The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP022617	Mycolicibacterium monacense strain JCM 15658	6042466	253588	261773	6042466		Mollivirus(16.67%)	9	NA	NA
WP_041925370.1|253588_254353_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	42.5	2.0e-11
WP_064872871.1|254404_255280_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	28.9	1.0e-14
WP_064872869.1|255272_256181_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_064872867.1|256180_257725_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	51.9	1.6e-156
WP_011561489.1|258038_258755_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	44.4	1.4e-14
WP_011561488.1|258829_259150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064872866.1|259159_260275_-	NAD-dependent epimerase/dehydratase family protein	NA	Q76TT0	Molluscum_contagiosum_virus	33.3	4.1e-29
WP_064872864.1|260338_260551_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_064872862.1|260537_261773_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	51.9	1.3e-68
>prophage 2
NZ_AP022617	Mycolicibacterium monacense strain JCM 15658	6042466	2024454	2079733	6042466	integrase,transposase	uncultured_Mediterranean_phage(28.57%)	32	2024114:2024132	2079872:2079888
2024114:2024132	attL	TGCTGTCCGATCCGGAACT	NA	NA	NA	NA
WP_083045115.1|2024454_2025585_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2024114:2024132	attL	TGCTGTCCGATCCGGAACT	NA	NA	NA	NA
WP_083045113.1|2027897_2028680_+|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_083045112.1|2028676_2030740_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	NA	NA	NA	NA
WP_083045111.1|2030743_2031742_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_133056656.1|2032449_2032722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024445222.1|2032765_2033041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158498036.1|2033037_2033205_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_011767782.1|2033885_2034506_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013470158.1|2034596_2036057_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_011767780.1|2036053_2036869_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_083045109.1|2037300_2038155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024445219.1|2038235_2038604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083045108.1|2038653_2039532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163647407.1|2039677_2040550_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_083045106.1|2040850_2041555_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_083045105.1|2041544_2043596_-	DUF1998 domain-containing protein	NA	NA	NA	NA	NA
WP_083045104.1|2043595_2047309_-	helicase	NA	NA	NA	NA	NA
WP_083045103.1|2047308_2051382_-	N-6 DNA methylase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	28.4	1.8e-37
WP_083045102.1|2051381_2054822_-	DEAD/DEAH box helicase family protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	28.3	4.5e-82
WP_163647408.1|2055169_2057176_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_133056654.1|2057228_2058455_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_083045099.1|2058549_2062317_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_110807684.1|2062313_2063936_+	GTPase domain-containing protein	NA	NA	NA	NA	NA
WP_083045659.1|2064910_2066092_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S7K9	Streptococcus_phage	55.6	2.3e-06
WP_083045661.1|2068255_2068699_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083045649.1|2069133_2070495_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_083045650.1|2070734_2072129_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.9	2.0e-33
WP_083045651.1|2072052_2072805_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	40.4	1.4e-36
WP_083045652.1|2072801_2073125_-|transposase	transposase	transposase	A0A2P1JR43	Mycobacterium_phage	41.3	5.4e-06
WP_083045653.1|2073216_2076027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083045654.1|2076278_2077685_-|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	44.5	1.4e-87
WP_011894084.1|2078992_2079733_+|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
2078542:2078560	attR	AGTTCCGGATCGGACAGCA	NA	NA	NA	NA
WP_011894084.1|2078992_2079733_+|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
2079872:2079888	attR	AGCTGATGGTTGATCCG	NA	NA	NA	NA
>prophage 3
NZ_AP022617	Mycolicibacterium monacense strain JCM 15658	6042466	2156571	2174356	6042466	integrase,transposase,protease	Streptococcus_phage(100.0%)	10	2171488:2171508	2181675:2181695
WP_064872668.1|2156571_2157336_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_064872582.1|2157471_2158788_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_064872580.1|2159199_2160561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064872578.1|2160557_2161007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064916353.1|2162203_2163115_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_083045661.1|2164625_2165069_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083045659.1|2167231_2168413_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S7K9	Streptococcus_phage	55.6	2.3e-06
WP_082947906.1|2168904_2170413_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
2171488:2171508	attL	TTTCTCATTGAATCTGGGGCA	NA	NA	NA	NA
WP_011894084.1|2171527_2172268_+|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_005148662.1|2172391_2174356_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
2181675:2181695	attR	TGCCCCAGATTCAATGAGAAA	NA	NA	NA	NA
>prophage 4
NZ_AP022617	Mycolicibacterium monacense strain JCM 15658	6042466	2973668	2981394	6042466		Lactococcus_phage(16.67%)	8	NA	NA
WP_082947857.1|2973668_2975837_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.0	1.5e-205
WP_011559216.1|2975803_2976262_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_011559215.1|2976294_2976546_-	redoxin NrdH	NA	V5UN81	Mycobacterium_phage	64.5	1.6e-21
WP_011559214.1|2977011_2977578_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	33.1	1.2e-08
WP_011559213.1|2977673_2978276_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011559212.1|2978279_2979347_+	DNA polymerase IV	NA	F1C5A5	Cronobacter_phage	26.5	1.0e-13
WP_011855253.1|2979356_2980529_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	35.7	4.2e-56
WP_083045449.1|2980536_2981394_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	38.5	1.3e-06
>prophage 5
NZ_AP022617	Mycolicibacterium monacense strain JCM 15658	6042466	3831481	3882227	6042466	tail,plate,transposase	Leptospira_phage(16.67%)	47	NA	NA
WP_085975375.1|3831481_3832619_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	34.8	6.3e-33
WP_083044942.1|3832710_3833223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133056648.1|3833824_3834973_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_083044940.1|3835219_3836308_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_083044939.1|3836371_3837400_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_163647419.1|3837654_3838377_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_133056647.1|3838661_3840014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163647420.1|3840351_3841119_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_083044936.1|3841120_3841951_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_163647421.1|3841960_3842815_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_083044945.1|3842901_3844287_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_083044934.1|3844471_3846241_-	DUF4012 domain-containing protein	NA	NA	NA	NA	NA
WP_083044933.1|3846446_3846809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083044932.1|3847448_3848777_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	36.6	1.9e-68
WP_083044931.1|3848985_3849174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011558343.1|3849266_3849974_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_011854758.1|3850110_3850539_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_083044930.1|3850573_3851389_-	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_011854756.1|3851425_3851869_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_011854755.1|3852184_3852694_-	(3R)-hydroxyacyl-ACP dehydratase subunit HadC	NA	NA	NA	NA	NA
WP_011854754.1|3852709_3853138_-	(3R)-hydroxyacyl-ACP dehydratase subunit HadB	NA	NA	NA	NA	NA
WP_064874878.1|3853124_3853604_-	(3R)-hydroxyacyl-ACP dehydratase subunit HadA	NA	NA	NA	NA	NA
WP_011854752.1|3853655_3853823_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_083044929.1|3854165_3855365_-	hemin transporter	NA	NA	NA	NA	NA
WP_083044928.1|3855364_3855826_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_083044927.1|3855933_3856650_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_083044926.1|3856971_3857976_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011854747.1|3858130_3858754_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_064916204.1|3858842_3859535_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_083044925.1|3859531_3861547_+	ATP-binding protein	NA	A0A2D2W2C3	Stenotrophomonas_phage	45.7	1.6e-07
WP_133056646.1|3861584_3862886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083044923.1|3862896_3864291_+	trypsin-like peptidase domain-containing protein	NA	A0A1S5Y2X3	uncultured_archaeal_virus	29.7	6.2e-06
WP_083044922.1|3864547_3866392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011854741.1|3866424_3870387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011854740.1|3870390_3871110_-	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_011854739.1|3871344_3872883_+|tail	phage tail sheath family protein	tail	H6WFT7	Cyanophage	32.5	7.2e-24
WP_011854738.1|3872919_3873372_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011854737.1|3873364_3873805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165760722.1|3873801_3873960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041924978.1|3874086_3875991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011854735.1|3876004_3876457_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_110807662.1|3876453_3877221_+	peptidase M23	NA	NA	NA	NA	NA
WP_011854733.1|3877227_3878991_+	VgrG-related protein	NA	NA	NA	NA	NA
WP_011854732.1|3879006_3879291_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_011854731.1|3879293_3879734_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_011854730.1|3879735_3881694_+|plate	putative baseplate assembly protein	plate	A0A1J0GW37	Streptomyces_phage	26.8	5.8e-10
WP_011854729.1|3881696_3882227_+|tail	tail protein	tail	NA	NA	NA	NA
