The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP022594	Mycolicibacillus koreensis strain JCM 19956	4155701	1283011	1288332	4155701		Mycobacterium_phage(66.67%)	12	NA	NA
WP_085304566.1|1283011_1283374_+	hypothetical protein	NA	S5Z690	Mycobacterium_phage	47.9	1.3e-16
WP_085304565.1|1283370_1283940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163797049.1|1283936_1284107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133056120.1|1284190_1284472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085304563.1|1284468_1284681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163797051.1|1284795_1285011_+	hypothetical protein	NA	A0A2R4AQG4	Mycobacterium_phage	66.7	1.5e-12
WP_085304602.1|1285054_1285342_+	hypothetical protein	NA	A0A0F6YRD1	Mycobacterium_phage	54.9	3.3e-23
WP_163797053.1|1285663_1286755_+	hypothetical protein	NA	A0A222YVK0	Streptomyces_phage	37.6	1.4e-26
WP_085304560.1|1286779_1287076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085304558.1|1287075_1287276_-	hypothetical protein	NA	A0A142F061	Stenotrophomonas_phage	48.3	3.2e-09
WP_085304556.1|1287853_1288087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085304554.1|1288083_1288332_-	hypothetical protein	NA	A0A286MQM8	Mycobacterium_phage	49.4	1.4e-14
>prophage 2
NZ_AP022594	Mycolicibacillus koreensis strain JCM 19956	4155701	1391435	1401738	4155701	transposase	Mycobacterium_phage(54.55%)	18	NA	NA
WP_085302748.1|1391435_1391960_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	56.1	1.2e-39
WP_085302745.1|1392006_1392198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085302743.1|1392262_1392466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085302741.1|1392470_1392773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085302740.1|1392793_1393252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085302739.1|1393329_1393515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133056059.1|1393546_1393858_-	hypothetical protein	NA	H6X4E9	Enterobacteria_phage	56.3	1.3e-25
WP_085302737.1|1393945_1395337_-	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	57.4	1.8e-151
WP_085302736.1|1395320_1396532_-	hypothetical protein	NA	V5UNW9	Mycobacterium_phage	36.8	2.7e-58
WP_133056058.1|1396528_1397023_-	hypothetical protein	NA	V5UP92	Mycobacterium_phage	43.3	1.0e-32
WP_085302734.1|1397034_1397490_-	XRE family transcriptional regulator	NA	V5UN35	Mycobacterium_phage	50.0	5.8e-30
WP_085302733.1|1397693_1397936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085302732.1|1397949_1398186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085302731.1|1398235_1399210_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	30.5	8.1e-21
WP_085302729.1|1399290_1399575_+	hypothetical protein	NA	G1JV45	Mycobacterium_phage	57.9	1.7e-16
WP_133056057.1|1399598_1400807_-|transposase	transposase	transposase	I4AZI9	Saccharomonospora_phage	34.3	3.3e-40
WP_085302725.1|1400938_1401259_-	DUF4031 domain-containing protein	NA	A0A291LA06	Bordetella_phage	52.9	1.1e-14
WP_085302723.1|1401255_1401738_-	hypothetical protein	NA	A0A2P1JRA0	Mycobacterium_phage	67.5	9.7e-52
>prophage 3
NZ_AP022594	Mycolicibacillus koreensis strain JCM 19956	4155701	1445427	1476399	4155701	transposase,integrase	Mycobacterium_phage(30.0%)	27	1453199:1453230	1476566:1476597
WP_085302624.1|1445427_1446645_-|integrase	site-specific integrase	integrase	G9FGY1	Rhodococcus_phage	38.9	2.8e-63
WP_085302622.1|1446991_1447798_+	DUF2637 domain-containing protein	NA	NA	NA	NA	NA
WP_085302620.1|1447844_1448075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163797129.1|1448260_1448815_+	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	33.5	4.9e-07
WP_085302893.1|1449734_1450937_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	24.5	8.2e-07
WP_085302616.1|1450965_1451229_-	helix-turn-helix domain-containing protein	NA	A0A0A7RVT4	Mycobacterium_phage	58.0	2.3e-07
WP_109561714.1|1451341_1452547_+|integrase	tyrosine-type recombinase/integrase	integrase	G9FGY1	Rhodococcus_phage	40.5	1.9e-67
1453199:1453230	attL	TTCAATCCCAGTATCGCGCACCACGTTTGACC	NA	NA	NA	NA
WP_085302614.1|1453318_1453723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133056043.1|1453775_1454021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133056042.1|1454149_1457263_-	hypothetical protein	NA	A0A076YMH0	Mycobacterium_phage	45.7	1.1e-98
WP_163797131.1|1457522_1457834_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_085302606.1|1457995_1458919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109561855.1|1459011_1460176_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	28.0	3.9e-22
WP_133056032.1|1460339_1460759_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_085302179.1|1460755_1461136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085302261.1|1462229_1465274_-	RND family transporter	NA	NA	NA	NA	NA
WP_085302183.1|1465427_1465862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085266671.1|1466077_1466821_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065289896.1|1467064_1467886_-	TniQ family protein	NA	NA	NA	NA	NA
WP_085266670.1|1467923_1468949_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_085266683.1|1468936_1470895_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_084014214.1|1471017_1471650_-|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_163797133.1|1471844_1472294_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_085302187.1|1473738_1474062_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_133056033.1|1474061_1474862_-	hypothetical protein	NA	A0A173G9P7	Propionibacterium_phage	34.3	1.3e-19
WP_085302191.1|1474858_1475062_-	excisionase family DNA-binding protein	NA	A0A2P1CHK7	Mycobacterium_phage	70.2	3.1e-15
WP_085302193.1|1475271_1476399_-|integrase	site-specific integrase	integrase	Q1A0I1	Mycobacterium_virus	36.8	2.8e-57
1476566:1476597	attR	TTCAATCCCAGTATCGCGCACCACGTTTGACC	NA	NA	NA	NA
>prophage 4
NZ_AP022594	Mycolicibacillus koreensis strain JCM 19956	4155701	3475294	3534587	4155701	holin,transposase,protease,integrase	Mycobacterium_phage(21.43%)	56	3467845:3467862	3530371:3530388
3467845:3467862	attL	TGGCAGGTCCGCCGCGGC	NA	NA	NA	NA
WP_163797268.1|3475294_3476611_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	88.4	4.2e-222
WP_085303797.1|3476764_3477601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085303795.1|3477597_3478197_-	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	53.6	2.1e-40
WP_133056089.1|3478358_3478679_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_085303793.1|3479085_3479451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085303791.1|3479556_3480054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085303819.1|3480050_3480344_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085303789.1|3480492_3481011_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_163797272.1|3481133_3482198_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3XBN7	Gordonia_phage	36.8	7.2e-47
WP_069393125.1|3482658_3483768_-	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_069393124.1|3483764_3484730_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_069393123.1|3484817_3487241_-	transglycosylase/D,D-transpeptidase PonA2	NA	NA	NA	NA	NA
WP_069393122.1|3487583_3487937_+	WhiB family transcriptional regulator	NA	A0A220NS58	Mycobacterium_phage	46.2	4.0e-10
WP_085303785.1|3487933_3489091_-	ArsA family ATPase	NA	NA	NA	NA	NA
WP_085303774.1|3489087_3490095_-	ArsA family ATPase	NA	NA	NA	NA	NA
WP_109470166.1|3490164_3490326_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_085303770.1|3490322_3490784_+	RidA family protein	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	32.7	2.5e-12
WP_085303768.1|3490788_3491577_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_085303766.1|3491594_3492269_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_163796979.1|3492368_3492512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085303764.1|3492577_3493354_+	endonuclease III	NA	NA	NA	NA	NA
WP_174254793.1|3493373_3494015_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_085303760.1|3494058_3494862_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_085303758.1|3494866_3496054_+|protease	acid resistance serine protease MarP	protease	NA	NA	NA	NA
WP_085303756.1|3496069_3497023_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_085303817.1|3497023_3497494_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_085303815.1|3497734_3498424_+	peptidase	NA	NA	NA	NA	NA
WP_085303754.1|3498449_3500387_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.5	2.6e-71
WP_085303752.1|3500473_3501283_+	oxidoreductase	NA	NA	NA	NA	NA
WP_085303750.1|3501648_3502503_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_085303813.1|3502881_3503940_+	helicase	NA	NA	NA	NA	NA
WP_085303748.1|3503936_3505103_+	TadA family conjugal transfer-associated ATPase	NA	NA	NA	NA	NA
WP_085303746.1|3505099_3505900_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_085303744.1|3505896_3506469_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_069393105.1|3506511_3506709_+	DUF4244 domain-containing protein	NA	NA	NA	NA	NA
WP_085303811.1|3506714_3507041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085303809.1|3506958_3507783_+	flp pilus-assembly TadE/G-like family protein	NA	NA	NA	NA	NA
WP_085303742.1|3508411_3510793_-	DUF1998 domain-containing protein	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	27.7	4.7e-06
WP_003925183.1|3511116_3511320_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	54.7	2.6e-14
WP_085303740.1|3511460_3512039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109561759.1|3512177_3515039_+	type I DNA topoisomerase	NA	J3E777	Acanthamoeba_polyphaga_lentillevirus	34.4	1.9e-94
WP_069393100.1|3515218_3515536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084228975.1|3515570_3517079_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	32.3	2.2e-17
WP_069393099.1|3517263_3518469_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_163797276.1|3518589_3518937_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_069393097.1|3519004_3520159_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_084228965.1|3520155_3520866_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_084228974.1|3520865_3522716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085303738.1|3522681_3523620_+	GDP-mannose 4,6-dehydratase	NA	M1NML0	Moumouvirus	34.3	4.1e-38
WP_109470169.1|3523616_3524861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069393094.1|3525267_3525699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085303805.1|3525829_3530314_+	cation-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	26.5	2.8e-36
WP_085303736.1|3530473_3531454_+	TerC/Alx family metal homeostasis membrane protein	NA	I7HPH5	Enterobacteria_phage	30.6	5.6e-30
3530371:3530388	attR	GCCGCGGCGGACCTGCCA	NA	NA	NA	NA
WP_085303734.1|3531502_3531991_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	48.1	8.7e-32
WP_085303733.1|3532170_3533547_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_085303803.1|3533543_3534587_+|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
