_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
WP_000655692.1|2780610_2781714_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	28.0	3.9e-11
>prophage 212
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2791652	2792495	2848798		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209551.1|2791652_2792495_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	3.8e-11
>prophage 213
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2813799	2816534	2848798		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_164094435.1|2813799_2814822_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	30.4	6.7e-10
WP_001191954.1|2814799_2815744_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_000449069.1|2815733_2816534_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	43.4	5.8e-41
>prophage 214
NZ_CP048643	Staphylococcus aureus strain SR153 chromosome, complete genome	2848798	2821223	2847728	2848798	terminase,tail,protease,capsid,portal,holin,plate,head	Staphylococcus_phage(100.0%)	28	NA	NA
WP_094314235.1|2821223_2822678_-	CHAP domain-containing protein	NA	A0A0N6WMR3	Staphylococcus_phage	98.6	2.0e-286
WP_000339146.1|2822689_2822992_-|holin	phage holin	holin	A0A2I6PET6	Staphylococcus_phage	100.0	7.0e-48
WP_000466784.1|2823126_2823426_-	DUF2951 domain-containing protein	NA	A0A2I6PER2	Staphylococcus_phage	100.0	2.0e-31
WP_000916020.1|2823471_2823636_-	XkdX family protein	NA	A0A2I6PES4	Staphylococcus_phage	100.0	4.9e-24
WP_001166599.1|2823628_2824018_-	DUF2977 domain-containing protein	NA	A0A2I6PER1	Staphylococcus_phage	100.0	2.2e-62
WP_000067132.1|2824017_2825484_-|plate	BppU family phage baseplate upper protein	plate	B5WZQ8	Staphylococcus_phage	100.0	7.6e-257
WP_089519209.1|2825483_2827394_-	hypothetical protein	NA	A0A2I6PEQ9	Staphylococcus_phage	99.8	0.0e+00
WP_000179858.1|2827409_2827700_-	hypothetical protein	NA	U5U457	Staphylococcus_phage	100.0	2.1e-49
WP_161081390.1|2827699_2829283_-	peptidase	NA	A0A2I6PEQ5	Staphylococcus_phage	99.8	6.0e-308
WP_161081391.1|2829291_2830116_-|tail	phage tail family protein	tail	A0A2I6PER3	Staphylococcus_phage	99.6	2.0e-158
WP_000438833.1|2836328_2836487_-	hypothetical protein	NA	A0A2I6PES8	Staphylococcus_phage	100.0	1.2e-19
WP_000589167.1|2836528_2836879_-	hypothetical protein	NA	A0A2I6PEQ2	Staphylococcus_phage	100.0	1.1e-55
WP_000169127.1|2836936_2837392_-	Ig domain-containing protein	NA	A0A2I6PER6	Staphylococcus_phage	100.0	5.7e-78
WP_000807536.1|2837483_2838125_-|tail	tail protein	tail	A0A2I6PEP6	Staphylococcus_phage	100.0	5.9e-121
WP_001023806.1|2838159_2838555_-	DUF3168 domain-containing protein	NA	A0A2I6PEQ4	Staphylococcus_phage	100.0	8.8e-67
WP_000110023.1|2838555_2838957_-	hypothetical protein	NA	A0A2I6PF54	Staphylococcus_phage	100.0	8.1e-68
WP_000395498.1|2838953_2839286_-	hypothetical protein	NA	A0A2I6PES3	Staphylococcus_phage	100.0	4.1e-57
WP_000050973.1|2839297_2839576_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I6PEQ1	Staphylococcus_phage	100.0	2.1e-46
WP_001142734.1|2839644_2840808_-|capsid	phage major capsid protein	capsid	A0A2I6PEQ3	Staphylococcus_phage	100.0	1.2e-217
WP_000061866.1|2840819_2841593_-|protease	Clp protease ClpP	protease	A0A2I6PEQ7	Staphylococcus_phage	100.0	2.4e-137
WP_001100669.1|2841576_2842815_-|portal	phage portal protein	portal	A0A2K9VBP0	Staphylococcus_phage	100.0	6.9e-235
WP_000152858.1|2842819_2844511_-|terminase	terminase large subunit	terminase	A0A2K9VBQ1	Staphylococcus_phage	100.0	0.0e+00
WP_000778935.1|2844500_2844806_-|terminase	P27 family phage terminase small subunit	terminase	U5U414	Staphylococcus_phage	100.0	2.9e-49
WP_000596031.1|2844930_2845251_-	HNH endonuclease	NA	A0A2K9VBV6	Staphylococcus_phage	100.0	3.0e-57
WP_000513704.1|2845407_2845845_-	transcriptional regulator	NA	A0A2K9VBV2	Staphylococcus_phage	100.0	6.1e-77
WP_001793488.1|2845857_2847225_-	DEAD/DEAH box helicase	NA	A0A2I6PE95	Staphylococcus_phage	100.0	1.7e-263
WP_000665205.1|2847205_2847496_-	VRR-NUC domain-containing protein	NA	U5U7A3	Staphylococcus_phage	100.0	4.9e-51
WP_001801650.1|2847629_2847728_+	hypothetical protein	NA	A0A2I6PDP6	Staphylococcus_phage	100.0	3.7e-11
>prophage 1
NZ_CP048644	Staphylococcus aureus strain SR153 plasmid pSR01, complete sequence	39500	5861	13775	39500	transposase	Staphylococcus_phage(42.86%)	7	NA	NA
WP_032495458.1|5861_7034_+|transposase	IS256-like element ISEnfa4 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	92.4	1.5e-125
WP_000393259.1|7090_7483_+	GNAT family N-acetyltransferase	NA	A0A0N7GFH7	Staphylococcus_phage	100.0	6.9e-72
WP_001028144.1|7483_8923_+	aminoglycoside O-phosphotransferase APH(2'')-Ia	NA	A0A1X9I6C2	Streptococcus_phage	100.0	3.8e-285
WP_000195429.1|9020_10193_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_030061428.1|11367_11784_-	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	60.9	2.7e-34
WP_030061432.1|12077_12635_+	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	41.1	9.9e-32
WP_030061435.1|12650_13775_+	hypothetical protein	NA	U5N3F3	Enterobacteria_phage	26.0	8.7e-19
>prophage 1
NZ_CP048645	Staphylococcus aureus strain SR153 plasmid pSR02, complete sequence	28040	10750	23761	28040	transposase,bacteriocin	Staphylococcus_phage(44.44%)	14	NA	NA
WP_001105960.1|10750_11425_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	97.3	1.7e-126
WP_049394661.1|11732_12350_+	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_002441960.1|12368_12716_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	34.9	4.1e-12
WP_000228874.1|12884_12986_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_002504104.1|13711_13861_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002504103.1|13881_14025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002504102.1|14181_16338_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.3	6.8e-44
WP_000583537.1|16565_17174_+	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	30.6	8.3e-16
WP_010775116.1|17425_18100_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	98.7	4.4e-127
WP_000393259.1|18743_19136_+	GNAT family N-acetyltransferase	NA	A0A0N7GFH7	Staphylococcus_phage	100.0	6.9e-72
WP_001028144.1|19136_20576_+	aminoglycoside O-phosphotransferase APH(2'')-Ia	NA	A0A1X9I6C2	Streptococcus_phage	100.0	3.8e-285
WP_010775116.1|20741_21416_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	98.7	4.4e-127
WP_001832666.1|21472_22039_-	multidrug-binding transcriptional regulator QacR	NA	NA	NA	NA	NA
WP_058342586.1|22216_23761_+	QacA/B family quaternary ammonium compound efflux MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	26.8	5.5e-32
