The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP022612	Mycolicibacterium confluentis strain JCM 13671	5876557	2870678	2923131	5876557	integrase,transposase,tRNA,capsid	Mycobacterium_phage(36.36%)	51	2921625:2921647	2933650:2933672
WP_085157366.1|2870678_2871521_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_085157363.1|2871699_2872200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085157360.1|2872196_2872445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085157357.1|2872536_2872842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085157354.1|2872987_2874589_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	38.2	3.7e-71
WP_163645264.1|2874585_2874759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085157351.1|2874755_2874932_-	helix-turn-helix domain-containing protein	NA	G1JV87	Mycobacterium_phage	48.1	1.1e-05
WP_085157348.1|2875092_2876424_-	recombinase family protein	NA	A0A2D1GQ20	Mycobacterium_phage	43.4	5.4e-92
WP_085157345.1|2876347_2877565_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_085157342.1|2877862_2878486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133057828.1|2878597_2879653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085151461.1|2879830_2880112_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_163645382.1|2880224_2880539_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_163645384.1|2880451_2880904_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	34.6	7.3e-17
WP_163645385.1|2880927_2882072_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.2	2.6e-34
WP_085151474.1|2882552_2883410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085151473.1|2883952_2884249_-	hypothetical protein	NA	G8I4Q1	Mycobacterium_phage	37.5	3.2e-05
WP_085151472.1|2884339_2885404_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.2	5.6e-07
WP_085151471.1|2885400_2885994_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_085151470.1|2885990_2886563_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_085151469.1|2887010_2888267_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	55.4	1.1e-123
WP_109788448.1|2888278_2888560_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_085151468.1|2888926_2889925_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_085151467.1|2889979_2890936_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_109788447.1|2891001_2891178_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_085151466.1|2891174_2891522_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_085151465.1|2891531_2892380_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	31.1	9.8e-23
WP_085151464.1|2892382_2893138_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_085151463.1|2893239_2893839_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_085151462.1|2893835_2894678_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_163645387.1|2894687_2895605_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_085152499.1|2895675_2896722_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_085152500.1|2896721_2897846_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_085152501.1|2897845_2898814_-	phosphatidylinositol mannoside acyltransferase	NA	NA	NA	NA	NA
WP_085152695.1|2898813_2899503_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_085152502.1|2899499_2900063_-	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_085152503.1|2900059_2902126_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.7	1.7e-105
WP_085152504.1|2902217_2902631_-	TIGR02611 family protein	NA	NA	NA	NA	NA
WP_085152505.1|2902627_2903254_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_085152506.1|2903316_2903820_+	DUF1990 domain-containing protein	NA	NA	NA	NA	NA
WP_085152507.1|2903829_2904732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085152508.1|2905847_2907530_-	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_163645389.1|2907605_2907761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085152509.1|2907771_2909262_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_085152510.1|2909378_2909849_+	DUF4383 domain-containing protein	NA	NA	NA	NA	NA
WP_085152511.1|2909849_2912105_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_109788527.1|2912191_2912974_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_085152512.1|2913079_2914423_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_109788541.1|2914672_2915212_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_163645391.1|2915201_2920772_-	hypothetical protein	NA	NA	NA	NA	NA
2921625:2921647	attL	GTGGTCCCGGCTGGTATCGAACC	NA	NA	NA	NA
WP_085152697.1|2921889_2923131_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1J0GQ13	Mycobacterium_phage	37.0	3.3e-59
WP_085152697.1|2921889_2923131_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1J0GQ13	Mycobacterium_phage	37.0	3.3e-59
2933650:2933672	attR	GTGGTCCCGGCTGGTATCGAACC	NA	NA	NA	NA
>prophage 2
NZ_AP022612	Mycolicibacterium confluentis strain JCM 13671	5876557	3293934	3303191	5876557		Lactococcus_phage(16.67%)	10	NA	NA
WP_085147979.1|3293934_3296103_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	50.9	5.3e-206
WP_085147982.1|3296069_3296522_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_085147985.1|3296550_3296793_-	redoxin NrdH	NA	V5UN81	Mycobacterium_phage	66.7	2.6e-21
WP_085147988.1|3297325_3297877_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	32.6	8.9e-09
WP_085147991.1|3297970_3298579_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085149909.1|3298575_3299631_+	DNA polymerase IV	NA	F1C5A5	Cronobacter_phage	27.4	3.4e-17
WP_085147994.1|3299692_3300403_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_085147998.1|3300426_3301191_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_085148001.1|3301201_3302317_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	37.8	5.9e-60
WP_085148004.1|3302282_3303191_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	35.4	2.0e-05
