The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048711	Kineobactrum sp. M2 chromosome, complete genome	4649503	1388929	1409250	4649503	integrase,transposase,protease	Leptospira_phage(14.29%)	16	1384580:1384598	1424998:1425016
1384580:1384598	attL	CCAGCCACTGCTGCTTCTG	NA	NA	NA	NA
WP_163494252.1|1388929_1390043_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.0	1.2e-41
WP_163494253.1|1390808_1391603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163494254.1|1392039_1392408_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_163494255.1|1392501_1393575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163494256.1|1393555_1394736_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	37.0	1.0e-38
WP_163494257.1|1394880_1396458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163493605.1|1396677_1397766_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_163494008.1|1398085_1399170_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_163494258.1|1400349_1400538_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.9	2.8e-07
WP_163494259.1|1400585_1401452_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_163494260.1|1402380_1403385_-	hypothetical protein	NA	Q9JMN3	Wolbachia_phage	41.6	3.6e-24
WP_163494261.1|1403763_1404156_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_163494262.1|1404212_1404956_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_163494263.1|1405065_1406421_-	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	26.7	1.7e-08
WP_163496980.1|1406417_1407218_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.7	2.4e-23
WP_163494264.1|1407303_1409250_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	42.5	6.4e-118
1424998:1425016	attR	CCAGCCACTGCTGCTTCTG	NA	NA	NA	NA
>prophage 2
NZ_CP048711	Kineobactrum sp. M2 chromosome, complete genome	4649503	2676330	2684923	4649503		Acinetobacter_phage(50.0%)	6	NA	NA
WP_163495423.1|2676330_2677851_+	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.0	2.9e-41
WP_163495424.1|2678061_2679555_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	80.5	5.6e-215
WP_163495425.1|2679713_2681822_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.8	9.9e-16
WP_163497075.1|2682495_2683074_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	58.2	1.1e-65
WP_163495426.1|2683076_2684126_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	55.4	1.5e-97
WP_163495427.1|2684122_2684923_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	55.0	6.5e-69
>prophage 3
NZ_CP048711	Kineobactrum sp. M2 chromosome, complete genome	4649503	2803503	2862228	4649503	integrase,transposase,protease,tRNA	Vibrio_phage(20.0%)	49	2819021:2819043	2877363:2877385
WP_163495511.1|2803503_2804616_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_163495512.1|2804716_2806216_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_163495513.1|2806212_2806743_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_163495514.1|2806715_2808020_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	30.3	1.2e-14
WP_163495515.1|2808040_2809846_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.1e-87
WP_163497083.1|2809888_2810839_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_163495516.1|2810994_2811246_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_163495517.1|2811311_2812583_+	GTPase HflX	NA	NA	NA	NA	NA
WP_163495518.1|2812648_2813815_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_163495519.1|2813816_2814692_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_163497084.1|2814869_2815061_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_163495520.1|2815074_2816247_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_163495521.1|2817817_2818210_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_163497085.1|2818303_2818690_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
2819021:2819043	attL	GTCTCGAAAGCACCCTCCCAGGA	NA	NA	NA	NA
WP_163497086.1|2819086_2821048_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_163495522.1|2821075_2821672_-	LemA family protein	NA	NA	NA	NA	NA
WP_163495523.1|2821843_2823214_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_163495524.1|2823285_2825409_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_163495525.1|2825634_2825934_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_163495526.1|2825920_2826190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163495527.1|2827004_2827679_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_163497087.1|2827979_2828480_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	35.1	1.9e-13
WP_163495528.1|2829593_2829848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163495529.1|2830090_2831353_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_163495530.1|2831739_2832156_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_163495531.1|2832223_2833135_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163495532.1|2833231_2833678_+	ester cyclase	NA	NA	NA	NA	NA
WP_163495533.1|2833702_2834623_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_163495534.1|2834638_2834995_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_163495535.1|2835014_2835977_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_163497088.1|2837283_2837535_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_163495536.1|2839030_2839969_+	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_163495537.1|2839965_2840991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163495538.1|2840962_2841718_-	peptidase	NA	NA	NA	NA	NA
WP_163497089.1|2841881_2842316_+	NUDIX hydrolase	NA	A0A1W6DX89	Sphingobium_phage	35.9	8.9e-12
WP_163495539.1|2842324_2843371_-	sodium:calcium antiporter	NA	NA	NA	NA	NA
WP_163495540.1|2843511_2845233_+	amidohydrolase	NA	NA	NA	NA	NA
WP_163495541.1|2845666_2847604_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	30.6	1.2e-07
WP_163495542.1|2847640_2848753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163495543.1|2848656_2851521_+	cobaltochelatase subunit CobN	NA	NA	NA	NA	NA
WP_163495544.1|2851546_2852041_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_163495545.1|2852040_2852403_+	DUF2149 domain-containing protein	NA	NA	NA	NA	NA
WP_163495546.1|2852446_2854387_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_163495547.1|2854597_2855059_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_163495548.1|2855100_2856831_-	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_163495549.1|2856838_2858911_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_163495550.1|2859031_2860258_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_163495551.1|2860260_2861031_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_163494389.1|2861058_2862228_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2877363:2877385	attR	GTCTCGAAAGCACCCTCCCAGGA	NA	NA	NA	NA
>prophage 4
NZ_CP048711	Kineobactrum sp. M2 chromosome, complete genome	4649503	3857525	3865797	4649503	tRNA	Bacillus_phage(16.67%)	7	NA	NA
WP_163497166.1|3857525_3859205_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	3.5e-56
WP_163496295.1|3859276_3860374_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	46.8	1.2e-07
WP_163496296.1|3860384_3861881_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	37.6	6.0e-84
WP_163496297.1|3861968_3862556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163496298.1|3862503_3864036_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	38.5	1.8e-30
WP_163496299.1|3864032_3864407_-	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	35.4	4.6e-09
WP_163497167.1|3864399_3865797_-	adenylate/guanylate cyclase domain-containing response regulator	NA	A0A218MLZ2	uncultured_virus	32.9	8.0e-30
