The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	68672	134902	6361125	tRNA,integrase,capsid,tail,head,terminase,transposase,plate,protease,portal	Vibrio_phage(11.43%)	80	70595:70613	133938:133956
WP_163830697.1|68672_69647_-|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	29.0	6.2e-05
WP_163830698.1|69745_70255_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.4	4.7e-20
70595:70613	attL	TAAGTAAGCTTAAGTTGCT	NA	NA	NA	NA
WP_163830699.1|70853_71882_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	61.4	3.7e-08
WP_163836340.1|71957_73130_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	37.9	1.1e-32
WP_163830700.1|73251_73758_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.4	6.5e-22
WP_163830701.1|73770_74325_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_163830702.1|74560_75469_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_163830703.1|75485_76304_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_163830704.1|76709_77951_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163830705.1|78664_79600_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_163830706.1|79797_80685_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163830707.1|80791_80980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163830708.1|80958_81330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163830709.1|81390_81699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163830710.1|81978_83220_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_163830711.1|83316_83901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163830712.1|84023_85067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163830713.1|85313_86246_-	hypothetical protein	NA	D4HTW7	Vibrio_phage	38.5	5.5e-51
WP_163830714.1|86415_86883_-|tail	tail fiber domain-containing protein	tail	A4ZRC7	Synechococcus_virus	35.5	9.2e-07
WP_163830715.1|87097_87301_-|tail	phage tail protein	tail	A0A193GYC8	Enterobacter_phage	49.1	6.8e-07
WP_163830716.1|87269_87677_-|tail	phage tail protein	tail	E5E3U5	Burkholderia_phage	33.1	1.4e-14
WP_163830717.1|87673_89674_-	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	40.2	2.1e-31
WP_163830718.1|89900_90173_-|tail	phage tail assembly protein	tail	Q75QK8	Wolbachia_phage	35.1	1.5e-09
WP_163830719.1|90233_90737_-|tail	phage major tail tube protein	tail	A0A1B2LRS4	Wolbachia_phage	41.1	8.9e-32
WP_163830720.1|90726_91887_-|tail	phage tail protein	tail	D4HTW1	Vibrio_phage	58.7	2.3e-131
WP_163830721.1|91951_92722_-	hypothetical protein	NA	K7R2Q5	Vibrio_phage	25.0	3.1e-07
WP_163830722.1|92721_93252_-|tail	phage tail protein	tail	A2I2X8	Vibrio_virus	38.3	4.4e-21
WP_163830723.1|93260_93872_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	41.8	2.0e-30
WP_163830724.1|93899_94796_-|plate	baseplate assembly protein	plate	A0A088FQL4	Escherichia_phage	52.2	3.6e-76
WP_163830725.1|94792_95128_-|plate	phage baseplate protein	plate	A0A088FV58	Escherichia_phage	64.0	3.2e-33
WP_163830726.1|95198_95456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163830727.1|95542_96115_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	41.2	2.7e-24
WP_163830728.1|96089_96950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163830729.1|96942_97353_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_163830730.1|97342_97663_-|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	40.6	7.7e-13
WP_163830731.1|97659_97968_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2D1GNK0	Pseudomonas_phage	39.4	4.6e-15
WP_163830732.1|98112_98304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163830733.1|98350_99562_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	52.1	5.5e-112
WP_163830734.1|99566_100217_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	58.0	5.9e-60
WP_163830735.1|100203_101412_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	50.1	3.6e-111
WP_163830736.1|101408_103103_-|terminase	terminase large subunit	terminase	G3EN96	Psychrobacter_phage	54.7	9.3e-182
WP_163830737.1|103099_103558_-|terminase	phage terminase small subunit P27 family	terminase	A0A0R6PKJ2	Moraxella_phage	50.7	1.1e-39
WP_163830738.1|103719_104085_-	HNH endonuclease	NA	Q8W6N0	Burkholderia_virus	44.4	1.6e-22
WP_163830739.1|104239_104974_-	phage repressor protein/antirepressor Ant	NA	A0A0A8WIE3	Clostridium_phage	37.9	4.8e-34
WP_163830740.1|105045_105267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163830741.1|105583_106741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163830742.1|106812_107205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163830743.1|107173_107353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163830744.1|107336_107759_-	N-acetylmuramoyl-L-alanine amidase	NA	I6R9Z4	Marinomonas_phage	58.1	9.8e-40
WP_163830745.1|107761_107935_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_163830746.1|108109_108430_-	XRE family transcriptional regulator	NA	A0A0D5BHH6	Escherichia_phage	35.7	1.8e-09
WP_163830747.1|108583_108973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163830748.1|109068_109626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836341.1|109865_110183_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.9	2.1e-26
WP_163830749.1|110358_110622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163830750.1|110618_110978_-	recombinase	NA	NA	NA	NA	NA
WP_163830751.1|111762_112173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163830752.1|112297_113026_-	Replication protein P	NA	B5WZY0	Pseudomonas_phage	45.5	4.9e-39
WP_163830753.1|113028_113340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163830754.1|113344_113875_-	winged helix-turn-helix transcriptional regulator	NA	H9C164	Pectobacterium_phage	39.0	3.7e-12
WP_163830755.1|114465_114885_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_163830756.1|115130_115571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163830757.1|115540_116047_+	recombination-associated protein RdgC	NA	NA	NA	NA	NA
WP_163830758.1|116049_116250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163830759.1|116357_116573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163830760.1|116593_116995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163830761.1|116997_117333_+	carbon storage regulator	NA	NA	NA	NA	NA
WP_163830762.1|117349_117754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163830763.1|117789_118710_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_163836342.1|119071_119464_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_163830764.1|125368_126412_+	ADP-ribosylglycohydrolase family protein	NA	G3M9X5	Bacillus_virus	26.4	4.3e-12
WP_163830765.1|126516_127008_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_163830766.1|127035_128355_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_163830767.1|128369_129071_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_163830768.1|129342_129696_+	VOC family protein	NA	NA	NA	NA	NA
WP_163830769.1|129682_130345_-	DUF4360 domain-containing protein	NA	NA	NA	NA	NA
WP_163830770.1|130697_131834_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_163830771.1|131948_132368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836343.1|133212_133944_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_163836344.1|134119_134902_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	28.0	2.3e-10
133938:133956	attR	TAAGTAAGCTTAAGTTGCT	NA	NA	NA	NA
>prophage 2
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	395384	428497	6361125	transposase,integrase,protease	Morganella_phage(33.33%)	35	410018:410077	428663:428730
WP_163830705.1|395384_396320_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_163831092.1|396428_396677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831093.1|396832_397396_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_163831095.1|397411_397855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163830996.1|397917_399063_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_163831097.1|399322_400123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831099.1|400202_400814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831101.1|401375_401630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831103.1|401795_402350_+	ribosomal protein S5-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_163831105.1|402409_402976_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_163831107.1|403065_404007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831109.1|404165_404807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831111.1|404902_406030_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_163831113.1|406153_408382_+	AsmA family protein	NA	NA	NA	NA	NA
WP_163831115.1|408381_409443_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_163831117.1|409483_409762_+	oxidative damage protection protein	NA	NA	NA	NA	NA
410018:410077	attL	TTGGTAGACACGCTGTCTTCAGGTGGCAGTGCCTTCGGGCGTGGGAGTTCGAGTCTCCCC	NA	NA	NA	NA
WP_163831119.1|410542_411454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831121.1|411619_412126_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_163836355.1|412164_412677_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_163831123.1|413575_413950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831124.1|414183_414525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831126.1|414538_414835_-	Bro-N domain-containing protein	NA	NA	NA	NA	NA
WP_163831128.1|416804_417215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831130.1|417411_418119_-	hypothetical protein	NA	A0A1W6JP13	Morganella_phage	44.4	9.0e-30
WP_163831132.1|418381_419167_-	hypothetical protein	NA	A0A0A8WIG2	Clostridium_phage	36.6	9.4e-28
WP_163831134.1|419367_419988_-	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_163831136.1|420217_420430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831138.1|420537_420774_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_163831140.1|420872_421433_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	71.5	3.1e-41
WP_163831143.1|421973_422981_-|protease	serine protease	protease	NA	NA	NA	NA
WP_163831145.1|423340_425248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831147.1|425256_425643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831148.1|425685_426198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831150.1|426485_427145_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_163831151.1|427219_428497_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
428663:428730	attR	TTGGTAGACACGCTGTCTTCAGGTGGCAGTGCCTTCGGGCGTGGGAGTTCGAGTCTCCCCTTCGGCAC	NA	NA	NA	NA
>prophage 3
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	901002	1010503	6361125	integrase,capsid,tail,head,terminase,transposase,plate,protease,portal	Pseudomonas_phage(43.33%)	113	900925:900984	1002684:1003716
900925:900984	attL	CCTAATTATCACTATACCTAAGCCATTAACTGCTGTATATTTGAACAGCATGGAAACTTA	NA	NA	NA	NA
WP_163830705.1|901002_901938_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_163831816.1|902303_904064_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	41.6	6.2e-120
WP_163831817.1|904571_904727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831818.1|905305_905737_+	flavin reductase	NA	NA	NA	NA	NA
WP_163836380.1|905869_906157_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_163831819.1|906506_907523_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_163831820.1|907741_908740_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_163831821.1|908764_909310_+	redoxin family protein	NA	NA	NA	NA	NA
WP_163831822.1|911209_911395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836381.1|911706_911970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831823.1|912488_912665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831824.1|913273_913534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163830705.1|914446_915382_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_163831825.1|916058_916631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831826.1|916638_917205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831827.1|917494_917920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831828.1|917916_918576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831829.1|918585_920418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831830.1|921095_921578_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_163831831.1|921834_922317_-	ester cyclase	NA	NA	NA	NA	NA
WP_163831832.1|922564_922987_-	response regulator	NA	NA	NA	NA	NA
WP_163831833.1|923614_924247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831834.1|924342_924663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831835.1|924729_925146_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_163831836.1|925217_925589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831837.1|925641_925938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836382.1|926021_926294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831838.1|926323_926581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831839.1|926676_927048_+	hypothetical protein	NA	A0A0U4IBV2	Pseudomonas_phage	36.4	2.9e-11
WP_163831840.1|927066_927624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831841.1|928527_929007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831842.1|929074_929407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831843.1|929478_930036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831844.1|930113_930515_+	DUF4259 domain-containing protein	NA	NA	NA	NA	NA
WP_163831845.1|931059_931230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831846.1|931237_931609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831847.1|931734_932025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836383.1|932309_933110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831848.1|933113_933593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831849.1|934054_934633_+	hypothetical protein	NA	B5TRA6	Bacteroides_phage	28.2	1.9e-09
WP_163831850.1|934638_934968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831851.1|935495_935867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836384.1|936113_937481_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_163831852.1|937816_939001_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_163831853.1|939000_939624_-	helix-turn-helix domain-containing protein	NA	A0SML1	Pseudomonas_virus	26.2	4.8e-11
WP_163831854.1|939790_940054_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_163831855.1|940070_942752_+	hypothetical protein	NA	A0A0U3TH43	Pseudomonas_phage	37.6	4.9e-161
WP_163831856.1|943143_943446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831857.1|943459_943735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831858.1|943767_943995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831859.1|944385_944910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831860.1|945245_945587_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_163831861.1|945843_946071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836385.1|946089_946344_-	ogr/Delta-like zinc finger family protein	NA	A5X9H0	Aeromonas_virus	46.2	1.4e-12
WP_163831862.1|946431_947439_-|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	43.7	2.5e-73
WP_163831863.1|947444_949196_-|terminase	terminase	terminase	A0A0U4JIZ9	Pseudomonas_phage	52.5	3.9e-167
WP_163831864.1|949203_949401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831865.1|949399_950233_+|capsid	capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	38.8	4.2e-26
WP_163831866.1|950232_951243_+|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	49.5	7.4e-86
WP_163831867.1|951308_951926_+	hypothetical protein	NA	A0A0U4JEJ1	Pseudomonas_phage	33.7	3.4e-25
WP_163831868.1|952043_952502_+|head	head completion/stabilization protein	head	NA	NA	NA	NA
WP_163831869.1|952498_952954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831870.1|952937_953600_+	virion morphogenesis protein	NA	NA	NA	NA	NA
WP_163831871.1|953604_954720_+	DUF2586 family protein	NA	A0A0U4KLE6	Pseudomonas_phage	55.2	3.5e-113
WP_163831872.1|954723_955182_+	DUF2597 family protein	NA	A0A0U3TH58	Pseudomonas_phage	62.8	9.6e-49
WP_163831873.1|955215_955614_+	DUF882 domain-containing protein	NA	A0A1D9C9S9	Salinivibrio_phage	50.7	7.1e-32
WP_163836386.1|955639_956095_+	hypothetical protein	NA	A0A2I7R241	Vibrio_phage	51.7	7.1e-36
WP_163831874.1|956084_956351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831875.1|956343_956628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831876.1|956835_959007_+|tail	phage tail tape measure protein	tail	U3PFL8	Vibrio_phage	55.8	1.8e-121
WP_163831877.1|959006_959333_+	DUF2590 family protein	NA	A0A0U4B0N5	Pseudomonas_phage	57.0	3.4e-24
WP_163831878.1|959316_960489_+	hypothetical protein	NA	A0A0U4JJ14	Pseudomonas_phage	57.0	1.2e-127
WP_163831879.1|960481_961078_+|tail	phage tail protein	tail	A0A0U4JVX3	Pseudomonas_phage	61.5	1.2e-59
WP_163831880.1|961108_962824_+|tail	phage tail protein	tail	A0A0U4K5K2	Pseudomonas_phage	45.5	2.0e-59
WP_163831881.1|962826_963705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831882.1|963701_964280_+	DNA-binding protein	NA	A0A0U4J942	Pseudomonas_phage	44.1	1.4e-28
WP_163831883.1|964221_964905_+	hypothetical protein	NA	A0A2I7RNK1	Vibrio_phage	40.2	8.7e-46
WP_163831884.1|964898_965849_+	hypothetical protein	NA	A0A0U4IBV2	Pseudomonas_phage	42.0	2.7e-61
WP_163831885.1|965989_966412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831886.1|966841_967453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831887.1|968219_969263_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_163831888.1|969259_970252_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_163831889.1|972311_972599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831890.1|972805_973138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831891.1|973235_973673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831892.1|974137_974716_+	hypothetical protein	NA	B5TRA6	Bacteroides_phage	28.3	2.5e-09
WP_163831893.1|974721_975051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831894.1|976186_978310_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_163831895.1|978313_978811_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_163831896.1|978878_980216_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_163831897.1|980231_981218_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_163831898.1|981263_984806_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_163831899.1|984882_985638_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_163831900.1|985647_986403_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_163831901.1|986485_989140_+	serine/threonine protein kinase	NA	A0A1M7XUH0	Cedratvirus	25.8	4.0e-14
WP_163831902.1|989235_990063_-|protease	serine protease	protease	G9E4M4	Emiliania_huxleyi_virus	27.6	1.1e-07
WP_163831903.1|990736_991252_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_163831904.1|991331_992126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831905.1|992457_994533_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.1	1.7e-39
WP_163831906.1|994567_995500_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_163831907.1|995709_999831_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	42.5	1.9e-34
WP_163831908.1|999832_1000240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836387.1|1000387_1000786_+	hypothetical protein	NA	M1PY53	Moumouvirus	33.0	2.3e-06
WP_163831909.1|1001037_1002018_+	DUF2156 domain-containing protein	NA	NA	NA	NA	NA
WP_163831910.1|1002030_1002495_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_163830705.1|1002761_1003697_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_163831911.1|1003769_1004030_-	hypothetical protein	NA	NA	NA	NA	NA
1002684:1003716	attR	CCTAATTATCACTATACCTAAGCCATTAACTGCTGTATATTTGAACAGCATGGAAACTTAATTGAGAAGGTATAAATAATGGCTATCAACAAAGTTCAATTTCAAAAAGGCCTGAGTTTAAACGAGTTTCTCAAACAATATGGTACAGAAGAACAATGCTTTAATACCTTATACAAATTGCGATGGCCAGAAGGTTTTCAGTGCCCCAATTGTGGATACGACAAATGCTGTCAACTCACTACTAGAAAGCTTCAGCAGTGCTATAAATGTCACCAGCAAACATCTGTAACTGCAGGTACTATCTTTGAATCAACCAAATTACCATTAAAGACTTGGTTCCAAGGGATGTATTTGATCTCCCAAGACAAAAAAGGTATATCAGCCATAGAATTACATCGCCATTTAGGTATTTCCTATCAAGCTGCCTGGAGAATGAAACATAAGCTCATGAAAGTGATGCAAGAAAGAGAAGGCACCAAGCAATTGTCGGGTTTTATTGAAATTGATGATGCCTATCTTGGTGGTGAGCGTACAGGTTGCAAAAGAGGTAGGGGAGCAGATGGGAAAATACCTTTTGTAGCAGCCGTAGAAACAACAAAACAAGGTCAACCGACACGAATTAAACTGAGCATTTTAAAAGGGTTTAATAAAGAAGAGATAACGGCTTGGAGTAGGCAGAATTTGGCCAAGGGCAGTACCGTAATCTCCGATGGACTGGCCTGTTTTAATGGTGTCATAGAAGCAGGTTGTCTTCATGATAAAATTGTATGCGGTGGTGGTCGTGCATCAGTAGAGGAACCTGAATTTTATTGGGTTAACACCATCCTTGGAAACTTAAAAAGTGCTTTACGTAGTACTTATCATGCTATTCGCGCTAAATATGCACAACGTTATCTTGCTGAATTTCAGTATCGATTTAATCGAAGATTTAGCTTAGTAGAATTTATTCCTAGGCTAGCATTTGTAGCACTGAGAACACCTCCACTACCAGGTAAGCTACTAAATATAGCTTAGGTATGATGATAATTAGGTA	NA	NA	NA	NA
WP_163831912.1|1004223_1006071_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_163831913.1|1006258_1007011_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163831914.1|1007101_1007440_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_163830641.1|1007700_1007886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831915.1|1008000_1009344_-	VWA domain-containing protein	NA	A0A2D1GNA9	Pseudoalteromonas_phage	30.3	1.2e-14
WP_163830996.1|1009357_1010503_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	1038762	1113090	6361125	tRNA,integrase,protease,transposase	Diachasmimorpha_longicaudata_entomopoxvirus(20.0%)	54	1046613:1046628	1120093:1120108
WP_163836388.1|1038762_1039494_+|tRNA	alanyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_163831942.1|1039486_1040860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831943.1|1040887_1041460_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_163831944.1|1041643_1041931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831945.1|1042069_1042813_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163831946.1|1043025_1044810_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	3.6e-51
WP_163831947.1|1044964_1046209_-	hypothetical protein	NA	NA	NA	NA	NA
1046613:1046628	attL	CCAGGAATTAATGAAA	NA	NA	NA	NA
WP_163831948.1|1046749_1047094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163830996.1|1047147_1048293_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_163830996.1|1049639_1050785_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_163831949.1|1051074_1051620_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_163831950.1|1051775_1054118_+	phosphoenolpyruvate synthase	NA	NA	NA	NA	NA
WP_163831951.1|1054089_1055565_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_163831952.1|1055538_1056156_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_163831953.1|1056326_1056578_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_163831954.1|1056588_1057311_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_163831955.1|1057359_1057788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831956.1|1059630_1060266_+	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_163831957.1|1060469_1061456_-	YHYH protein	NA	NA	NA	NA	NA
WP_163831958.1|1061707_1063294_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_163831959.1|1063905_1065474_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_163831960.1|1065952_1067473_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_163831961.1|1067801_1069169_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_163831962.1|1069165_1072264_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_163831963.1|1072542_1074984_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.1	2.2e-19
WP_163831964.1|1074996_1075743_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163831965.1|1075912_1079050_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_163831966.1|1079088_1080252_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_163831967.1|1080486_1080969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831968.1|1081102_1081909_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163831969.1|1081999_1082401_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_163831970.1|1082448_1083174_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_163831971.1|1083293_1083989_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_163831972.1|1084384_1085038_+	RNA ligase family protein	NA	A0A292GKV8	Xanthomonas_phage	51.5	3.5e-60
WP_163831973.1|1085040_1085865_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_163836389.1|1085952_1087023_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_163831974.1|1087259_1088693_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_163831975.1|1089017_1090043_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_163831976.1|1090108_1091611_-	DUF4173 domain-containing protein	NA	NA	NA	NA	NA
WP_163831977.1|1091753_1094591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831978.1|1095067_1095700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163831979.1|1097873_1099157_-	OprD family porin	NA	NA	NA	NA	NA
WP_163831980.1|1099459_1099897_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_163831981.1|1100133_1101228_-	peptidase M42	NA	NA	NA	NA	NA
WP_163831982.1|1101375_1102737_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_163831983.1|1102893_1103916_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_163831984.1|1104204_1105830_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_163831985.1|1105834_1106752_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	33.6	6.5e-12
WP_163831986.1|1106779_1107592_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_163831987.1|1107624_1108506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163831988.1|1108757_1110161_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_163831989.1|1110242_1110662_+	GFA family protein	NA	NA	NA	NA	NA
WP_163831990.1|1110769_1112101_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_163831991.1|1112097_1113090_-|integrase	site-specific integrase	integrase	M1HMA3	Pelagibacter_phage	33.9	4.4e-30
1120093:1120108	attR	TTTCATTAATTCCTGG	NA	NA	NA	NA
>prophage 5
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	1129636	1144167	6361125	tail	Ralstonia_phage(40.0%)	22	NA	NA
WP_163832013.1|1129636_1130092_-	hypothetical protein	NA	A0A2R2ZGD5	Ralstonia_phage	32.4	6.9e-15
WP_163832014.1|1130188_1130506_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_163832015.1|1130818_1130959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832016.1|1131007_1131331_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_163832017.1|1131335_1134101_-	hypothetical protein	NA	L7TLW2	Rhizobium_phage	33.5	1.0e-145
WP_163832018.1|1134100_1134631_-	hypothetical protein	NA	A0A076YQK3	Mesorhizobium_phage	37.6	8.3e-20
WP_163832019.1|1134715_1134943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832020.1|1134983_1136021_-	hypothetical protein	NA	M1HMB6	Pelagibacter_phage	30.5	2.2e-32
WP_163832021.1|1136086_1136767_-	hypothetical protein	NA	E3SQM5	Cyanophage	36.3	3.3e-21
WP_163832022.1|1136770_1138315_-|tail	phage tail protein	tail	A0A2R2ZGG8	Ralstonia_phage	49.4	5.0e-126
WP_163832023.1|1138318_1138552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832024.1|1138551_1138737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832025.1|1138736_1138874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832026.1|1138873_1139032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832027.1|1139024_1139564_-	DUF3310 domain-containing protein	NA	A0A1D8KUM9	Synechococcus_phage	38.4	2.7e-10
WP_163832028.1|1139650_1140487_-	exonuclease	NA	A0A2R2ZGE9	Ralstonia_phage	43.4	5.3e-53
WP_163832029.1|1140476_1140656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832030.1|1140670_1140865_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_163832031.1|1141045_1141417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832032.1|1141596_1142025_-	cell wall hydrolase	NA	A0A218MLD1	uncultured_virus	42.8	5.5e-22
WP_163832033.1|1142071_1142293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832034.1|1142289_1144167_-	DNA polymerase	NA	A0A2R2ZGG6	Ralstonia_phage	45.2	4.2e-151
>prophage 6
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	1213313	1239698	6361125	transposase,tail	Synechococcus_phage(50.0%)	28	NA	NA
WP_163836393.1|1213313_1213721_-|tail	tail fiber domain-containing protein	tail	A0A0E3HHC2	Synechococcus_phage	47.2	5.2e-14
WP_163832098.1|1215401_1217045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832099.1|1217650_1218433_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163832100.1|1218626_1219493_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163832101.1|1220252_1221458_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_163832102.1|1222018_1222357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832103.1|1222420_1223227_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_163832104.1|1223623_1224352_+	DsbC family protein	NA	NA	NA	NA	NA
WP_163832105.1|1224937_1225438_+	DUF4234 domain-containing protein	NA	NA	NA	NA	NA
WP_163832106.1|1225512_1225665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832107.1|1225928_1226186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832108.1|1226230_1226425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832109.1|1227075_1227678_-	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_163832110.1|1227789_1227942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832111.1|1228265_1228433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832112.1|1228972_1229740_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_163832113.1|1229726_1230515_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_163832114.1|1230810_1231119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832115.1|1231261_1231741_-|tail	tail fiber domain-containing protein	tail	A0A0E3HHC2	Synechococcus_phage	48.1	1.3e-16
WP_163832116.1|1232747_1233230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836389.1|1233679_1234750_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_163832117.1|1235493_1236054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832118.1|1236228_1236993_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163832119.1|1237467_1237665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832120.1|1238022_1238334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832121.1|1238553_1239000_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	50.0	7.2e-33
WP_163836394.1|1238972_1239368_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	37.6	5.6e-13
WP_163832122.1|1239518_1239698_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	1244348	1329070	6361125	integrase,capsid,tail,head,terminase,transposase,plate,portal	Vibrio_phage(15.38%)	106	1258736:1258759	1329272:1329295
WP_163832128.1|1244348_1244672_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_163836395.1|1245166_1245475_+	DUF2007 domain-containing protein	NA	NA	NA	NA	NA
WP_163832129.1|1245763_1247572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832130.1|1247586_1248249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832131.1|1248700_1249066_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_163832132.1|1249148_1250984_+	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_163832133.1|1252172_1253072_-	DUF2167 domain-containing protein	NA	NA	NA	NA	NA
WP_163836355.1|1253097_1253610_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_163831121.1|1253648_1254155_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_163832134.1|1254637_1254913_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_163832135.1|1255344_1255848_+	DUF4234 domain-containing protein	NA	NA	NA	NA	NA
WP_163832136.1|1256339_1257026_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163832137.1|1257185_1258337_-|integrase	tyrosine-type recombinase/integrase	integrase	I6PDJ1	Cronobacter_phage	33.1	5.6e-45
WP_163836396.1|1258343_1258535_-	excisionase	NA	NA	NA	NA	NA
1258736:1258759	attL	TCTCCTTAACTCATTACCCCAATA	NA	NA	NA	NA
WP_163832138.1|1258740_1259076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832139.1|1259174_1259645_+	hypothetical protein	NA	W6MVG8	Pseudomonas_phage	46.7	2.4e-23
WP_163832140.1|1259669_1260149_+	hypothetical protein	NA	A0A0U4IBV2	Pseudomonas_phage	43.2	1.4e-18
WP_163832141.1|1260417_1260642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832142.1|1260720_1261218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832143.1|1261487_1262012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832144.1|1262696_1263752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163830705.1|1263998_1264934_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_163836355.1|1265105_1265618_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_163832145.1|1265656_1266163_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_163830705.1|1266945_1267881_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_163832146.1|1268170_1268395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832147.1|1268802_1269048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832145.1|1269101_1269608_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_163836397.1|1269646_1270159_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_163832148.1|1270359_1271232_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_163832149.1|1271563_1272292_+	DsbC family protein	NA	NA	NA	NA	NA
WP_163832150.1|1272325_1272463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832151.1|1272873_1275564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832152.1|1276026_1276794_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163832153.1|1277076_1277313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832154.1|1277853_1278198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832155.1|1278235_1278475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832156.1|1278588_1278951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832157.1|1279073_1279604_+	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_163832158.1|1279603_1280254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832159.1|1280572_1280956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832160.1|1281020_1281410_-	DUF3574 domain-containing protein	NA	M1PJL2	Synechococcus_phage	35.6	3.1e-08
WP_163832161.1|1281476_1282412_-	hypothetical protein	NA	D4HTW7	Vibrio_phage	39.0	1.1e-51
WP_163832162.1|1282494_1283274_+	hypothetical protein	NA	A0A2I7SAB9	Vibrio_phage	28.0	5.9e-06
WP_163832163.1|1283262_1283466_-|tail	phage tail protein	tail	R9TR63	Vibrio_phage	52.9	2.0e-11
WP_163832164.1|1283434_1283842_-|tail	phage tail protein	tail	E5E3U5	Burkholderia_phage	32.8	1.0e-14
WP_163832165.1|1283838_1285839_-	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	40.2	5.5e-32
WP_163832166.1|1285942_1286215_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_163830719.1|1286273_1286777_-|tail	phage major tail tube protein	tail	A0A1B2LRS4	Wolbachia_phage	41.1	8.9e-32
WP_163832167.1|1286766_1287963_-|tail	phage tail protein	tail	D4HTW1	Vibrio_phage	57.8	8.4e-129
WP_163832168.1|1288023_1289340_-|tail	phage tail protein	tail	A0A2H4J039	uncultured_Caudovirales_phage	48.6	4.4e-38
WP_163832169.1|1289342_1290038_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	42.0	6.3e-36
WP_163832170.1|1290042_1290939_-|plate	baseplate assembly protein	plate	A0A088FQL4	Escherichia_phage	52.5	3.3e-77
WP_163832171.1|1290935_1291271_-	hypothetical protein	NA	A0A088FV58	Escherichia_phage	64.0	4.1e-33
WP_163832172.1|1291329_1291701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832173.1|1291788_1292361_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	41.2	1.6e-24
WP_163832174.1|1292335_1292863_-	hypothetical protein	NA	Q8H9N6	Vibrio_phage	24.2	4.5e-10
WP_163832175.1|1292855_1293383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832176.1|1293379_1293706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832177.1|1293702_1294725_-|capsid	major capsid protein	capsid	Q6UYI3	Burkholderia_phage	36.4	8.7e-50
WP_163832178.1|1294813_1295182_-|head	head decoration protein	head	NA	NA	NA	NA
WP_163832179.1|1295181_1296444_-	S49 family peptidase	NA	A0A1I9KF73	Aeromonas_phage	38.9	1.3e-68
WP_163832180.1|1296776_1296953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832181.1|1297177_1298680_-|portal	phage portal protein	portal	A0A2D1GMV5	Marinobacter_phage	48.1	1.1e-114
WP_163832182.1|1298679_1298880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832183.1|1298876_1300343_-	hypothetical protein	NA	A5LH27	Enterobacteria_phage	49.0	3.5e-129
WP_163830705.1|1300367_1301303_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_163832184.1|1301376_1302006_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	51.3	3.9e-61
WP_163832185.1|1301968_1302139_-	DUF1441 family protein	NA	NA	NA	NA	NA
WP_163832186.1|1302092_1302422_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	37.4	1.8e-09
WP_163832187.1|1302742_1303462_-	phage antirepressor Ant	NA	A0A0C5AEJ9	Bacteriophage	39.7	1.0e-36
WP_163832188.1|1303729_1304020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832189.1|1304008_1304251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832190.1|1304262_1304670_-	hypothetical protein	NA	A0A218MKV5	uncultured_virus	43.8	6.6e-09
WP_163832191.1|1304737_1305199_-|tail	tail fiber domain-containing protein	tail	A0A0E3HHC2	Synechococcus_phage	45.5	7.0e-15
WP_163832192.1|1305263_1305656_-|tail	tail fiber domain-containing protein	tail	A0A0E3HHC2	Synechococcus_phage	50.0	1.4e-16
WP_163832193.1|1305837_1306230_-	N-acetylmuramoyl-L-alanine amidase	NA	I6R9Z4	Marinomonas_phage	57.5	5.1e-43
WP_163832194.1|1306432_1306915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832195.1|1306986_1307622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832196.1|1307689_1308025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832197.1|1308272_1308866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832198.1|1308873_1309254_-	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	51.6	8.5e-27
WP_163832199.1|1309260_1309431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832200.1|1309789_1312012_-	DUF3987 domain-containing protein	NA	A0A173H0P8	Pseudoalteromonas_phage	38.7	6.9e-84
WP_163832201.1|1312356_1312794_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	47.5	3.5e-08
WP_163832202.1|1312938_1313328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832203.1|1313339_1314254_+	recombination-associated protein RdgC	NA	M4MHA9	Vibrio_phage	23.7	1.6e-15
WP_163832204.1|1314250_1314460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832205.1|1314543_1314960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832206.1|1314962_1315715_+	ATP-binding protein	NA	B4UTW5	Rhizobium_phage	39.5	2.4e-41
WP_163832207.1|1315726_1316305_+	DUF669 domain-containing protein	NA	A0A2H4GYE1	Pseudomonas_phage	33.8	1.5e-19
WP_163832208.1|1316502_1317543_+	oxidoreductase	NA	A0A173H0P7	Pseudoalteromonas_phage	48.2	8.5e-85
WP_163832209.1|1317539_1319165_+	DEAD/DEAH box helicase family protein	NA	A0A172PZU9	Pseudomonas_phage	38.8	2.7e-98
WP_163832210.1|1319154_1319388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832211.1|1319397_1319703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832212.1|1319713_1319908_+	excisionase	NA	NA	NA	NA	NA
WP_163832213.1|1319907_1321089_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	37.2	3.2e-64
WP_163832214.1|1321081_1321276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832215.1|1321652_1322294_+	GTP cyclohydrolase	NA	A0A1V0SE20	Indivirus	41.6	4.5e-20
WP_163836398.1|1322535_1323114_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_163832216.1|1323110_1323686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832217.1|1324518_1325022_+	YcxB family protein	NA	NA	NA	NA	NA
WP_163832218.1|1325710_1326103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832219.1|1326156_1326486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832220.1|1327324_1327876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832221.1|1327915_1329070_-|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	39.0	3.2e-69
1329272:1329295	attR	TCTCCTTAACTCATTACCCCAATA	NA	NA	NA	NA
>prophage 8
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	1333113	1368304	6361125	integrase,capsid,tail,head,terminase,portal	Pseudomonas_phage(48.0%)	44	1329674:1329687	1369521:1369534
1329674:1329687	attL	GAACTTAATTAAAT	NA	NA	NA	NA
WP_163832230.1|1333113_1334028_+	replication protein	NA	S4TNJ9	Salmonella_phage	39.6	7.1e-11
WP_163832231.1|1334038_1334782_+	Replication protein P	NA	A0A1J0GUU6	Halomonas_phage	31.0	3.7e-18
WP_163832232.1|1334778_1335006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832233.1|1335244_1335580_-	bacteriophage CI repressor	NA	NA	NA	NA	NA
WP_163832234.1|1335819_1336020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832235.1|1336043_1336298_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_163836399.1|1336359_1337298_-|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	44.2	2.5e-72
WP_163832236.1|1337387_1339136_-|terminase	terminase	terminase	A0A0U4JIZ9	Pseudomonas_phage	52.7	1.5e-171
WP_163832237.1|1339237_1339384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832238.1|1339382_1340219_+|capsid	capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	44.2	5.1e-24
WP_163832239.1|1340218_1341232_+|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	48.9	6.1e-88
WP_163832240.1|1341231_1341906_+	hypothetical protein	NA	A0A0U4JEJ1	Pseudomonas_phage	35.0	9.8e-26
WP_163832241.1|1342018_1342477_+|head	head completion/stabilization protein	head	A4PE32	Ralstonia_virus	24.1	5.9e-06
WP_163832242.1|1342473_1342926_+	hypothetical protein	NA	A0A0U4IBS7	Pseudomonas_phage	34.7	2.3e-18
WP_163832243.1|1342909_1343572_+	virion morphogenesis protein	NA	NA	NA	NA	NA
WP_163832244.1|1343577_1344693_+	DUF2586 family protein	NA	A0A0U4KLE6	Pseudomonas_phage	54.4	1.8e-112
WP_163832245.1|1344696_1345143_+	DUF2597 family protein	NA	A0A0U3TH58	Pseudomonas_phage	64.4	7.6e-51
WP_163832246.1|1345145_1345520_+	peptidase M15	NA	A0A218MM71	uncultured_virus	51.6	2.5e-31
WP_163832247.1|1345523_1346006_+	hypothetical protein	NA	A0A2I7R2B5	Vibrio_phage	49.7	1.5e-36
WP_163832248.1|1345992_1346289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832249.1|1346285_1346570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163830642.1|1346584_1346734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832250.1|1346745_1348758_+|tail	phage tail tape measure protein	tail	A0A2I7RNI7	Vibrio_phage	48.1	4.0e-115
WP_163832251.1|1348757_1349084_+	DUF2590 family protein	NA	A0A0U4B0N5	Pseudomonas_phage	56.0	2.4e-22
WP_163832252.1|1349067_1350240_+	hypothetical protein	NA	A0A0U4JJ14	Pseudomonas_phage	55.7	1.0e-123
WP_163832253.1|1350232_1350829_+|tail	phage tail protein	tail	A0A0U4JVX3	Pseudomonas_phage	62.1	3.5e-59
WP_163832254.1|1350859_1352575_+|tail	phage tail protein	tail	A0A0U4K5K2	Pseudomonas_phage	44.0	1.1e-57
WP_163832255.1|1352577_1353456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832256.1|1353452_1354031_+	DNA-binding protein	NA	A0A0U4J942	Pseudomonas_phage	43.5	4.8e-29
WP_163832257.1|1353972_1354656_+	hypothetical protein	NA	A0A2I7RNK1	Vibrio_phage	40.7	1.3e-46
WP_163832258.1|1354649_1355600_+	hypothetical protein	NA	A0A0U4IBV2	Pseudomonas_phage	47.0	1.8e-70
WP_163832259.1|1355882_1356374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832260.1|1356798_1357263_+	Hsp20 family protein	NA	M4QDP7	Prochlorococcus_phage	35.4	1.3e-16
WP_163832261.1|1357475_1358063_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_163832262.1|1359807_1360029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832263.1|1360151_1361024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832264.1|1361020_1361254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832265.1|1361246_1363007_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_163832266.1|1363183_1363459_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_163832267.1|1363978_1364254_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_163832268.1|1364660_1365155_+	DUF4234 domain-containing protein	NA	NA	NA	NA	NA
WP_163832269.1|1365581_1366640_+	N-acetyltransferase	NA	Q6SE88	Lactobacillus_prophage	43.0	1.1e-68
WP_163832270.1|1366611_1366986_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	47.6	2.2e-27
WP_163832271.1|1367050_1368304_-|integrase	tyrosine-type recombinase/integrase	integrase	I6PDJ1	Cronobacter_phage	36.1	2.2e-55
1369521:1369534	attR	ATTTAATTAAGTTC	NA	NA	NA	NA
>prophage 9
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	1377853	1426751	6361125	capsid,tail,head,terminase,plate,protease,portal,holin	Vibrio_phage(14.29%)	56	NA	NA
WP_163832288.1|1377853_1378171_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	52.9	7.9e-26
WP_163832289.1|1378410_1378983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832290.1|1379143_1379317_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_163832291.1|1379319_1379742_+	N-acetylmuramoyl-L-alanine amidase	NA	I6R9Z4	Marinomonas_phage	55.6	5.4e-38
WP_163832292.1|1379725_1379896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832293.1|1379867_1380260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832294.1|1380280_1380502_+|holin	holin	holin	NA	NA	NA	NA
WP_163832295.1|1380574_1381306_+	phage repressor protein/antirepressor Ant	NA	A0A067ZIN2	Vibrio_phage	51.4	1.7e-31
WP_163832296.1|1381460_1381826_+	HNH endonuclease	NA	Q8W6N0	Burkholderia_virus	44.4	2.5e-23
WP_163832297.1|1381987_1382440_+|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	52.1	9.5e-41
WP_163832298.1|1382436_1384134_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	55.6	2.4e-185
WP_163832299.1|1384130_1385339_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	50.4	1.2e-111
WP_163832300.1|1385325_1385976_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	57.5	7.7e-60
WP_163832301.1|1385980_1387192_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	52.1	2.5e-112
WP_163832302.1|1387231_1387531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832303.1|1387703_1388012_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2D1GNK0	Pseudomonas_phage	42.3	8.5e-17
WP_163832304.1|1388008_1388329_+|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	38.5	2.5e-11
WP_163832305.1|1388318_1388729_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_163832306.1|1388721_1389582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832307.1|1389556_1390129_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	42.0	1.9e-25
WP_163836400.1|1390205_1390901_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	35.7	1.5e-08
WP_163832308.1|1390937_1391273_+	hypothetical protein	NA	A0A088FV58	Escherichia_phage	64.9	4.9e-34
WP_163832309.1|1391269_1392166_+|plate	baseplate assembly protein	plate	A0A088FQL4	Escherichia_phage	51.5	2.8e-76
WP_163832310.1|1392170_1392866_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	42.0	4.9e-36
WP_163832311.1|1392868_1394185_+|tail	phage tail protein	tail	A0A2H4J039	uncultured_Caudovirales_phage	48.6	7.5e-38
WP_163832312.1|1394244_1395441_+|tail	phage tail protein	tail	D4HTW1	Vibrio_phage	57.8	8.4e-129
WP_163832313.1|1395430_1395934_+|tail	phage major tail tube protein	tail	A0A1B2LRS4	Wolbachia_phage	41.8	4.0e-32
WP_163832314.1|1395993_1396266_+|tail	phage tail assembly protein	tail	Q75QK8	Wolbachia_phage	36.0	3.4e-09
WP_163832315.1|1396492_1398493_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	40.2	5.5e-32
WP_163832316.1|1398489_1398897_+|tail	phage tail protein	tail	E5E3U5	Burkholderia_phage	33.1	4.0e-14
WP_163832317.1|1398865_1399069_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_163832318.1|1399315_1400248_+	hypothetical protein	NA	D4HTW7	Vibrio_phage	38.5	4.2e-51
WP_163832319.1|1400643_1401240_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_163832320.1|1401347_1402193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832321.1|1402741_1404139_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_163832322.1|1404246_1405125_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163832323.1|1405232_1405547_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_163832324.1|1405762_1406002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832325.1|1406346_1406706_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_163832326.1|1407388_1407865_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	43.2	5.5e-23
WP_163832327.1|1408041_1409412_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_163832328.1|1409458_1409890_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_163832329.1|1409882_1410197_+	RnfH family protein	NA	NA	NA	NA	NA
WP_163832330.1|1410286_1410751_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_163832331.1|1410842_1411244_+	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_163832332.1|1411318_1413001_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_163832333.1|1413268_1413901_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_163832334.1|1414050_1415970_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	53.5	8.7e-152
WP_163832335.1|1416102_1417254_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	37.6	4.7e-28
WP_163832336.1|1417265_1418069_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_163832337.1|1418388_1419519_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.4	8.1e-49
WP_163832338.1|1419583_1422808_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_163832339.1|1422800_1423277_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_163832340.1|1423334_1423640_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_163832341.1|1423927_1424548_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_163832342.1|1424813_1426751_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	43.4	8.3e-118
>prophage 10
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	1480113	1489206	6361125	tRNA	Vibrio_phage(50.0%)	10	NA	NA
WP_163832381.1|1480113_1481943_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.8	1.3e-35
WP_163832382.1|1482070_1483882_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	33.1	5.5e-63
WP_163832383.1|1483991_1484441_-	GatB/YqeY domain-containing protein	NA	A0A2I7SAL1	Vibrio_phage	29.7	2.9e-05
WP_163832384.1|1484489_1484705_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_163832385.1|1484924_1485956_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.7	4.0e-103
WP_163832386.1|1486006_1486369_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_163832387.1|1486383_1486881_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_163832388.1|1486881_1488039_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A2I7SAR1	Vibrio_phage	56.0	1.5e-58
WP_163832389.1|1488058_1488388_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_163832390.1|1488384_1489206_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A291L9W7	Bordetella_phage	30.4	3.0e-08
>prophage 11
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	1659136	1726843	6361125	transposase,protease	Bacillus_phage(37.5%)	60	NA	NA
WP_163832512.1|1659136_1660501_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_163832513.1|1660807_1661680_-	TIGR02285 family protein	NA	NA	NA	NA	NA
WP_163832514.1|1661965_1662127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832515.1|1662204_1663329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832516.1|1663511_1664201_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_163832517.1|1664438_1664723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832518.1|1665033_1665444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832519.1|1665538_1666249_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_163832520.1|1666649_1666904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832521.1|1667310_1668219_+	formylglycine-generating enzyme family protein	NA	NA	NA	NA	NA
WP_163832522.1|1668529_1669006_+	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_163832523.1|1669002_1669827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832524.1|1670001_1670883_+	formylglycine-generating enzyme family protein	NA	NA	NA	NA	NA
WP_163832525.1|1670892_1673016_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_163832526.1|1673052_1674255_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_163832527.1|1674268_1676269_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.3	1.4e-27
WP_163832528.1|1676413_1676809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832529.1|1676897_1677362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832530.1|1678054_1678399_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_163832531.1|1678454_1680923_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_163832532.1|1681703_1681895_-	DUF3094 family protein	NA	NA	NA	NA	NA
WP_163832533.1|1681976_1683158_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_163832534.1|1683359_1685003_+	fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	24.7	1.2e-29
WP_163832535.1|1685195_1686377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836410.1|1686726_1687374_+	OmpA family protein	NA	NA	NA	NA	NA
WP_163832536.1|1687438_1687831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832537.1|1687914_1688700_-	anti-sigma factor	NA	NA	NA	NA	NA
WP_163832538.1|1688696_1689203_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_163832539.1|1689227_1689602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832540.1|1690018_1690438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832541.1|1690741_1691416_-	response regulator	NA	W8CYM9	Bacillus_phage	32.4	8.0e-28
WP_163832542.1|1691435_1692854_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.4	2.1e-22
WP_163832543.1|1693407_1695225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832544.1|1695287_1696199_-	acyltransferase	NA	NA	NA	NA	NA
WP_163832545.1|1696597_1698706_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_163832546.1|1698714_1699929_-	acetate kinase	NA	NA	NA	NA	NA
WP_163832547.1|1700286_1700820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832548.1|1700866_1701859_-	YHYH protein	NA	NA	NA	NA	NA
WP_163832549.1|1702209_1703769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832550.1|1704323_1705592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832551.1|1705678_1706524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832552.1|1706835_1707477_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_163832553.1|1707586_1707913_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_163832554.1|1708703_1709165_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_163832555.1|1709218_1711015_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	37.7	9.0e-18
WP_163832556.1|1711043_1711793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163830705.1|1711976_1712912_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_163832557.1|1712978_1713104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832558.1|1713322_1714042_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_163832559.1|1714390_1714597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832560.1|1714659_1715435_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_163832561.1|1716521_1718588_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	21.7	9.4e-11
WP_163832562.1|1718588_1718990_+	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	36.6	3.1e-11
WP_163832563.1|1718934_1719390_+	response regulator	NA	NA	NA	NA	NA
WP_163832564.1|1719402_1720080_-	arylesterase	NA	NA	NA	NA	NA
WP_163832565.1|1720078_1720795_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	1.4e-30
WP_163832566.1|1720787_1723286_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_163836411.1|1723400_1724006_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_163831647.1|1724482_1725784_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_163830705.1|1725907_1726843_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	1941155	1959874	6361125	transposase,tail	Synechococcus_phage(100.0%)	25	NA	NA
WP_163832560.1|1941155_1941930_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_163832737.1|1942023_1942536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832738.1|1942538_1943225_-	formylglycine-generating enzyme family protein	NA	NA	NA	NA	NA
WP_163832739.1|1944237_1944795_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163832740.1|1945109_1945466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832741.1|1945910_1946456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832742.1|1946474_1946774_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_163836424.1|1946763_1947363_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_163832743.1|1947428_1948208_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_163832744.1|1948656_1948839_+	sporulation protein	NA	NA	NA	NA	NA
WP_163832668.1|1948860_1949652_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_163832745.1|1949864_1950011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832746.1|1950196_1950982_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163832747.1|1951467_1953072_-	oleate hydratase	NA	NA	NA	NA	NA
WP_163832748.1|1953626_1953827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832749.1|1953877_1954117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832750.1|1954257_1954857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832751.1|1955050_1955182_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_163832752.1|1955212_1955323_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_163836425.1|1955406_1955907_-	RDD family protein	NA	NA	NA	NA	NA
WP_163832753.1|1955974_1956130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836426.1|1956415_1956499_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_163832754.1|1956769_1957573_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_163832755.1|1957607_1958207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163832756.1|1959445_1959874_+|tail	tail fiber domain-containing protein	tail	A0A0E3HHC2	Synechococcus_phage	43.0	5.5e-14
>prophage 13
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	2496221	2551890	6361125	transposase,protease,tRNA	uncultured_Caudovirales_phage(15.0%)	55	NA	NA
WP_163833196.1|2496221_2497367_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_163833197.1|2497905_2498958_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	42.5	3.2e-39
WP_163833198.1|2499000_2499708_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_163833199.1|2499766_2500531_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163833200.1|2500755_2503086_+	response regulator	NA	A0A1V0SGX0	Hokovirus	32.8	2.0e-73
WP_163833201.1|2503107_2503923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833202.1|2503919_2504936_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_163833203.1|2504907_2506086_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_163833204.1|2506082_2507453_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.2	6.7e-114
WP_163833205.1|2507546_2508170_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_163833206.1|2508199_2509297_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_163833207.1|2509336_2509783_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_163833208.1|2510170_2511430_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	88.9	2.3e-20
WP_163833209.1|2511686_2511980_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	56.7	6.8e-16
WP_163833210.1|2512213_2512576_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	2.5e-12
WP_163833211.1|2512602_2514867_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.0	3.5e-168
WP_027706826.1|2514918_2515137_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_163833212.1|2515454_2516162_-	arginyltransferase	NA	NA	NA	NA	NA
WP_163833213.1|2516158_2516875_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_163833214.1|2517155_2519540_+	cell division protein FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.7	1.9e-87
WP_163833215.1|2519566_2520199_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_163833216.1|2520202_2521525_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.0	7.2e-81
WP_163836452.1|2521551_2521935_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_163833217.1|2521972_2523259_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	41.7	2.2e-90
WP_163836453.1|2523340_2524735_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_163833218.1|2524768_2525104_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	57.3	2.5e-30
WP_163833219.1|2525105_2525399_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_163833220.1|2525403_2525760_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_163833221.1|2525785_2526178_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	50.4	3.5e-31
WP_163833222.1|2526264_2526936_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	46.9	6.3e-41
WP_163833223.1|2527576_2528965_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_163833224.1|2529245_2529968_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_163833225.1|2530059_2530839_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_163833226.1|2530857_2531211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833227.1|2531228_2531711_+	CreA family protein	NA	NA	NA	NA	NA
WP_163833228.1|2531982_2532591_+	TerD family protein	NA	A0A2I7QY07	Vibrio_phage	41.1	7.2e-36
WP_163833229.1|2532663_2533749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833230.1|2533760_2534219_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_163833231.1|2534237_2535266_+	TerC/Alx family metal homeostasis membrane protein	NA	A0A1D7XFL1	Escherichia_phage	50.3	3.6e-80
WP_163833232.1|2535324_2535897_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.7	4.6e-32
WP_163833233.1|2535948_2536527_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	37.5	5.6e-30
WP_163833234.1|2536608_2537745_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.7	4.5e-23
WP_163833235.1|2537747_2538506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833236.1|2538507_2539617_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	32.4	3.1e-45
WP_163833237.1|2539613_2540489_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_163833238.1|2540495_2540774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833239.1|2540825_2541152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833240.1|2541442_2541907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833241.1|2541908_2542448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836454.1|2542717_2543050_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_163833242.1|2543212_2543950_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	33.8	8.0e-29
WP_163833243.1|2544122_2547191_-	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_163830705.1|2548254_2549190_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_163833244.1|2549436_2550282_-	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_163832675.1|2550744_2551890_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	2558232	2692239	6361125	tRNA,integrase,capsid,tail,head,terminase,transposase,plate,protease,portal	Vibrio_virus(14.67%)	171	2621037:2621057	2647106:2647126
WP_163833251.1|2558232_2559231_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_163833252.1|2559363_2560413_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	46.8	7.2e-84
WP_163833253.1|2560423_2560657_-	pyocin activator protein PrtN	NA	A0A1D9C9N7	Salinivibrio_phage	38.2	1.8e-11
WP_163830705.1|2560699_2561635_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_163833254.1|2561755_2561929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833255.1|2561963_2562194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833256.1|2562262_2562601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833257.1|2562658_2563525_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	53.3	6.0e-68
WP_163833258.1|2563585_2564587_-	hypothetical protein	NA	A6XMH8	Bacillus_virus	36.3	5.9e-43
WP_163833259.1|2564588_2564915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833260.1|2565287_2565914_-	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	38.4	5.0e-24
WP_163833261.1|2566033_2566285_+	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
WP_163833262.1|2566241_2566838_+	hypothetical protein	NA	H2BD67	Pseudomonas_phage	34.1	2.2e-08
WP_163833263.1|2566894_2567887_+	replication protein	NA	I6PDJ3	Cronobacter_phage	43.8	1.2e-11
WP_163833264.1|2567897_2568626_+	Replication protein P	NA	NA	NA	NA	NA
WP_163833265.1|2568798_2569125_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	55.1	4.7e-26
WP_163833266.1|2569595_2570015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833267.1|2570069_2570708_-	nuclease	NA	A0A0R6PHV6	Moraxella_phage	37.6	5.8e-36
WP_163833268.1|2570736_2571564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833269.1|2571637_2572063_+	M15 family metallopeptidase	NA	A0A0F7L8C4	uncultured_marine_virus	41.6	3.2e-22
WP_163833270.1|2572052_2572244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833271.1|2572240_2572636_+	hypothetical protein	NA	A0A1B1ITB4	uncultured_Mediterranean_phage	44.8	2.2e-17
WP_163833272.1|2572635_2573211_+|terminase	terminase small subunit	terminase	A0A0A0RSW5	Bacillus_phage	44.0	1.7e-31
WP_163833273.1|2573213_2574722_+|terminase	phage terminase large subunit	terminase	A8ATG0	Listeria_phage	35.7	5.4e-64
WP_163833274.1|2574721_2576266_+	DUF935 domain-containing protein	NA	A0A2P9JZI9	Alteromonadaceae_phage	45.7	2.4e-115
WP_163833275.1|2576265_2577051_+	hypothetical protein	NA	M4M9M5	Vibrio_phage	46.6	2.7e-67
WP_163833276.1|2577052_2577277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833277.1|2577412_2578027_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_163833278.1|2578357_2578531_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_163836455.1|2578749_2579244_+	hypothetical protein	NA	Q7Y5W2	Haemophilus_phage	46.0	9.1e-21
WP_163833279.1|2579397_2579793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833280.1|2579835_2580813_+	hypothetical protein	NA	A0A2P9JZJ0	Alteromonadaceae_phage	45.9	4.5e-72
WP_163833281.1|2580869_2581205_+	hypothetical protein	NA	A0A0A1IWZ9	Pseudomonas_phage	67.3	1.2e-32
WP_163833282.1|2582984_2583590_+	hypothetical protein	NA	A0A0C4UQR9	Shigella_phage	49.5	1.4e-52
WP_163833283.1|2583666_2584050_+	hypothetical protein	NA	X5IGC7	Pseudomonas_phage	33.3	8.4e-06
WP_163833284.1|2584046_2584463_+	DUF1320 domain-containing protein	NA	A0A2P9JZJ4	Alteromonadaceae_phage	40.5	9.4e-19
WP_163833285.1|2584462_2584969_+	phage virion morphogenesis protein	NA	M1NVQ9	Vibrio_phage	42.9	1.8e-27
WP_163833286.1|2585018_2585786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833287.1|2585829_2586366_+	hypothetical protein	NA	A0A2P9JZJ6	Alteromonadaceae_phage	35.5	3.5e-18
WP_163836456.1|2586358_2586931_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	42.6	1.2e-27
WP_163833288.1|2586930_2587266_+|plate	phage baseplate protein	plate	V5YTB2	Pseudomonas_phage	60.4	6.3e-34
WP_163833289.1|2587262_2588153_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	53.8	5.4e-80
WP_163833290.1|2588145_2588853_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	42.0	3.5e-34
WP_163833291.1|2588849_2590166_+|tail	phage tail protein	tail	A0A2H4J039	uncultured_Caudovirales_phage	49.4	2.4e-36
WP_163833292.1|2590238_2591402_+|tail	phage tail protein	tail	A0A193GYC3	Enterobacter_phage	53.6	8.4e-134
WP_163833293.1|2591398_2591902_+|tail	phage major tail tube protein	tail	K4I1G5	Acidithiobacillus_phage	50.9	1.1e-40
WP_163833294.1|2591973_2592246_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_163836457.1|2592218_2592362_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	60.0	1.8e-06
WP_163833295.1|2592354_2594610_+|tail	phage tail tape measure protein	tail	A0A1B2LRQ0	Wolbachia_phage	41.7	6.1e-104
WP_163833296.1|2595010_2595493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833297.1|2595528_2596116_-	hypothetical protein	NA	B6SCX2	Bacteriophage	51.0	6.3e-21
WP_163833298.1|2596421_2597834_-	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	44.0	1.2e-44
WP_163833299.1|2597859_2598141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833300.1|2598418_2599036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833301.1|2599624_2600083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833302.1|2600104_2606101_-	hypothetical protein	NA	S5WIG9	Leptospira_phage	24.8	5.5e-27
WP_163833303.1|2606334_2606754_+|tail	phage tail protein	tail	A0A088FQM4	Escherichia_phage	46.6	1.2e-26
WP_163833304.1|2606740_2606947_+|tail	phage tail protein	tail	S4TTA0	Salmonella_phage	46.9	1.3e-10
WP_163833305.1|2606937_2607933_+	late control protein	NA	D4HTW7	Vibrio_phage	42.4	1.2e-64
WP_163833306.1|2608239_2608566_+	hypothetical protein	NA	I6NSG1	Burkholderia_phage	40.7	3.1e-09
WP_163833307.1|2608593_2608791_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L5C291	Pseudoalteromonas_phage	56.4	7.5e-11
WP_163833308.1|2609453_2610251_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163833309.1|2610273_2611002_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163833310.1|2611160_2611487_+	M15 family metallopeptidase	NA	A0A0F7L8C4	uncultured_marine_virus	37.3	4.3e-11
WP_163833311.1|2612526_2612985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833312.1|2613034_2613484_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_163836458.1|2613837_2613978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833313.1|2614127_2614220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833314.1|2614292_2614865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833315.1|2615244_2615445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833316.1|2615530_2616154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833317.1|2616510_2616795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833318.1|2617142_2617520_+	PH domain-containing protein	NA	A6N235	Microbacterium_phage	36.8	2.1e-09
WP_163836355.1|2617567_2618080_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_163832145.1|2618118_2618625_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_163833319.1|2618697_2618874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833320.1|2619015_2619417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833321.1|2619676_2620243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833322.1|2620634_2620829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833323.1|2620919_2621060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832560.1|2621036_2621812_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
2621037:2621057	attL	CTAGGGCCTGTTAACACTAAT	NA	NA	NA	NA
WP_163833324.1|2621833_2622031_+|tail	phage tail protein	tail	S4TTA0	Salmonella_phage	53.7	1.4e-09
WP_163833325.1|2622035_2622302_+	hypothetical protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	39.7	2.6e-06
WP_163830705.1|2622738_2623674_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_163833326.1|2623747_2624059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836389.1|2624240_2625311_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_163833327.1|2625550_2626429_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163833328.1|2626655_2627390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833329.1|2627769_2628843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833330.1|2629018_2629240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833331.1|2629281_2629656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833332.1|2629873_2630290_+	VOC family protein	NA	NA	NA	NA	NA
WP_163833333.1|2630313_2631969_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_163833334.1|2632415_2633171_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_163833335.1|2633171_2634101_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_163833336.1|2634417_2635065_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_163833337.1|2635231_2637076_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_163833338.1|2637159_2637747_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_163833339.1|2638254_2639289_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	52.2	4.5e-94
WP_163833340.1|2639292_2639517_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	50.0	5.6e-10
WP_163833341.1|2639526_2639862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833342.1|2639864_2640266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833343.1|2640365_2641154_-	DUF2303 family protein	NA	NA	NA	NA	NA
WP_163833344.1|2641191_2641542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833345.1|2641618_2641819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833346.1|2641821_2642328_-	recombination-associated protein RdgC	NA	NA	NA	NA	NA
WP_163833347.1|2642297_2642732_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JTA9	Pseudomonas_phage	43.2	5.6e-06
WP_163833348.1|2642897_2643311_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_163833349.1|2643942_2644812_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	39.1	3.4e-10
WP_163833350.1|2644808_2645522_+	Replication protein P	NA	W6MVG8	Pseudomonas_phage	38.4	1.3e-36
WP_163833351.1|2645734_2645914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833352.1|2645976_2646294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833353.1|2646960_2647119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833354.1|2647143_2647918_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
2647106:2647126	attR	CTAGGGCCTGTTAACACTAAT	NA	NA	NA	NA
WP_163833355.1|2648180_2649470_-|protease	serine protease	protease	V5LS29	Emiliania_huxleyi_virus	43.1	8.2e-05
WP_163833356.1|2649761_2650124_+	recombinase	NA	NA	NA	NA	NA
WP_163833357.1|2650120_2650381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833358.1|2651094_2651673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833359.1|2651925_2652546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833360.1|2652616_2652790_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_163833361.1|2652793_2653186_+	N-acetylmuramoyl-L-alanine amidase	NA	I6R9Z4	Marinomonas_phage	58.5	1.1e-42
WP_163833362.1|2653330_2653804_+|tail	tail fiber domain-containing protein	tail	A0A0E3HHC2	Synechococcus_phage	43.7	7.9e-14
WP_163836459.1|2654444_2654639_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	52.4	1.4e-09
WP_163833363.1|2654680_2655073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833364.1|2655094_2655367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833365.1|2655407_2656298_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163833366.1|2656470_2657199_+	phage repressor protein/antirepressor Ant	NA	A0A2P1N2N7	Gordonia_phage	35.4	2.1e-34
WP_163833367.1|2657259_2657550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833368.1|2657978_2658470_+	DUF1441 family protein	NA	A0A2H4EYX7	Aeromonas_phage	45.5	4.3e-31
WP_163836460.1|2658462_2660496_+|terminase	phage terminase large subunit family protein	terminase	A0A219YAX2	Aeromonas_phage	54.5	8.2e-217
WP_163833369.1|2660524_2660932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833370.1|2661057_2661264_+	hypothetical protein	NA	A0A219Y9T2	Aeromonas_phage	51.5	5.7e-09
WP_163833371.1|2661263_2662769_+|portal	phage portal protein	portal	A0A219Y9V7	Aeromonas_phage	47.3	3.9e-131
WP_163833372.1|2662825_2663437_+	DUF1131 family protein	NA	NA	NA	NA	NA
WP_163833373.1|2663526_2664543_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	30.7	4.6e-27
WP_163833374.1|2664539_2664893_+|head	head decoration protein	head	A0A0A8IL52	Aurantimonas_phage	39.1	1.6e-11
WP_163833375.1|2664991_2665987_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	46.4	4.3e-78
WP_163833376.1|2665989_2666355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833377.1|2666329_2666908_+	hypothetical protein	NA	B0ZSF5	Halomonas_phage	42.4	4.8e-29
WP_163833378.1|2666891_2667425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833379.1|2667405_2667951_+|plate	phage baseplate assembly protein V	plate	A2I2X5	Vibrio_virus	57.3	4.2e-43
WP_163833380.1|2667983_2668271_+	PaaR repeat-containing protein	NA	G4KK81	Yersinia_phage	40.0	2.9e-11
WP_163833381.1|2668275_2668596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833382.1|2668641_2668986_+|plate	phage baseplate protein	plate	A2I2X7	Vibrio_virus	49.1	3.7e-21
WP_163833383.1|2668982_2669975_+|plate	baseplate assembly protein	plate	Q6R4V6	Vibrio_virus	41.9	1.7e-71
WP_163833384.1|2669971_2670601_+|tail	phage tail protein I	tail	Q6R4V7	Vibrio_virus	44.7	7.3e-31
WP_163833385.1|2670593_2672003_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	34.7	3.9e-24
WP_163830644.1|2672014_2672212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833386.1|2672195_2673362_+|tail	phage tail protein	tail	Q6R4W2	Vibrio_virus	71.6	3.9e-163
WP_163833387.1|2673361_2673868_+|tail	phage tail protein	tail	Q6R4W3	Vibrio_virus	66.7	3.7e-62
WP_163833388.1|2673870_2674146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833389.1|2674280_2674859_+|tail	phage tail assembly protein	tail	Q6R4W4	Vibrio_virus	50.0	4.9e-50
WP_163833390.1|2674958_2677544_+|tail	phage tail tape measure protein	tail	A2I2Y1	Vibrio_virus	50.2	2.3e-123
WP_163833391.1|2677543_2677945_+|tail	phage tail protein	tail	A2I2Y2	Vibrio_virus	52.4	2.9e-33
WP_163833392.1|2677919_2678126_+|tail	phage tail protein	tail	A2I2Y3	Vibrio_virus	42.4	8.2e-08
WP_163833393.1|2678116_2679127_+	phage late control D family protein	NA	A2I2Y5	Vibrio_virus	54.6	3.9e-103
WP_163833394.1|2679360_2679645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833395.1|2679839_2680559_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_163833396.1|2680612_2681113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833397.1|2681293_2681629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833398.1|2681729_2682422_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_163833399.1|2684237_2684450_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_163833400.1|2684545_2685148_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_163833401.1|2685187_2685802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833402.1|2685851_2686463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833403.1|2687339_2687612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833404.1|2687872_2688247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833405.1|2688934_2689291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833406.1|2690054_2691185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836355.1|2691181_2691694_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_163832145.1|2691732_2692239_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	3428235	3486029	6361125	integrase,transposase	Streptococcus_phage(33.33%)	39	3429499:3429516	3489360:3489377
WP_163833948.1|3428235_3429579_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3429499:3429516	attL	TTTGAATTAGAAGCTAAT	NA	NA	NA	NA
WP_163833949.1|3429593_3431405_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_163836494.1|3431833_3433321_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_163833950.1|3433329_3433794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833951.1|3433802_3435737_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.0	5.9e-39
WP_163833952.1|3435833_3436088_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_163833953.1|3436125_3436314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833954.1|3436722_3437214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833955.1|3437759_3442661_+	DEAD/DEAH box helicase	NA	A0A2H4UVA3	Bodo_saltans_virus	25.0	7.6e-35
WP_163833956.1|3443219_3446594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833957.1|3446917_3450736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836495.1|3450817_3451129_-	HigA family addiction module antidote protein	NA	I6ZVM3	Aeromonas_phage	49.5	5.0e-17
WP_163833958.1|3451410_3451767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833959.1|3452076_3453747_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.0	7.3e-38
WP_163833960.1|3453864_3455124_-	diaminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_163830705.1|3455188_3456124_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_163833961.1|3456243_3457593_-	MFS transporter	NA	NA	NA	NA	NA
WP_163833962.1|3457921_3458734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163830705.1|3458765_3459701_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_163836496.1|3459832_3459979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836497.1|3460273_3460549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833963.1|3460719_3461268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833964.1|3461410_3462667_+	cytochrome P450	NA	NA	NA	NA	NA
WP_163833965.1|3462756_3463083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833966.1|3463619_3464654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833967.1|3464879_3467780_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.9	3.0e-273
WP_163833968.1|3467908_3468301_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_163833969.1|3468374_3469673_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.9	1.8e-100
WP_163833970.1|3469740_3471120_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_163833971.1|3471542_3472160_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_163833972.1|3473170_3474544_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_163833973.1|3474590_3475715_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_163833974.1|3476060_3477902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833975.1|3477974_3478910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163833976.1|3479128_3479551_-	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_163833977.1|3479547_3480726_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_163833978.1|3480732_3481575_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_163833979.1|3481950_3484998_+	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_163830705.1|3485093_3486029_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
3489360:3489377	attR	ATTAGCTTCTAATTCAAA	NA	NA	NA	NA
>prophage 16
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	3616653	3667692	6361125	tRNA,tail,transposase	Tetraselmis_virus(20.0%)	42	NA	NA
WP_163834074.1|3616653_3617565_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_163834075.1|3617586_3618348_-	glycosyltransferase	NA	A0A2P0VNH9	Tetraselmis_virus	40.8	6.3e-45
WP_163834076.1|3618535_3620269_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_163834077.1|3620674_3622834_+	flagellin	NA	NA	NA	NA	NA
WP_163834078.1|3623033_3624647_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_163834079.1|3624691_3626677_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_163834080.1|3626699_3627938_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_163834081.1|3627969_3630753_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_163834082.1|3630841_3631921_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	D6PHK9	uncultured_phage	36.3	1.0e-08
WP_163836503.1|3631981_3633076_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_163834083.1|3633134_3633827_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_163834084.1|3634110_3634896_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_163834085.1|3634976_3635723_-	flagellar basal-body rod protein FlgF	NA	NA	NA	NA	NA
WP_163834086.1|3635973_3637986_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_163834087.1|3638146_3638842_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_163834088.1|3638908_3639355_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_163834089.1|3639357_3639762_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_163834090.1|3639971_3641087_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.8	4.4e-15
WP_163834091.1|3641236_3641653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163834092.1|3641812_3643987_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_163834093.1|3644007_3644556_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	33.5	6.1e-18
WP_163834094.1|3644786_3645209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163834095.1|3645637_3646504_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163834096.1|3646652_3646871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163834097.1|3646864_3647080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163834098.1|3647151_3647331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163830705.1|3647698_3648634_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_163834099.1|3648658_3648940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163834100.1|3649029_3649344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163834101.1|3649713_3651312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836355.1|3651893_3652406_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_163831121.1|3652444_3652951_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_163834102.1|3653717_3654014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163834103.1|3654435_3655029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163834104.1|3655095_3655290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163834105.1|3655738_3657118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163834106.1|3657416_3661202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163834107.1|3661665_3662526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836504.1|3662513_3663584_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_163834108.1|3663652_3665728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163830705.1|3666093_3667029_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_163834109.1|3667242_3667692_-|tail	tail fiber domain-containing protein	tail	A0A192Y7K3	Salmonella_phage	39.4	5.6e-09
>prophage 17
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	4381701	4447586	6361125	tRNA,integrase,capsid,tail,head,terminase,transposase,plate,protease,portal,holin	Vibrio_phage(14.29%)	82	4409572:4409596	4444085:4444109
WP_163834641.1|4381701_4383195_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_163834642.1|4383818_4387310_+	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_163834643.1|4387506_4387746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163834644.1|4388127_4388697_-	RICIN domain-containing protein	NA	NA	NA	NA	NA
WP_163834645.1|4388860_4390012_-	DUF1176 domain-containing protein	NA	NA	NA	NA	NA
WP_163834646.1|4390067_4390433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163834647.1|4390736_4391576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163834648.1|4391851_4392628_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163834649.1|4394122_4395007_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163834650.1|4395082_4395262_-|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
WP_163834651.1|4395524_4395758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836546.1|4396024_4396123_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_163834652.1|4396112_4396238_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_163834653.1|4396260_4396872_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.0	1.2e-30
WP_163832145.1|4397106_4397613_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_163836355.1|4397806_4398319_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_163831121.1|4398357_4398864_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_163834654.1|4398949_4399273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163834655.1|4399306_4399435_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_163834656.1|4399403_4399757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163834657.1|4399818_4400223_-	N-acetylmuramoyl-L-alanine amidase	NA	I6R9Z4	Marinomonas_phage	54.0	2.9e-41
WP_163830705.1|4400365_4401301_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_163834658.1|4401479_4401776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163834659.1|4401828_4402245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163834660.1|4402505_4402847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163834661.1|4403044_4403722_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.2	7.8e-39
WP_163832199.1|4404073_4404244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163834662.1|4404250_4404631_+	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	53.2	1.2e-28
WP_163834663.1|4404638_4405226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163834664.1|4405445_4405673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163834665.1|4405755_4405944_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_163834666.1|4405954_4406323_+	N-acetylmuramoyl-L-alanine amidase	NA	I6R9Z4	Marinomonas_phage	55.9	1.6e-38
WP_163834667.1|4406608_4407061_+|tail	tail fiber domain-containing protein	tail	A0A0E3HHC2	Synechococcus_phage	50.0	8.9e-15
WP_163834668.1|4407128_4407536_+	hypothetical protein	NA	A0A218MKV5	uncultured_virus	43.8	6.6e-09
WP_163834669.1|4407547_4407766_+|holin	holin	holin	NA	NA	NA	NA
WP_163834670.1|4407802_4408462_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163834671.1|4408837_4409557_+	phage antirepressor Ant	NA	A0A0C5AEJ9	Bacteriophage	40.5	2.7e-37
4409572:4409596	attL	TTGCCCACTTCGGTGGGCTTTTTTT	NA	NA	NA	NA
WP_163834661.1|4409737_4410415_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.2	7.8e-39
WP_163834672.1|4410612_4411776_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GN00	Marinobacter_phage	43.7	6.6e-78
WP_163834673.1|4412500_4412722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163834674.1|4413076_4414621_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_163834675.1|4414697_4417604_+	hypothetical protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	40.2	1.7e-21
WP_163834676.1|4417606_4417924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163834677.1|4418219_4418636_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_163834678.1|4418966_4419614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163834679.1|4419597_4421397_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_163834680.1|4421396_4422572_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_163834681.1|4422654_4423464_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	26.7	3.0e-05
WP_163834682.1|4423651_4424587_-	hypothetical protein	NA	D4HTW7	Vibrio_phage	39.8	1.5e-53
WP_163834683.1|4424729_4425023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163834684.1|4425067_4425271_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_163834685.1|4425239_4425647_-|tail	phage tail protein	tail	E5E3U5	Burkholderia_phage	33.1	6.8e-14
WP_163834686.1|4425643_4427644_-	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	40.2	5.5e-32
WP_163834687.1|4427747_4428020_-|tail	phage tail assembly protein	tail	Q75QK8	Wolbachia_phage	36.0	1.2e-09
WP_163834688.1|4428080_4428584_-|tail	phage major tail tube protein	tail	A0A1B2LRS4	Wolbachia_phage	41.1	5.2e-32
WP_163834689.1|4428573_4429770_-|tail	phage tail protein	tail	D4HTW1	Vibrio_phage	57.8	1.4e-128
WP_163834690.1|4429829_4431146_-|tail	phage tail protein	tail	A0A2H4J039	uncultured_Caudovirales_phage	48.6	7.5e-38
WP_163832310.1|4431148_4431844_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	42.0	4.9e-36
WP_163834691.1|4431848_4432520_-|plate	baseplate assembly protein	plate	A0A088FQL4	Escherichia_phage	45.7	3.5e-47
WP_163834692.1|4434272_4434545_-	hypothetical protein	NA	A0A193GYM8	Enterobacter_phage	68.8	1.0e-18
WP_163834693.1|4434541_4434877_-|plate	phage baseplate protein	plate	A0A088FV58	Escherichia_phage	64.9	1.4e-33
WP_163834694.1|4434944_4435364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163834695.1|4435441_4436014_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	42.0	1.2e-24
WP_163834696.1|4435988_4436849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163830729.1|4436841_4437252_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_163830730.1|4437241_4437562_-|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	40.6	7.7e-13
WP_163830731.1|4437558_4437867_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2D1GNK0	Pseudomonas_phage	39.4	4.6e-15
WP_163830732.1|4438011_4438203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163830733.1|4438249_4439461_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	52.1	5.5e-112
WP_163834697.1|4439465_4440116_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	57.5	4.5e-60
WP_163834698.1|4440102_4441311_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	50.4	5.5e-112
WP_163836547.1|4441307_4443002_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	55.8	1.8e-185
WP_163834699.1|4443001_4443454_-|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	52.7	2.5e-41
WP_163834700.1|4443615_4443981_-	HNH endonuclease	NA	A0A1V0E8A5	Vibrio_phage	49.1	2.4e-26
WP_163832295.1|4444135_4444867_-	phage repressor protein/antirepressor Ant	NA	A0A067ZIN2	Vibrio_phage	51.4	1.7e-31
4444085:4444109	attR	AAAAAAAGCCCACCGAAGTGGGCAA	NA	NA	NA	NA
WP_163834701.1|4444937_4445159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163834702.1|4445179_4445572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163834703.1|4445543_4445714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163834704.1|4445697_4446120_-	N-acetylmuramoyl-L-alanine amidase	NA	I6R9Z4	Marinomonas_phage	58.1	1.7e-39
WP_163834705.1|4446122_4446236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163834706.1|4446450_4447029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163834707.1|4447268_4447586_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	54.9	2.4e-27
>prophage 18
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	4456939	4491619	6361125	integrase,tail,terminase,plate,protease,portal,holin	Vibrio_virus(50.0%)	35	4453157:4453176	4496255:4496274
4453157:4453176	attL	AGCGAGCTTAAAGATAGAAT	NA	NA	NA	NA
WP_163834723.1|4456939_4458055_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GN00	Marinobacter_phage	45.7	5.9e-84
WP_163834724.1|4458138_4458909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163834673.1|4459783_4460005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163834725.1|4460359_4461904_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_163834726.1|4461980_4464611_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	40.5	3.0e-17
WP_163834727.1|4465548_4468209_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_163834728.1|4468276_4469257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163834729.1|4469304_4470312_-	phage late control D family protein	NA	A2I2Y5	Vibrio_virus	54.2	4.8e-101
WP_163834730.1|4470302_4470509_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_163834731.1|4470483_4470885_-|tail	phage tail protein	tail	A2I2Y2	Vibrio_virus	52.4	2.9e-33
WP_163834732.1|4470884_4473470_-|tail	phage tail tape measure protein	tail	A2I2Y1	Vibrio_virus	54.5	7.9e-116
WP_163834733.1|4473569_4474148_-|tail	phage tail assembly protein	tail	Q6R4W4	Vibrio_virus	50.5	9.9e-51
WP_163833388.1|4474282_4474558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163833387.1|4474560_4475067_-|tail	phage tail protein	tail	Q6R4W3	Vibrio_virus	66.7	3.7e-62
WP_163834734.1|4475066_4476233_-|tail	phage tail protein	tail	Q6R4W2	Vibrio_virus	71.9	1.7e-163
WP_163834735.1|4476216_4476402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163834736.1|4476421_4478158_-|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	35.2	4.3e-25
WP_163834737.1|4478150_4478780_-|tail	phage tail protein I	tail	Q6R4V7	Vibrio_virus	44.2	3.8e-32
WP_163834738.1|4478776_4479769_-|plate	baseplate assembly protein	plate	Q6R4V6	Vibrio_virus	43.6	2.2e-74
WP_163834739.1|4479765_4480104_-|plate	phage baseplate protein	plate	A2I2X7	Vibrio_virus	47.7	2.8e-21
WP_163834740.1|4480103_4480391_-	PaaR repeat-containing protein	NA	K4ICQ1	Acidithiobacillus_phage	48.9	8.2e-14
WP_163834741.1|4480423_4480969_-|plate	phage baseplate assembly protein V	plate	A2I2X5	Vibrio_virus	56.9	1.4e-43
WP_163834742.1|4480949_4481486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163834743.1|4481472_4482045_-	hypothetical protein	NA	B0ZSF5	Halomonas_phage	40.6	1.3e-26
WP_163834744.1|4482019_4482397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163834745.1|4482396_4482714_-	DUF2190 family protein	NA	A0A1W6JT93	Pseudomonas_phage	35.9	3.0e-09
WP_163834746.1|4482779_4484786_-|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	43.7	2.2e-145
WP_163834747.1|4484791_4486273_-|portal	phage portal protein	portal	A0A1B0YZU4	Pseudomonas_phage	48.1	4.0e-128
WP_163836548.1|4486269_4486479_-	hypothetical protein	NA	A0A1B0YZU1	Pseudomonas_phage	46.5	2.3e-05
WP_163834748.1|4486475_4488506_-|terminase	terminase	terminase	A2I2W6	Vibrio_virus	60.9	7.1e-237
WP_163834749.1|4488357_4488942_-|terminase	terminase small subunit	terminase	B0ZSE9	Halomonas_phage	41.1	1.7e-29
WP_163834750.1|4489609_4490425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163834751.1|4490439_4490658_-|holin	holin	holin	NA	NA	NA	NA
WP_163834752.1|4490678_4491071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163834753.1|4491196_4491619_-	N-acetylmuramoyl-L-alanine amidase	NA	I6R9Z4	Marinomonas_phage	54.0	1.8e-41
4496255:4496274	attR	AGCGAGCTTAAAGATAGAAT	NA	NA	NA	NA
>prophage 19
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	4497445	4505407	6361125	integrase	Pseudomonas_phage(33.33%)	12	4496603:4496615	4508090:4508102
4496603:4496615	attL	ATTGGAAGAAGTA	NA	NA	NA	NA
WP_163834759.1|4497445_4498360_+	recombination-associated protein RdgC	NA	M4MHA9	Vibrio_phage	24.0	1.3e-15
WP_163834760.1|4498356_4498566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163834761.1|4498649_4499066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163832206.1|4499068_4499821_+	ATP-binding protein	NA	B4UTW5	Rhizobium_phage	39.5	2.4e-41
WP_163834762.1|4499832_4500402_+	DUF669 domain-containing protein	NA	A0A2H4GYE1	Pseudomonas_phage	33.8	4.0e-20
WP_163834763.1|4500456_4500675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163834764.1|4500859_4501900_+	oxidoreductase	NA	A0A173H0P7	Pseudoalteromonas_phage	47.9	4.2e-84
WP_163834765.1|4501896_4503522_+	DEAD/DEAH box helicase family protein	NA	A0A172PZU9	Pseudomonas_phage	39.0	3.6e-98
WP_163832210.1|4503511_4503745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163834766.1|4503754_4504060_+	carbon storage regulator	NA	NA	NA	NA	NA
WP_163834767.1|4504070_4504283_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_163834768.1|4504279_4505407_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GN00	Marinobacter_phage	41.6	2.3e-72
4508090:4508102	attR	TACTTCTTCCAAT	NA	NA	NA	NA
>prophage 20
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	5783600	5812406	6361125	transposase,holin	uncultured_Caudovirales_phage(25.0%)	22	NA	NA
WP_163830705.1|5783600_5784536_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_163835888.1|5785001_5785391_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_163835889.1|5785638_5787897_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_163835890.1|5788107_5789469_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	40.8	2.2e-64
WP_163835891.1|5789543_5789741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163835892.1|5789995_5790910_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.9	6.6e-17
WP_163835893.1|5791118_5791886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163835894.1|5792574_5792901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163835895.1|5793448_5794906_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_163835896.1|5794919_5796665_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	29.9	2.1e-59
WP_163835897.1|5796719_5798996_+	CehA/McbA family metallohydrolase	NA	NA	NA	NA	NA
WP_163835898.1|5799180_5800320_+	BCCT family transporter	NA	NA	NA	NA	NA
WP_163835899.1|5800606_5802838_+	FAD-binding protein	NA	A0A2K9L3G7	Tupanvirus	28.6	1.7e-50
WP_163835900.1|5803336_5803675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836607.1|5803730_5804849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163835901.1|5804938_5806057_-	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_163835902.1|5806175_5806967_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_163835903.1|5807121_5809068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836389.1|5809250_5810321_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_163835904.1|5810490_5811177_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_163836355.1|5811348_5811861_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_163831121.1|5811899_5812406_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	5962331	6013991	6361125	tRNA,transposase	Salicola_phage(20.0%)	49	NA	NA
WP_163836037.1|5962331_5963033_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_163836038.1|5963114_5963492_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_163836039.1|5963843_5964062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836040.1|5964806_5965661_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	38.8	5.6e-42
WP_163836041.1|5966007_5967021_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_163836042.1|5967013_5967685_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	37.5	1.5e-29
WP_163836618.1|5967865_5968225_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163836043.1|5968420_5969146_-	hydrogenase	NA	NA	NA	NA	NA
WP_163836044.1|5969278_5969716_+	cytochrome c	NA	NA	NA	NA	NA
WP_163836045.1|5970146_5970608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836046.1|5970692_5971139_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163836047.1|5971492_5972065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836048.1|5972067_5973846_+	OmpA family protein	NA	NA	NA	NA	NA
WP_163836049.1|5973850_5974390_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_163836050.1|5974367_5976566_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_163836051.1|5976635_5979680_-	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	20.4	1.6e-19
WP_163836052.1|5979679_5980768_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_163836053.1|5981168_5981378_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_163836054.1|5981733_5983113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836055.1|5983226_5984012_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_163836056.1|5984159_5985359_+	MFS transporter	NA	NA	NA	NA	NA
WP_163836057.1|5985856_5986045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836619.1|5986185_5987505_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_163836058.1|5989284_5990133_+	alpha-L-glutamate ligase	NA	NA	NA	NA	NA
WP_163836059.1|5990332_5991952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836060.1|5991964_5992678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836061.1|5993153_5994272_-	agmatine deiminase family protein	NA	A7IVE6	Paramecium_bursaria_Chlorella_virus	35.3	5.4e-53
WP_163836062.1|5994544_5995234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836063.1|5995419_5996157_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_163836064.1|5996268_5996706_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_163836065.1|5996642_5997524_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_163836066.1|5997498_5998779_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_163836067.1|5998779_5998977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836068.1|5999119_5999965_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163836069.1|5999987_6000758_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163836070.1|6000913_6001621_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163836066.1|6001693_6002974_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_163836071.1|6002990_6003431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836072.1|6003848_6004871_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_163836620.1|6004913_6005330_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_163836073.1|6005333_6005564_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163836621.1|6005577_6006144_-	putative 4-mercaptohistidine N1-methyltransferase	NA	NA	NA	NA	NA
WP_163836074.1|6006241_6006406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836075.1|6006377_6006707_+	hypothetical protein	NA	Q1MVF0	Enterobacteria_phage	38.9	2.2e-18
WP_163836076.1|6008648_6009440_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_163836622.1|6009481_6009958_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_163836077.1|6010018_6011707_-	phosphatidylserine/phosphatidylglycerophosphate/ cardiolipin synthase family protein	NA	NA	NA	NA	NA
WP_163836078.1|6011767_6012181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836066.1|6012710_6013991_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	6019060	6064091	6361125	transposase	Bacillus_virus(40.0%)	48	NA	NA
WP_163836081.1|6019060_6019288_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	41.9	1.3e-06
WP_163836082.1|6019338_6020229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836083.1|6020459_6020996_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_163836066.1|6021126_6022407_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_163836065.1|6022381_6023263_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_163836084.1|6023338_6024148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836085.1|6024238_6026590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836066.1|6027151_6028432_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_163836086.1|6028750_6029587_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_163836066.1|6029916_6031197_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_163836087.1|6031292_6032063_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163836088.1|6032085_6032931_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163836066.1|6033073_6034354_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_163836089.1|6034594_6034915_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_163836090.1|6034930_6035281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836091.1|6035495_6035687_+	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_163836092.1|6035686_6036100_+	PIN domain nuclease	NA	NA	NA	NA	NA
WP_163836093.1|6036055_6036457_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_163836094.1|6036446_6036713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836095.1|6036894_6037218_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_163836096.1|6037327_6037582_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_163836097.1|6037578_6037833_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_163836066.1|6038075_6039356_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_163836098.1|6039487_6039868_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_163836099.1|6039857_6040124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836100.1|6040562_6040817_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_163836097.1|6040813_6041068_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_163836101.1|6041178_6041835_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_163836102.1|6041862_6042045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836103.1|6042074_6042488_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_163836104.1|6042487_6042721_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_163836105.1|6042834_6043074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836066.1|6043090_6044371_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_163836088.1|6044513_6045359_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163836069.1|6045381_6046152_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163836106.1|6046405_6047014_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163836107.1|6047086_6047749_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_163836108.1|6047837_6050945_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_163836109.1|6051135_6051726_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.2	5.6e-41
WP_163836110.1|6051848_6052463_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_163836086.1|6052792_6053629_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_163836066.1|6053947_6055228_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_163836111.1|6055444_6057229_+	EAL domain-containing protein	NA	W8CYM9	Bacillus_phage	33.8	7.1e-07
WP_163836112.1|6057390_6058809_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_163836113.1|6059021_6060374_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	23.1	7.3e-20
WP_163836114.1|6060370_6062479_+	hypothetical protein	NA	G3MBJ8	Bacillus_virus	22.0	4.9e-23
WP_163836115.1|6062789_6063089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163830705.1|6063155_6064091_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP048878	Oceanospirillales bacterium S2-4-1H chromosome, complete genome	6361125	6254450	6317125	6361125	transposase,protease	Tupanvirus(33.33%)	47	NA	NA
WP_163836389.1|6254450_6255521_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_163836260.1|6255423_6256575_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_163836261.1|6257117_6258782_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_163836262.1|6259007_6262655_+	DUF2339 domain-containing protein	NA	NA	NA	NA	NA
WP_163836263.1|6262717_6263449_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_163836264.1|6263507_6263924_-	N-acetylmuramoyl-L-alanine amidase	NA	I6R9Z4	Marinomonas_phage	55.8	1.8e-38
WP_163836265.1|6264038_6264404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836266.1|6264645_6264897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836267.1|6265947_6266853_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163836268.1|6266810_6267008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836269.1|6267462_6268284_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_163836270.1|6268379_6269045_+	LysE family transporter	NA	NA	NA	NA	NA
WP_163836271.1|6269114_6269984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836272.1|6270125_6270575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836273.1|6270803_6271865_-	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_163836274.1|6271882_6272788_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	33.3	1.8e-35
WP_163836275.1|6272796_6273258_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_163836276.1|6273274_6274189_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_163836277.1|6274438_6275860_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_163836278.1|6275964_6276861_+	EamA family transporter	NA	NA	NA	NA	NA
WP_163836279.1|6276894_6278331_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_163836280.1|6278528_6278699_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_163836281.1|6278763_6279375_+	LysE family translocator	NA	NA	NA	NA	NA
WP_163836282.1|6279610_6281182_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	48.2	1.5e-104
WP_163836283.1|6281197_6282319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836284.1|6282603_6282882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836285.1|6283213_6283855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836286.1|6283881_6285435_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	44.5	1.7e-41
WP_163836287.1|6285703_6287683_-	pilin	NA	NA	NA	NA	NA
WP_163836288.1|6288199_6289570_-	YjiH family protein	NA	NA	NA	NA	NA
WP_163836289.1|6290104_6290806_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_163836290.1|6291701_6292061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836291.1|6292320_6292785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836638.1|6292817_6293387_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_163836292.1|6294504_6295389_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_163836293.1|6295415_6295787_+	VOC family protein	NA	NA	NA	NA	NA
WP_163836294.1|6295804_6298831_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	28.4	5.7e-57
WP_163836295.1|6298796_6299843_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_163836296.1|6299864_6300887_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_163836297.1|6300887_6307301_+	FkbM family methyltransferase	NA	A0A2K9KZV5	Tupanvirus	25.5	8.8e-31
WP_163836298.1|6307467_6308028_+	cytochrome b	NA	NA	NA	NA	NA
WP_163836299.1|6308227_6309385_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_163836300.1|6309446_6311039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836301.1|6311028_6312570_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_163836302.1|6312572_6314207_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_163836303.1|6314199_6316308_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_163836639.1|6316294_6317125_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP048879	Oceanospirillales bacterium S2-4-1H plasmid pA, complete sequence	141078	0	24597	141078		Macacine_betaherpesvirus(20.0%)	17	NA	NA
WP_163836642.1|493_1591_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_163836643.1|1591_2926_-	AAA family ATPase	NA	A0A2I6B2X3	Macacine_betaherpesvirus	36.1	4.4e-62
WP_163836644.1|3169_4249_-	replication initiation protein	NA	NA	NA	NA	NA
WP_163836645.1|4814_5531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836646.1|5527_6628_-	hypothetical protein	NA	W0LNS9	Mycobacterium_phage	29.9	1.6e-12
WP_163836647.1|6969_7362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836648.1|7543_8038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836649.1|8118_8493_-	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_163836650.1|9427_10417_+	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	32.3	3.0e-23
WP_163836651.1|10419_10821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836652.1|10859_11597_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_163836653.1|11843_12572_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_163836654.1|12580_12973_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_163836655.1|13000_14290_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.9	7.1e-41
WP_163836656.1|14504_14849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836657.1|14883_16647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836658.1|16695_24597_+	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	35.4	3.9e-12
>prophage 2
NZ_CP048879	Oceanospirillales bacterium S2-4-1H plasmid pA, complete sequence	141078	30957	47733	141078	protease,transposase,terminase	Acinetobacter_phage(12.5%)	25	NA	NA
WP_163836793.1|30957_31287_+	hypothetical protein	NA	A0A0P0IKL1	Acinetobacter_phage	37.5	5.7e-11
WP_163836667.1|31271_31754_+	single-stranded DNA-binding protein	NA	A0A0U4K5C0	Pseudomonas_phage	60.0	1.2e-36
WP_163836668.1|32378_32555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836669.1|32638_32911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836794.1|33384_33834_+	transglycosylase SLT domain-containing protein	NA	M4R0Y9	Tetraselmis_viridis_virus	48.6	8.3e-29
WP_163836670.1|33833_34172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836671.1|34140_34371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836672.1|34363_34813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836673.1|34809_35907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836674.1|35899_37399_+|terminase	terminase	terminase	Q5QBP2	Enterobacteria_phage	44.6	2.4e-117
WP_163836675.1|37404_37683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836676.1|37916_38531_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	46.2	1.0e-37
WP_163836677.1|38647_39223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836678.1|39309_39732_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_163836679.1|39722_40001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836795.1|40247_40409_-	DUF2559 family protein	NA	NA	NA	NA	NA
WP_163836680.1|40531_40825_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163836796.1|40841_43022_-	ATP-dependent RecD-like DNA helicase	NA	A0A0H3UZA5	Geobacillus_virus	28.7	4.7e-61
WP_163836681.1|43186_43513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836682.1|43672_44008_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_163836683.1|44121_45204_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_163836684.1|45285_45741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836685.1|45762_46341_-	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	40.8	3.3e-22
WP_163836686.1|46337_46805_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_163836687.1|47106_47733_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	37.6	3.0e-29
>prophage 3
NZ_CP048879	Oceanospirillales bacterium S2-4-1H plasmid pA, complete sequence	141078	52502	53486	141078		Listeria_phage(100.0%)	1	NA	NA
WP_163836696.1|52502_53486_+	gas vesicle protein GvpN	NA	S4U6G7	Listeria_phage	25.3	3.3e-06
>prophage 4
NZ_CP048879	Oceanospirillales bacterium S2-4-1H plasmid pA, complete sequence	141078	77847	84601	141078		Ralstonia_phage(33.33%)	7	NA	NA
WP_163836726.1|77847_79971_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.5	6.3e-26
WP_163836727.1|80147_80441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836728.1|80462_80828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836729.1|81039_81240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836730.1|81340_82477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836731.1|82586_83291_-	hypothetical protein	NA	A0A1P8CX02	Bacillus_phage	31.7	8.7e-09
WP_163836732.1|83338_84601_-	Y-family DNA polymerase	NA	A0A1W6JNT0	Morganella_phage	50.0	1.8e-113
>prophage 5
NZ_CP048879	Oceanospirillales bacterium S2-4-1H plasmid pA, complete sequence	141078	89535	91906	141078	transposase	Lactococcus_phage(33.33%)	4	NA	NA
WP_163836741.1|89535_89745_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	2.2e-16
WP_163836742.1|90030_90708_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.0	1.3e-46
WP_163836743.1|90835_91201_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_163836744.1|91270_91906_-	methyltransferase domain-containing protein	NA	A0A2P1JQT7	Mycobacterium_phage	33.3	4.6e-17
>prophage 6
NZ_CP048879	Oceanospirillales bacterium S2-4-1H plasmid pA, complete sequence	141078	95161	140450	141078	tail	Escherichia_phage(61.9%)	47	NA	NA
WP_163836746.1|95161_96580_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	35.4	1.9e-63
WP_163836747.1|96581_97691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836748.1|98682_98943_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_163836749.1|99050_99482_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	46.4	1.1e-27
WP_163836750.1|99544_100246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836751.1|100301_100502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836752.1|100863_101463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836753.1|101464_101773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836754.1|101769_102840_+	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	33.1	3.0e-37
WP_163836755.1|102836_103340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836756.1|103332_104865_+|tail	tail fiber domain-containing protein	tail	A0A0F6R513	Sinorhizobium_phage	31.6	5.0e-17
WP_163836757.1|104854_105721_+	hypothetical protein	NA	A0A142EZX0	Stenotrophomonas_phage	35.5	6.5e-06
WP_163836758.1|105711_106431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836759.1|106408_107428_+	hypothetical protein	NA	A0A222YXZ0	Escherichia_phage	23.8	1.3e-26
WP_163836760.1|107417_108155_+	hypothetical protein	NA	A0A222YWF1	Escherichia_phage	34.8	2.4e-17
WP_163836761.1|108154_108445_+	PaaR repeat-containing protein	NA	Q71TL3	Escherichia_phage	41.3	1.0e-08
WP_163836762.1|108643_109333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836798.1|109488_109632_+	hypothetical protein	NA	G3MBI0	Bacillus_virus	45.7	2.6e-05
WP_163836763.1|109695_110292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836764.1|110528_112088_+	DUF2460 domain-containing protein	NA	Q1MVJ5	Enterobacteria_phage	31.5	2.7e-66
WP_163836765.1|112166_112424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836766.1|112420_114241_+	hypothetical protein	NA	A0A222YWC8	Escherichia_phage	28.9	9.4e-55
WP_163836767.1|114258_114897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836768.1|114902_115505_+	hypothetical protein	NA	A0A222YY02	Escherichia_phage	37.8	1.3e-29
WP_163836769.1|115533_116022_+	hypothetical protein	NA	A0A222YWE4	Escherichia_phage	36.0	1.4e-21
WP_163836770.1|116018_116579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836771.1|116578_117076_+	hypothetical protein	NA	A0A222YY05	Escherichia_phage	29.2	5.8e-15
WP_163836772.1|117082_117862_+	hypothetical protein	NA	A0A1B0VBL3	Salmonella_phage	28.4	7.9e-19
WP_163836773.1|117960_120009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836774.1|120011_120359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836775.1|120358_121756_+	lipopolysaccharide biosynthesis protein BplA	NA	Q71TP2	Escherichia_phage	31.7	1.1e-55
WP_163836776.1|121766_122552_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_163836777.1|122589_123132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836778.1|123316_123982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836779.1|124075_124465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836780.1|124707_125520_+	hypothetical protein	NA	A0A222YWB7	Escherichia_phage	32.7	1.4e-23
WP_163836799.1|125519_125948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836781.1|125966_126590_+	coiled-coil domain-containing protein 22	NA	NA	NA	NA	NA
WP_163836782.1|126593_127706_+	hypothetical protein	NA	A0A077SLK4	Escherichia_phage	35.3	7.1e-13
WP_163836783.1|127722_128046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836784.1|128048_129800_+	hypothetical protein	NA	G9BW42	Planktothrix_phage	36.5	1.8e-07
WP_163836785.1|129832_130528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836786.1|130739_131456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836787.1|131493_131952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836788.1|132104_138236_+	DEAD/DEAH box helicase family protein	NA	A0A077SK04	Escherichia_phage	33.8	1.6e-255
WP_163836789.1|138238_138667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836790.1|138845_140450_+	hypothetical protein	NA	A0A077SL38	Escherichia_phage	36.2	1.8e-73
>prophage 1
NZ_CP048880	Oceanospirillales bacterium S2-4-1H plasmid pB, complete sequence	102423	35956	46952	102423		uncultured_Caudovirales_phage(20.0%)	15	NA	NA
WP_163836830.1|35956_36355_-	hypothetical protein	NA	A0A2P1JUB0	Erwinia_phage	53.1	5.2e-35
WP_163836831.1|36354_36648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836832.1|36650_36812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836833.1|37671_38478_-	recombinase RecT	NA	A0A2H4J1F0	uncultured_Caudovirales_phage	62.8	1.9e-52
WP_163836834.1|38539_39583_-	hypothetical protein	NA	D2IYT8	Enterococcus_phage	40.7	4.9e-32
WP_163836835.1|39586_39901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836836.1|40040_40520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836837.1|40833_41592_+	NYN domain-containing protein	NA	A0A0R6PGY5	Moraxella_phage	42.0	2.5e-41
WP_163836838.1|41588_42206_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	32.4	2.9e-24
WP_163836839.1|42282_42507_+	Cro/Cl family transcriptional regulator	NA	M4R204	Salicola_phage	47.2	6.4e-06
WP_163836840.1|42484_43108_+	hypothetical protein	NA	A0A0S2SYA8	Pseudomonas_phage	27.2	1.5e-07
WP_163836841.1|43528_44392_+	replication protein	NA	K7PGT1	Enterobacteria_phage	38.3	2.8e-09
WP_163836842.1|44395_45118_+	replication protein P	NA	A0A2H4J1T4	uncultured_Caudovirales_phage	30.5	1.5e-19
WP_163836843.1|45238_45841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836844.1|45827_46952_+	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	30.6	2.4e-32
>prophage 2
NZ_CP048880	Oceanospirillales bacterium S2-4-1H plasmid pB, complete sequence	102423	53816	100604	102423	capsid,coat,transposase,terminase,integrase	Pseudomonas_phage(29.03%)	57	93362:93377	100374:100389
WP_163836857.1|53816_54158_+	hypothetical protein	NA	K7PJX6	Enterobacterial_phage	46.3	1.4e-07
WP_163836858.1|54175_55135_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_163836859.1|55702_56107_+	hypothetical protein	NA	A0A2I7S7C3	Vibrio_phage	34.0	4.0e-14
WP_163836860.1|56109_56325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836861.1|56321_56525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836862.1|56514_57138_+	hypothetical protein	NA	A0A2H4J2I6	uncultured_Caudovirales_phage	37.8	5.0e-24
WP_163836863.1|57134_58619_+|terminase	terminase	terminase	A0A2H4J8J8	uncultured_Caudovirales_phage	76.0	9.5e-231
WP_163836864.1|58618_60019_+	DUF4055 domain-containing protein	NA	A0A2H4J5M6	uncultured_Caudovirales_phage	55.4	2.3e-146
WP_163836865.1|60011_61112_+|capsid	minor capsid protein	capsid	A0A2H4J831	uncultured_Caudovirales_phage	55.5	1.9e-106
WP_163836866.1|61127_61877_+	hypothetical protein	NA	A0A060RIN6	Pseudomonas_phage	38.8	2.1e-21
WP_163836867.1|61889_62903_+|coat	phage coat protein	coat	A0A0B4ZZB1	Achromobacter_phage	53.2	3.4e-99
WP_163836868.1|62934_63225_+	hypothetical protein	NA	A0A2D0W9V2	Bordetella_phage	45.3	1.7e-06
WP_163836869.1|63226_63733_+	hypothetical protein	NA	A0A1B0VND3	Pseudomonas_phage	38.1	6.3e-17
WP_163836870.1|63729_64089_+	hypothetical protein	NA	A0A0S0NA58	Pseudomonas_phage	33.3	1.5e-09
WP_163836871.1|64468_64885_+	hypothetical protein	NA	A0A1X9IAQ7	Xanthomonas_phage	40.0	1.4e-22
WP_163836872.1|64885_65824_+	hypothetical protein	NA	A0A125SA50	Pseudomonas_phage	67.6	7.6e-117
WP_163836873.1|65823_66198_+	hypothetical protein	NA	A0A1B0Z0C9	Vibrio_phage	50.4	4.2e-26
WP_163836874.1|66224_66533_+	hypothetical protein	NA	A0A1L2C8U2	Pseudomonas_phage	56.2	2.7e-23
WP_163836875.1|66498_69435_+	tape measure protein	NA	A0A125SA53	Pseudomonas_phage	45.6	6.6e-42
WP_163836876.1|69434_70346_+	hypothetical protein	NA	A0A2D1GMZ0	Marinobacter_phage	39.1	7.5e-45
WP_163836877.1|70345_71314_+	hypothetical protein	NA	A0A2D2W2C7	Stenotrophomonas_phage	31.5	2.4e-25
WP_163836878.1|71310_72960_+	hypothetical protein	NA	A0A125SA56	Pseudomonas_phage	48.2	6.5e-148
WP_163836879.1|72956_73757_+	DUF2163 domain-containing protein	NA	A0A0A1IX16	Pseudomonas_phage	53.2	1.4e-79
WP_163836880.1|73756_73987_+	hypothetical protein	NA	A0A1X9IAN5	Xanthomonas_phage	58.4	8.2e-17
WP_163836881.1|73983_74181_+	hypothetical protein	NA	A0A1X9IAJ5	Xanthomonas_phage	61.4	9.5e-14
WP_163836882.1|74156_77006_+	hypothetical protein	NA	A0A0A1IVS6	Pseudomonas_phage	53.0	2.8e-215
WP_163836883.1|77005_77458_+	DUF2793 domain-containing protein	NA	A0A248XD96	Klebsiella_phage	41.9	6.2e-16
WP_163836884.1|77807_78473_+	AAA family ATPase	NA	A0A2H4JGZ2	uncultured_Caudovirales_phage	38.9	9.4e-29
WP_163836885.1|78483_79392_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_163836886.1|79448_80510_-	replication initiation protein	NA	A0A218MNI2	uncultured_virus	31.6	2.4e-10
WP_163836887.1|81247_81706_+	lysozyme	NA	A0A2I7R771	Vibrio_phage	45.5	9.9e-30
WP_163836888.1|81745_82138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836889.1|82159_82432_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	58.9	5.5e-20
WP_163836890.1|82657_82873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836891.1|82885_83233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836892.1|83400_84264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836893.1|84387_84615_+	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_163836894.1|84645_84873_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_163836895.1|85205_85997_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_163836896.1|86159_86639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836897.1|86732_87440_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_163836109.1|87888_88479_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.2	5.6e-41
WP_163836898.1|88669_90397_+	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_163836899.1|92137_93577_+|transposase	transposase	transposase	NA	NA	NA	NA
93362:93377	attL	GCTATTGATGAATTTA	NA	NA	NA	NA
WP_163836900.1|93577_94018_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_163836901.1|94062_94278_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_163836902.1|94249_94699_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_163836903.1|95009_95558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836904.1|95819_96242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836905.1|96899_97088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836906.1|97194_97803_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_163836907.1|98007_98343_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0N9RU54	Staphylococcus_phage	46.6	4.7e-05
WP_163836089.1|98650_98971_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_163836090.1|98986_99337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836908.1|99551_99743_+	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_163836909.1|99742_100156_+	PIN domain nuclease	NA	NA	NA	NA	NA
WP_163836910.1|100202_100604_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	44.9	2.2e-25
100374:100389	attR	GCTATTGATGAATTTA	NA	NA	NA	NA
>prophage 1
NZ_CP048881	Oceanospirillales bacterium S2-4-1H plasmid pC, complete sequence	82464	10905	53838	82464	capsid,portal,transposase,plate,terminase,tail,head	Aeromonas_phage(26.32%)	58	NA	NA
WP_163836926.1|10905_11265_+	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	47.8	5.1e-21
WP_163836927.1|11280_11787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836928.1|11796_12228_+	GIY-YIG nuclease family protein	NA	Q94MV0	Myxococcus_phage	37.5	1.3e-10
WP_163836929.1|12480_12735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836930.1|12963_13380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836931.1|13735_14119_+	N-acetylmuramoyl-L-alanine amidase	NA	I6R9Z4	Marinomonas_phage	55.8	8.9e-40
WP_163836932.1|14115_14721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836933.1|15001_15196_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	55.6	2.4e-09
WP_163836934.1|15272_16031_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_163836935.1|16045_16450_+	hypothetical protein	NA	A0A1B1INP1	uncultured_Mediterranean_phage	31.6	1.4e-06
WP_163836936.1|16451_17168_+	hypothetical protein	NA	A0A067ZIN2	Vibrio_phage	49.3	7.5e-32
WP_163836937.1|17193_17442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836938.1|17443_18208_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163836939.1|18326_18593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163836940.1|18831_19338_+	DUF1441 family protein	NA	A0A219Y9R8	Aeromonas_phage	44.2	9.3e-29
WP_163836941.1|19307_21305_+|terminase	phage terminase large subunit family protein	terminase	A0A219YAX2	Aeromonas_phage	53.0	3.2e-205
WP_163836942.1|21509_22976_+|portal	phage portal protein	portal	A0A219YAY2	Aeromonas_phage	46.1	6.3e-118
WP_163836943.1|22972_24253_+	S49 family peptidase	NA	A0A219YAK4	Aeromonas_phage	39.0	1.0e-71
WP_163836944.1|24256_24610_+|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	33.1	9.7e-09
WP_163836945.1|24606_24975_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_163836946.1|25060_26062_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	42.3	7.9e-72
WP_163836947.1|26061_26412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836948.1|26395_26995_+	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	29.7	1.1e-12
WP_163836949.1|26975_27467_+	hypothetical protein	NA	A0A219Y9U4	Aeromonas_phage	39.0	1.6e-22
WP_163836950.1|27459_28053_+|plate	phage baseplate assembly protein V	plate	A0A219YA41	Aeromonas_phage	44.2	1.3e-26
WP_163836951.1|28065_28419_+|plate	baseplate assembly protein W	plate	Q75QM0	Wolbachia_phage	44.6	2.7e-19
WP_163836952.1|28408_29254_+	hypothetical protein	NA	A0A219YA42	Aeromonas_phage	38.5	1.4e-45
WP_163836953.1|29240_29873_+|tail	phage tail protein I	tail	D4HTV4	Vibrio_phage	43.1	6.6e-32
WP_163836954.1|29879_30815_+|tail	phage tail protein	tail	A0A2H4J039	uncultured_Caudovirales_phage	43.0	5.7e-32
WP_163836955.1|30814_31348_+	hypothetical protein	NA	A0A1Y0T1B3	Pseudomonas_phage	28.3	3.7e-12
WP_163836956.1|31334_31820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836957.1|31826_32312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836958.1|32312_33470_+|tail	phage tail protein	tail	A0A219YA67	Aeromonas_phage	55.1	6.7e-107
WP_163836959.1|33484_33994_+|tail	phage major tail tube protein	tail	A0A219YB36	Aeromonas_phage	44.6	1.6e-36
WP_163836960.1|33996_34254_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	52.5	5.6e-14
WP_163836961.1|34259_34418_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_163836962.1|34428_36909_+|tail	phage tail tape measure protein	tail	H7BVM4	unidentified_phage	35.2	3.6e-65
WP_163836963.1|36901_37324_+|tail	phage tail protein	tail	K4I406	Acidithiobacillus_phage	34.6	1.3e-15
WP_163837013.1|37347_37524_+|tail	phage tail protein	tail	Q94MF6	Enterobacteria_phage	45.6	9.1e-08
WP_163836964.1|37848_38805_+	hypothetical protein	NA	A0A219YA20	Aeromonas_phage	40.7	4.6e-61
WP_163836965.1|39037_40279_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.8	5.8e-24
WP_163836108.1|40380_43488_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_163836109.1|43678_44269_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.2	5.6e-41
WP_163836966.1|44423_44618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163837014.1|44690_45698_+|capsid	major capsid protein	capsid	D4HTU6	Vibrio_phage	57.2	1.2e-104
WP_163836967.1|45681_46053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836968.1|46027_46624_+	hypothetical protein	NA	B0ZSF5	Halomonas_phage	31.2	8.7e-18
WP_163836969.1|46616_47114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836970.1|47097_47706_+|plate	phage baseplate assembly protein V	plate	A2I2X5	Vibrio_virus	44.4	1.2e-30
WP_163836971.1|47702_48038_+|plate	phage baseplate protein	plate	A2I2X7	Vibrio_virus	49.1	7.8e-24
WP_163836972.1|48034_49069_+|plate	baseplate assembly protein	plate	Q6R4V6	Vibrio_virus	45.6	8.7e-82
WP_163836973.1|49065_49698_+|tail	phage tail protein I	tail	A0A2H4JDK0	uncultured_Caudovirales_phage	36.7	1.0e-24
WP_163836974.1|49694_51002_+|tail	phage tail protein	tail	A0A2H4J931	uncultured_Caudovirales_phage	35.3	9.5e-25
WP_163836975.1|51001_51535_+	hypothetical protein	NA	A0A1Y0T1B3	Pseudomonas_phage	28.8	8.3e-12
WP_163836976.1|51521_52007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836977.1|52013_52505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836978.1|52498_52669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163836979.1|52668_53838_+|tail	phage tail protein	tail	Q6R4W2	Vibrio_virus	63.8	1.5e-138
