The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044450	Acinetobacter indicus strain MMS9-2 chromosome, complete genome	3005353	6594	39988	3005353	tRNA,transposase	Helicobacter_phage(33.33%)	24	NA	NA
WP_104490858.1|6594_7008_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.9	2.3e-46
WP_034586922.1|7028_8087_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3UZC2	Geobacillus_virus	36.2	4.8e-27
WP_104488188.1|8324_10262_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.6	9.0e-64
WP_163140745.1|10494_11166_+	RND transporter	NA	NA	NA	NA	NA
WP_075175275.1|11423_12434_+	RND transporter	NA	NA	NA	NA	NA
WP_171065126.1|12778_13747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005181144.1|13869_14205_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.5	1.2e-24
WP_005181147.1|14276_15404_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_163140748.1|15467_16700_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005181154.1|17185_17458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163140751.1|17565_19470_+	5'-nucleotidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_016658670.1|25606_26956_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_163140754.1|27325_28492_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_163140757.1|28995_29538_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_104490858.1|29768_30182_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.9	2.3e-46
WP_034586922.1|30202_31261_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3UZC2	Geobacillus_virus	36.2	4.8e-27
WP_163140760.1|31274_31757_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_163140763.1|31749_32289_-	signal peptidase II	NA	NA	NA	NA	NA
WP_163140766.1|32281_35128_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	26.0	1.9e-78
WP_163140771.1|35189_36194_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_162182856.1|36489_37059_+	5'-nucleosidase	NA	NA	NA	NA	NA
WP_005181018.1|37102_37756_-	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_163140776.1|38219_39377_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A7P9	Microcystis_virus	36.6	1.3e-54
WP_152342396.1|39373_39988_-|transposase	IS607 family transposase	transposase	A0A1S5RGS9	Helicobacter_phage	62.7	3.5e-62
>prophage 2
NZ_CP044450	Acinetobacter indicus strain MMS9-2 chromosome, complete genome	3005353	134934	142651	3005353	coat,transposase	Escherichia_phage(100.0%)	8	NA	NA
WP_163140883.1|134934_136154_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.6	3.4e-77
WP_163140887.1|136201_136498_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_015060273.1|136716_138051_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_163140890.1|139091_140111_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	46.7	5.6e-81
WP_163140893.1|140110_140884_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.1e-76
WP_171521817.1|140880_141132_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_163140896.1|141203_141683_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_163140898.1|141697_142651_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 3
NZ_CP044450	Acinetobacter indicus strain MMS9-2 chromosome, complete genome	3005353	232141	352755	3005353	integrase,protease,tRNA,transposase	Salmonella_phage(17.39%)	111	229594:229610	324146:324162
229594:229610	attL	TGAAGAAGATGTCGCGG	NA	NA	NA	NA
WP_163141012.1|232141_232300_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_163141015.1|232593_232872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163141018.1|232894_233926_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	40.8	2.9e-61
WP_163141021.1|234123_235182_+	YqaJ viral recombinase family protein	NA	A0A139ZPJ9	Marinitoga_camini_virus	42.2	1.9e-44
WP_163141024.1|235377_236262_+	hydrolase or metal-binding protein	NA	NA	NA	NA	NA
WP_005180632.1|236341_236572_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_163141027.1|236837_239123_+	N-6 DNA methylase	NA	A0A220A2U5	Liberibacter_phage	25.1	7.7e-30
WP_163141030.1|239122_240490_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_163141033.1|240486_241536_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	40.4	9.3e-23
WP_163143390.1|241532_244796_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_163143393.1|244951_245800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163141036.1|245814_246648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163141039.1|247070_248267_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	3.7e-76
WP_163141042.1|248660_250541_+	KUP/HAK/KT family potassium transporter	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	31.3	6.5e-75
WP_163141045.1|250629_251277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016658418.1|251541_252624_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	38.0	1.2e-25
WP_163141048.1|252694_252940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160240886.1|253047_253722_-	aquaporin Z	NA	NA	NA	NA	NA
WP_005180609.1|253842_254859_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_163141051.1|254969_255602_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_005180605.1|256026_256785_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_163141054.1|256898_257849_+	homoserine kinase	NA	NA	NA	NA	NA
WP_005180601.1|257866_258493_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_163141057.1|258525_258918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005180595.1|258951_259887_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005180591.1|259974_260706_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_163141060.1|260884_261553_-	3'-5' exonuclease domain-containing protein 2	NA	NA	NA	NA	NA
WP_016658424.1|261627_262116_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_005180583.1|262268_262886_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_005180581.1|262885_263479_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_163141063.1|263575_263953_+	acetyl-CoA sensor PanZ family protein	NA	NA	NA	NA	NA
WP_163141066.1|264685_265195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005180567.1|265277_266795_-	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_005180564.1|267002_268463_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	27.2	1.7e-14
WP_005180561.1|268723_269488_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.7	2.2e-29
WP_163141069.1|269823_272175_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005180556.1|272226_272541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005180554.1|272622_273510_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_127801540.1|273818_275096_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	27.5	2.1e-13
WP_005180550.1|275412_277074_+	energy-dependent translational throttle protein EttA	NA	A0A1B0RXA0	Streptococcus_phage	27.5	7.0e-41
WP_016659780.1|277165_277615_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	49.2	2.7e-32
WP_163141072.1|277687_279079_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A2I7RKG5	Vibrio_phage	23.8	7.0e-10
WP_005180548.1|279326_279668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104495032.1|280055_281564_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005180544.1|281716_282028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163141075.1|282580_283600_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005180541.1|283785_284697_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_005180539.1|284708_285041_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_163141077.1|285053_286877_+	penicillin-binding protein PBP3	NA	NA	NA	NA	NA
WP_160232273.1|286888_288382_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_160232274.1|288394_289804_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_005180530.1|289804_290923_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_160232275.1|290988_291792_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_163141081.1|291898_293203_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_160232276.1|293243_295820_-	penicillin-binding protein PBP1a	NA	NA	NA	NA	NA
WP_075167936.1|296073_296688_+|transposase	IS607 family transposase	transposase	A0A1S5RGS9	Helicobacter_phage	63.2	2.7e-62
WP_163140776.1|296684_297842_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A7P9	Microcystis_virus	36.6	1.3e-54
WP_163143396.1|297990_299013_+	type IV pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_005180516.1|299012_299648_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_005180513.1|299644_300364_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_045795346.1|300363_300891_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_163143400.1|300951_303096_+	type IV pilus secretin PilQ	NA	NA	NA	NA	NA
WP_075167858.1|303132_303675_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_160232278.1|303697_304780_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_160232279.1|304792_305629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160232280.1|306067_310543_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_104483916.1|310616_312038_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_160232281.1|312280_313165_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_005180484.1|313330_313921_+	LemA family protein	NA	NA	NA	NA	NA
WP_160232282.1|313947_315012_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_104498738.1|315005_315566_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_160232283.1|315703_316189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160232284.1|316200_316929_+	type IV pilin accessory protein	NA	NA	NA	NA	NA
WP_163141084.1|317020_318661_+	O-antigen ligase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_005180468.1|318772_319237_-	bacterioferritin	NA	NA	NA	NA	NA
WP_171065121.1|319463_319646_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_005180461.1|319812_320196_-	RidA family protein	NA	NA	NA	NA	NA
WP_104498093.1|320266_322366_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	37.2	2.4e-09
WP_005013174.1|322589_322871_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_045795273.1|322947_323571_-	guanylate kinase	NA	A0A240FAU9	Liberibacter_phage	32.9	4.7e-14
WP_160232286.1|323705_324656_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
324146:324162	attR	TGAAGAAGATGTCGCGG	NA	NA	NA	NA
WP_160232287.1|324822_324999_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_160232288.1|325006_325939_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	8.4e-60
WP_004809941.1|326221_326479_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_016658481.1|326507_327056_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_160232289.1|327082_327832_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003792460.1|328005_328380_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_160232290.1|329497_330472_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_163141087.1|330559_331546_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005180409.1|331957_332986_-	lipase secretion chaperone	NA	NA	NA	NA	NA
WP_127800624.1|333418_334387_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_104473448.1|335559_336465_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_160232292.1|336501_337269_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_075168265.1|337428_337887_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_034598244.1|337956_338829_-	EamA family transporter	NA	NA	NA	NA	NA
WP_160232293.1|338975_339851_-	EamA family transporter	NA	NA	NA	NA	NA
WP_005180397.1|340084_341317_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.1	4.5e-101
WP_127800910.1|341443_341650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045795292.1|341671_343081_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_016658494.1|343233_343605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127801601.1|343836_345066_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.7	1.2e-13
WP_045795347.1|345180_345480_-	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_104471529.1|345766_346312_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	54.5	5.3e-38
WP_163143403.1|346417_347545_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005180385.1|347681_348326_-	ParA family protein	NA	NA	NA	NA	NA
WP_127800916.1|348445_348913_+	endonuclease	NA	NA	NA	NA	NA
WP_171457094.1|349210_349618_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	48.8	3.7e-28
WP_152342553.1|349690_351082_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A2I7RKG5	Vibrio_phage	23.0	1.6e-06
WP_127799297.1|351088_351562_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_127801059.1|351732_352296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127801058.1|352329_352755_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
>prophage 4
NZ_CP044450	Acinetobacter indicus strain MMS9-2 chromosome, complete genome	3005353	856304	903840	3005353	protease,tRNA,transposase	Clostridium_botulinum_C_phage(11.11%)	44	NA	NA
WP_075168104.1|856304_856904_+|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	55.4	1.9e-60
WP_152342465.1|856908_858291_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_005179424.1|860050_860209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005179422.1|860331_860949_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_005179419.1|861108_861747_+	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
WP_163141488.1|861918_863979_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	30.7	1.2e-13
WP_104513534.1|864051_865059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005179410.1|865073_866096_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_034598190.1|866405_867020_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_005179403.1|867116_867728_-	arylesterase	NA	NA	NA	NA	NA
WP_005179393.1|867760_868486_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	6.8e-33
WP_163141491.1|868487_870971_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_152342461.1|871005_871824_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_045796058.1|871902_872577_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_152342460.1|872688_874770_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005179377.1|874863_875763_-	hydrogen peroxide-inducible genes activator	NA	NA	NA	NA	NA
WP_171499845.1|875776_876670_-	alpha/beta hydrolase	NA	A0A1L7N183	Ralstonia_phage	29.9	7.7e-10
WP_104471160.1|876763_877942_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005179369.1|878019_878184_-	rubredoxin	NA	NA	NA	NA	NA
WP_005179368.1|878688_879231_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	38.4	5.9e-21
WP_034598188.1|879284_879791_-	esterase	NA	A0A2I7QX93	Vibrio_phage	24.7	5.0e-06
WP_171499844.1|880011_881574_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.5	6.1e-87
WP_152342456.1|881668_882211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005179347.1|882535_883450_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_163141494.1|883553_885167_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.4	2.3e-41
WP_016659282.1|885636_885999_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_163141497.1|886128_887121_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_005179332.1|887346_887517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005179331.1|887685_888582_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_016659280.1|888722_889229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005179329.1|889301_890618_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_075167072.1|890742_891732_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163141500.1|892369_893971_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_152342451.1|894111_894876_-	copper resistance protein NlpE N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_005179322.1|895054_895519_-	copper resistance protein NlpE N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_081401165.1|895783_896374_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_005179319.1|896525_896858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163143443.1|896982_897744_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_127800583.1|897887_898763_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_163141503.1|898918_899221_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_127800928.1|899230_899539_+	urease subunit beta	NA	NA	NA	NA	NA
WP_163141506.1|899551_901252_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_163141509.1|901312_902464_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_163141512.1|902666_903840_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	37.0	3.3e-45
>prophage 5
NZ_CP044450	Acinetobacter indicus strain MMS9-2 chromosome, complete genome	3005353	1040773	1049626	3005353	tRNA	uncultured_Caudovirales_phage(50.0%)	10	NA	NA
WP_045794839.1|1040773_1041907_+	toxic anion resistance protein	NA	K4F9M7	Cronobacter_phage	22.8	2.8e-17
WP_075166954.1|1041950_1042865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163141629.1|1043065_1044631_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.8	3.9e-25
WP_005179080.1|1044766_1045021_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	46.6	2.0e-16
WP_163141632.1|1045024_1046416_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	64.7	4.7e-131
WP_163141635.1|1046560_1046989_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	59.9	1.5e-40
WP_005179068.1|1047073_1047391_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	64.4	7.9e-26
WP_016659186.1|1047395_1047869_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	53.8	3.0e-37
WP_163141638.1|1047872_1048922_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_163141641.1|1048921_1049626_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.1	5.3e-91
>prophage 6
NZ_CP044450	Acinetobacter indicus strain MMS9-2 chromosome, complete genome	3005353	1478192	1525617	3005353	holin,plate,transposase	Escherichia_phage(40.0%)	35	NA	NA
WP_005177908.1|1478192_1480229_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	26.1	9.3e-19
WP_035363085.1|1480460_1481045_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_171066688.1|1481062_1482538_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_104484587.1|1482554_1484222_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	30.2	1.8e-52
WP_005177899.1|1484381_1485155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163141871.1|1485185_1486577_-	sensor histidine kinase N-terminal domain-containing protein	NA	W8CYF6	Bacillus_phage	22.0	8.9e-05
WP_016658141.1|1486579_1487251_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_163141874.1|1487360_1489343_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_163141877.1|1489339_1490182_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_163141880.1|1490194_1490935_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016658146.1|1492256_1492460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163141883.1|1492613_1493621_-	OmpA family protein	NA	NA	NA	NA	NA
WP_104498181.1|1494281_1495268_+	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_163141885.1|1495296_1496325_+	methionine synthase	NA	NA	NA	NA	NA
WP_160232475.1|1496439_1496931_+	flavin reductase	NA	NA	NA	NA	NA
WP_045795662.1|1496972_1497773_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_163141888.1|1499797_1500889_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_092818107.1|1501148_1502123_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_075166713.1|1502465_1503428_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_048881927.1|1503443_1504463_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_163141892.1|1504464_1506000_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_075166715.1|1506011_1507412_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_163141896.1|1507423_1508209_+	acetoin reductase	NA	NA	NA	NA	NA
WP_075175505.1|1508230_1509289_+	2,3-butanediol dehydrogenase	NA	NA	NA	NA	NA
WP_104471312.1|1509619_1509856_-	DUF2132 domain-containing protein	NA	NA	NA	NA	NA
WP_163141898.1|1510153_1510669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015060273.1|1510930_1512265_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_163141901.1|1512699_1513473_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	56.6	7.0e-76
WP_163141904.1|1513472_1514492_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	46.4	2.8e-80
WP_075175237.1|1515821_1516589_-	OmpA family protein	NA	NA	NA	NA	NA
WP_005177824.1|1516590_1517550_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_127801016.1|1517581_1521397_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_127801017.1|1521437_1522856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127801018.1|1522852_1523848_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_127801019.1|1523811_1525617_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 7
NZ_CP044450	Acinetobacter indicus strain MMS9-2 chromosome, complete genome	3005353	2076469	2082394	3005353		Acinetobacter_phage(83.33%)	7	NA	NA
WP_171065072.1|2076469_2077045_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	93.7	1.0e-103
WP_016659977.1|2077064_2078111_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	87.1	5.2e-167
WP_005176475.1|2078128_2078935_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	85.1	1.2e-126
WP_005176474.1|2079141_2079825_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	75.5	7.0e-88
WP_005176473.1|2079918_2080467_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	95.1	3.4e-93
WP_005176472.1|2080563_2080920_+	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_163142483.1|2081032_2082394_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.8	9.9e-17
>prophage 8
NZ_CP044450	Acinetobacter indicus strain MMS9-2 chromosome, complete genome	3005353	2829802	2887583	3005353	tRNA,transposase	uncultured_Caudovirales_phage(26.67%)	53	NA	NA
WP_127799285.1|2829802_2831593_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	21.6	1.5e-17
WP_127799287.1|2831678_2832299_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_127799289.1|2832344_2833004_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_163143178.1|2833135_2834083_-	pirin family protein	NA	NA	NA	NA	NA
WP_016658966.1|2834401_2835670_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_163143181.1|2835706_2836477_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_004994718.1|2836497_2837523_+|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.4	2.0e-25
WP_016658965.1|2837939_2839508_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.3	8.7e-25
WP_016658964.1|2839728_2840145_-	DoxX family protein	NA	NA	NA	NA	NA
WP_005181345.1|2840338_2840977_+	DedA family protein	NA	NA	NA	NA	NA
WP_016658963.1|2840973_2841567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005181343.1|2841786_2842179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005181342.1|2842186_2843029_-	ParA family protein	NA	J9QE36	Clostridium_phage	25.7	4.0e-08
WP_045795567.1|2843109_2843502_-	SirB2 family protein	NA	NA	NA	NA	NA
WP_016658959.1|2843534_2843843_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_163143184.1|2844600_2844825_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000122748.1|2844940_2845150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163143187.1|2845169_2846354_+	DUF3596 domain-containing protein	NA	A0A1W6JTA0	Pseudomonas_phage	30.1	1.4e-38
WP_151203593.1|2846343_2846595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163143190.1|2846660_2847203_+	DUF1376 domain-containing protein	NA	NA	NA	NA	NA
WP_127801644.1|2847213_2847957_+	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	38.7	4.7e-45
WP_163143193.1|2848234_2851111_-	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
WP_163143195.1|2851139_2852051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163143198.1|2852068_2852920_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_163143201.1|2852929_2854126_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_163143204.1|2854125_2855694_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	56.2	5.8e-162
WP_127801940.1|2855919_2856963_-	HNH endonuclease	NA	A0A2I2MUI7	uncultured_Caudovirales_phage	63.7	5.9e-78
WP_016658949.1|2856965_2857556_-	class I SAM-dependent methyltransferase	NA	A0A2H4J5G6	uncultured_Caudovirales_phage	80.0	1.5e-30
WP_127801939.1|2857707_2858037_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_016658948.1|2858136_2858451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005180682.1|2859455_2860028_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	59.5	1.7e-55
WP_016658936.1|2860024_2861323_+	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	60.2	8.2e-154
WP_127801938.1|2861481_2861691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005180690.1|2861870_2862065_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_016658934.1|2862054_2863320_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_127801937.1|2863520_2863823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095706045.1|2863897_2865016_-	Fic family protein	NA	NA	NA	NA	NA
WP_095706048.1|2865356_2865671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127801936.1|2866199_2866592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163143207.1|2866736_2867923_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	53.0	2.2e-76
WP_163143210.1|2868596_2869271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127801909.1|2869271_2871545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163143213.1|2876078_2877257_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_075167882.1|2877319_2878093_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	57.0	1.4e-76
WP_139853747.1|2878092_2879112_-|transposase	IS21-like element ISAba8 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.8	1.4e-79
WP_127801904.1|2879459_2880137_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	32.0	5.8e-10
WP_163143216.1|2880413_2881061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163143219.1|2881174_2882299_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_015060273.1|2882509_2883844_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_163143509.1|2884010_2885336_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_163143224.1|2885412_2885727_-	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_130114512.1|2885713_2886001_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_127801714.1|2886257_2887583_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP044451	Acinetobacter indicus strain MMS9-2 plasmid pMMS9-2-1, complete sequence	121603	2687	75327	121603	integrase,transposase,protease	Escherichia_phage(15.38%)	56	38691:38750	52557:53080
WP_001067855.1|2687_3392_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_163143546.1|4038_4971_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	41.7	1.4e-59
WP_127800989.1|5591_6764_-	replication initiation protein	NA	NA	NA	NA	NA
WP_127800991.1|7620_8394_+	ParA family protein	NA	Q8JL10	Natrialba_phage	33.3	7.6e-14
WP_127800993.1|8407_9319_+	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	35.1	1.4e-14
WP_163143549.1|9749_10133_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_163143552.1|10129_10465_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_127801007.1|12536_14198_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	54.9	3.6e-170
WP_127801006.1|14708_14948_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000934717.1|16778_18044_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000366814.1|18043_18349_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004726728.1|19269_19527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004658347.1|19876_20473_-	putative adenosine monophosphate-protein transferase Fic	NA	NA	NA	NA	NA
WP_002125865.1|20485_20653_-	DUF2559 family protein	NA	NA	NA	NA	NA
WP_127800793.1|20969_21419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127800787.1|21405_23745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127800785.1|23749_26950_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000550047.1|27262_27481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159153749.1|27511_28894_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_005245164.1|29536_30736_+|integrase	tyrosine-type recombinase/integrase	integrase	E5AGD0	Erwinia_phage	29.3	2.6e-37
WP_127800879.1|31270_32002_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_127800877.1|31988_32876_+	cation transporter	NA	NA	NA	NA	NA
WP_004658363.1|33580_33832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004658364.1|34026_34248_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038350081.1|35842_36631_+	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_077170035.1|36757_37216_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_127800590.1|37450_38616_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	84.9	5.1e-139
38691:38750	attL	GGAGTGACGGGCACTGGCTGGCAATGTCTAGCAACGGCAGGCATTTCGGCTGAGGGTAAA	NA	NA	NA	NA
WP_001120888.1|38808_40302_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_082987283.1|40332_40578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163143555.1|40872_41250_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_064754130.1|41246_42410_+	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_077782102.1|42427_43288_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001067855.1|44346_45051_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_152342664.1|45189_45717_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	39.8	1.1e-27
WP_024160783.1|45906_47073_+	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_001366550.1|47221_47959_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|47955_48180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|48390_49884_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|49914_50799_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|51015_52230_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|52257_52563_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001120891.1|52674_53214_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
52557:53080	attR	GGAGTGACGGGCACTGGCTGGCAATGTCTAGCAACGGCAGGCATTTCGGCTGAGGGTAAAAGAACTTTCCGCTAAGCGATAGACTGTATGTAAACACAGTATTGCAAGGACGCGGAACATGCCTCATGTGGCGGCCAGGACGGCCAGCCGGGATCGGGATACTGGTCGTTACCAGAGCCACCGACCCGAGCAAACCCTTCTCTATCAGATCGTTGACGAGTATTACCCGGCATTCGCTGCGCTTATGGCAGAGCAGGGAAAGGAATTGCCGGGCTATGTGCAACGGGAATTTGAAGAATTTCTCCAATGCGGGCGGCTGGAGCATGGCTTTCTACGGGTTCGCTGCGAGTCTTGCCACGCCGAGCACCTGGTCGCTTTCAGCTGTAAGCGTCGCGGTTTCTGCCCGAGCTGTGGGGCGCGGCGGATGGCCGAAAGTGCCGCCTTGCTGGTTGATGAAGTACTGCCTGAACAACCCATGCGTCAGTGGGTGTTGAGCTTCCCGTTTCAGCTGCGTTTCCTGTTTG	NA	NA	NA	NA
WP_000480968.1|53185_54022_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_058199817.1|54333_55113_-	APH(3')-VI family aminoglycoside O-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	35.5	3.1e-31
WP_000480968.1|55517_56354_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|56353_57157_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|57217_58033_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001255534.1|59177_60410_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000506885.1|60681_61011_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_152342638.1|61219_62086_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_152342637.1|62096_62708_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_002010699.1|62724_63300_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_152342636.1|63341_67022_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_152342635.1|67068_70590_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	A0A2R2ZGH5	Clostridioides_phage	22.1	6.3e-07
WP_163143558.1|70633_73258_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_016658780.1|73287_75327_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
