The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	0	44648	5151952	portal,terminase,capsid,tail,protease,head	Stx2-converting_phage(38.46%)	41	NA	NA
WP_001339613.1|0_1662_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.1	0.0e+00
WP_000173030.1|1725_3663_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|3707_3929_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_032167421.1|3874_6460_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.9	0.0e+00
WP_000125969.1|6456_6783_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	99.1	4.5e-53
WP_001007905.1|6792_7143_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573362.1|7139_7586_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_000133388.1|7582_7927_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|7991_8708_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|8722_9097_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|9192_9402_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_163510334.1|9449_12692_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
WP_000807937.1|12684_13026_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_001296027.1|13025_13724_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000194723.1|13734_14478_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_061089814.1|14423_15056_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000514648.1|15398_18872_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.5	0.0e+00
WP_001228358.1|18939_19539_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	95.5	1.0e-106
WP_000216499.1|19690_22861_+	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	59.3	2.0e-84
WP_000885578.1|22860_23445_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	5.0e-103
WP_000251936.1|23559_23730_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079500.1|24218_24725_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|24770_25271_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|25356_25536_-	general stress protein	NA	NA	NA	NA	NA
WP_000443071.1|25916_26723_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|26722_27916_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001551007.1|27927_29286_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	1.5e-36
WP_000763524.1|29289_30885_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001551009.1|30884_32447_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|32538_32583_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285692.1|32720_33602_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|33598_34219_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001551010.1|34246_36142_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291217.1|36352_37228_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_000622026.1|37397_38399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000710.1|38409_38718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278881.1|38769_39360_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559277.1|39356_40115_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_001523120.1|40334_41384_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|41419_41671_-	YciN family protein	NA	NA	NA	NA	NA
WP_001295576.1|42050_44648_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
>prophage 2
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	49572	50163	5151952		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|49572_50163_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 3
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	57976	59911	5151952		Lactococcus_phage(100.0%)	1	NA	NA
WP_001551016.1|57976_59911_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.5	1.1e-32
>prophage 4
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	68844	70863	5151952		Salmonella_phage(50.0%)	2	NA	NA
WP_001551021.1|68844_70008_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.1	1.1e-27
WP_000573407.1|70056_70863_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 5
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	83653	84919	5151952		Klosneuvirus(100.0%)	1	NA	NA
WP_001551026.1|83653_84919_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	1.6e-24
>prophage 6
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	103295	103811	5151952		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945045.1|103295_103811_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 7
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	113626	120896	5151952	tRNA	Bacillus_phage(20.0%)	6	NA	NA
WP_001314661.1|113626_114859_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|115113_116097_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001551034.1|116574_117948_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000081418.1|118076_119012_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_001295593.1|119187_119622_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837902.1|119762_120896_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	4.8e-118
>prophage 8
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	125851	126841	5151952		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|125851_126841_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 9
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	156399	160302	5151952		Klosneuvirus(100.0%)	1	NA	NA
WP_001551082.1|156399_160302_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	7.6e-54
>prophage 10
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	165641	168280	5151952	transposase	Escherichia_phage(33.33%)	4	NA	NA
WP_001306523.1|165641_166172_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
WP_000731833.1|166416_166590_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001309484.1|166661_166811_-	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_085948682.1|166910_168280_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	4.8e-112
>prophage 11
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	182501	189551	5151952		Phage_TP(25.0%)	7	NA	NA
WP_001551090.1|182501_184463_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	27.9	1.2e-23
WP_023910283.1|184554_184785_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813795.1|185006_185183_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	59.6	1.2e-12
WP_076797675.1|185228_185645_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.0	3.7e-31
WP_001551093.1|185723_187130_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001551094.1|187374_188520_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001551095.1|188537_189551_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 12
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	196756	199497	5151952	transposase	Saccharomonospora_phage(50.0%)	2	NA	NA
WP_000526135.1|196756_197215_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000689376.1|197394_199497_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.5	4.3e-136
>prophage 13
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	205254	214279	5151952		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_001563834.1|205254_209466_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	1.4e-21
WP_000618048.1|209462_209948_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000236740.1|211158_212208_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.0	2.4e-18
WP_001523249.1|212302_214279_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	44.1	1.5e-159
>prophage 14
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	218832	220377	5151952		Escherichia_phage(100.0%)	1	NA	NA
WP_001551102.1|218832_220377_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	36.5	3.7e-20
>prophage 15
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	228656	229757	5151952		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768393.1|228656_229757_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	65.4	5.3e-138
>prophage 16
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	235915	237893	5151952	transposase	Saccharomonospora_phage(33.33%)	3	NA	NA
WP_000502112.1|235915_236374_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	1.0e-13
WP_000781370.1|236481_236766_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_001551108.1|236882_237893_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	7.3e-25
>prophage 17
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	241166	243072	5151952		Planktothrix_phage(100.0%)	2	NA	NA
WP_001551109.1|241166_242093_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	3.5e-13
WP_001551110.1|242085_243072_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	3.8e-18
>prophage 18
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	247388	251195	5151952		Klosneuvirus(50.0%)	2	NA	NA
WP_001551112.1|247388_249788_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426277.1|249812_251195_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 19
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	256474	263410	5151952		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_023910036.1|256474_259270_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	1.1e-17
WP_001551114.1|259314_261687_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_000628568.1|261724_263410_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.0	2.9e-10
>prophage 20
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	287218	291943	5151952		Lactococcus_phage(50.0%)	4	NA	NA
WP_001551127.1|287218_288571_+	SIR2 family protein	NA	Q38324	Lactococcus_phage	30.6	5.6e-20
WP_001551128.1|288770_290093_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001296726.1|290092_290359_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_032146881.1|290542_291943_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.8	9.6e-108
>prophage 21
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	299365	300901	5151952		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001551131.1|299365_300901_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	4.4e-21
>prophage 22
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	308782	310201	5151952		Bacillus_phage(100.0%)	1	NA	NA
WP_001551135.1|308782_310201_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 23
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	317948	320078	5151952		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|317948_318332_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803518.1|318363_318582_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012603.1|318638_320078_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	2.8e-30
>prophage 24
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	327560	328472	5151952		Bacillus_phage(100.0%)	1	NA	NA
WP_000592809.1|327560_328472_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.0	1.1e-19
>prophage 25
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	333363	348801	5151952		Escherichia_phage(44.44%)	15	NA	NA
WP_000214712.1|333363_333567_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_001551142.1|333602_335063_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.5	2.5e-42
WP_001551143.1|335151_336519_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000836035.1|336576_337596_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	5.7e-17
WP_001295394.1|337607_338822_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001314753.1|339027_339354_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
WP_000705205.1|339488_339830_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|339864_340425_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001445899.1|340427_341138_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|341245_341551_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001551145.1|341749_344176_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
WP_072198879.1|344236_346660_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	6.3e-208
WP_000213028.1|346670_347288_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001551147.1|347289_348144_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_001551148.1|348186_348801_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	6.6e-29
>prophage 26
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	366561	367863	5151952		Bacillus_phage(100.0%)	1	NA	NA
WP_001551152.1|366561_367863_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	3.2e-17
>prophage 27
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	377759	379571	5151952		Vaccinia_virus(100.0%)	1	NA	NA
WP_001551153.1|377759_379571_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 28
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	399352	400627	5151952	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|399352_400627_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 29
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	407538	409037	5151952		Salmonella_phage(50.0%)	2	NA	NA
WP_163510344.1|407538_408060_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	1.7e-46
WP_000250656.1|408140_409037_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 30
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	417840	426644	5151952		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101181.1|417840_418668_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|418795_419377_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_001551165.1|419522_420692_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|420857_420947_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|421245_422271_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269493.1|422267_423200_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182362.1|423312_424524_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|424814_425963_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|426002_426644_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 31
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	432149	434416	5151952		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587586.1|432149_432962_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001070006.1|432965_433751_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001309532.1|433747_434416_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.8	4.5e-23
>prophage 32
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	442706	447790	5151952		environmental_halophage(33.33%)	5	NA	NA
WP_000144587.1|442706_443927_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.2	9.9e-93
WP_001551170.1|443923_445195_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948872.1|445169_445916_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	2.2e-10
WP_001389790.1|445925_447413_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367171.1|447421_447790_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	5.6e-15
>prophage 33
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	466382	569037	5151952	holin,portal,integrase,terminase,plate,capsid,lysis,tail,head,tRNA	Enterobacteria_phage(59.62%)	128	522287:522314	569062:569089
WP_000553724.1|466382_468083_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.6	1.4e-31
WP_001551175.1|468139_470518_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.5	7.9e-171
WP_000368046.1|470850_471684_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001551176.1|471840_472887_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270810.1|473017_473209_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001551177.1|473212_474649_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001544590.1|474711_475425_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209780.1|475671_476136_-	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_000029466.1|476213_476963_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154182.1|476962_477514_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_001520628.1|477576_478557_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_000997174.1|478765_479095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028119965.1|479202_479535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021543497.1|479567_480545_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.4	2.7e-85
WP_000904674.1|480594_480903_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	52.1	8.7e-22
WP_001151410.1|480999_481278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163510349.1|481292_481631_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	84.5	5.4e-49
WP_033879066.1|481641_481920_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000357028.1|481931_482174_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000021714.1|482170_482284_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	86.5	2.0e-08
WP_000022529.1|482459_482756_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	78.8	1.9e-34
WP_163510527.1|482974_483796_+	SPFH/Band 7/PHB domain protein	NA	A0A0A7NPW9	Enterobacteria_phage	99.2	4.6e-126
WP_163510351.1|483849_484470_+	ash family protein	NA	S5MQL6	Escherichia_phage	39.0	3.5e-09
WP_000599374.1|484466_484832_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	1.9e-60
WP_163510352.1|484838_487661_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.1	0.0e+00
WP_001167293.1|488141_488633_+	hypothetical protein	NA	G9L661	Escherichia_phage	93.3	2.0e-84
WP_000224220.1|488634_488898_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
WP_000236495.1|489484_490009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087814.1|490023_491070_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_163510354.1|491069_492821_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_033879060.1|492975_493812_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	4.2e-119
WP_163510355.1|493835_494888_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	92.9	2.5e-185
WP_033879056.1|494933_495734_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.8	1.8e-127
WP_000063100.1|495835_496330_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864901.1|496329_496530_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_001342221.1|496532_496856_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000072341.1|496852_497245_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_000780577.1|497241_497637_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_163510357.1|497775_499653_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	81.9	1.6e-304
WP_000921127.1|499676_500144_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000356371.1|500136_500772_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	2.6e-113
WP_001271944.1|500768_501350_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	5.0e-103
WP_001435533.1|501346_501697_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	2.7e-59
WP_163510359.1|501700_502597_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	2.5e-154
WP_000071724.1|502589_503198_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_163510360.1|503194_504958_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	49.2	9.9e-118
WP_000072167.1|504957_505572_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_032143395.1|505578_506052_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	52.4	8.1e-35
WP_134736916.1|506062_506524_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	67.5	1.3e-53
WP_001375851.1|506595_507195_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	2.0e-86
WP_001556996.1|507221_507710_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	3.0e-85
WP_163510362.1|507722_510530_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.4	0.0e+00
WP_000333503.1|510516_510672_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651568.1|510680_511055_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	72.4	2.0e-36
WP_000290462.1|511110_511623_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005453.1|511622_512807_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	4.9e-222
WP_032349750.1|512964_514074_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	5.3e-194
WP_000488099.1|514116_514377_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|514567_514708_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|515009_515309_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672359.1|515313_517701_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001551178.1|517715_518699_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	37.4	1.7e-34
WP_001386830.1|518837_518882_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|519004_519361_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|519414_519612_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|519708_520251_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|520254_522183_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
522287:522314	attL	AAATTGGTACACAATTTGGTACACAAAT	NA	NA	NA	NA
WP_000877736.1|522921_524664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551179.1|525145_525439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016247637.1|525481_526522_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	66.1	3.0e-122
WP_001518417.1|526531_526813_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
WP_016238726.1|526812_529188_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
WP_001551182.1|529252_529852_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	88.9	1.0e-98
WP_019843055.1|529919_533318_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.9	0.0e+00
WP_000090872.1|533378_534011_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.1	1.2e-94
WP_019843054.1|533947_534691_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	1.2e-149
WP_001551186.1|534696_535395_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_000847339.1|535394_535724_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	2.8e-58
WP_001551188.1|535720_538282_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.5	0.0e+00
WP_000459467.1|538274_538709_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	7.6e-64
WP_000479143.1|538690_539113_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	8.2e-71
WP_001445656.1|539128_539869_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	4.7e-130
WP_000683105.1|539876_540272_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000985116.1|540268_540847_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_000752996.1|540858_541212_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_000158895.1|541223_541619_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	93.2	4.5e-55
WP_001551189.1|541660_542686_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	7.6e-187
WP_001299443.1|542740_543073_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123230.1|543082_544402_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	6.9e-233
WP_001445654.1|544382_545984_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.2e-309
WP_000198149.1|545980_546187_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_163510363.1|546183_548109_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453587.1|548083_548629_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000738421.1|549297_549591_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001228695.1|549681_549864_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135296.1|550080_550578_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	1.6e-89
WP_000839582.1|550577_550793_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001146309.1|550981_551713_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000592546.1|552064_553024_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|553216_553741_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|553896_554274_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971055.1|554359_554500_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_000774488.1|554856_555147_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224916.1|555139_555310_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_001054342.1|555309_555765_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
WP_001303586.1|555761_555863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|555979_556777_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001445652.1|556786_557338_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001551199.1|557802_559329_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001299444.1|559386_559536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070450.1|559583_559916_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|559983_560286_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788813.1|560282_560984_-	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	99.1	3.8e-129
WP_001551200.1|560980_561910_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.0e-111
WP_001182891.1|561996_562536_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.6	6.8e-62
WP_001067458.1|562605_562836_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|562940_563630_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_023148105.1|564141_564432_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000995443.1|564507_564804_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	4.7e-49
WP_000100847.1|564809_565595_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186804.1|565591_566272_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	98.7	1.3e-131
WP_000682318.1|566268_566451_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000548531.1|566423_566615_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001386642.1|566625_566907_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763364.1|567005_567224_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000488401.1|567271_567550_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.7	1.4e-47
WP_001354056.1|567640_567871_+	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	55.7	2.9e-14
WP_001196928.1|567828_569037_-|integrase	site-specific integrase	integrase	I6R9B6	Salmonella_phage	74.9	4.7e-180
569062:569089	attR	AAATTGGTACACAATTTGGTACACAAAT	NA	NA	NA	NA
>prophage 34
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	580478	582740	5151952		Tupanvirus(100.0%)	1	NA	NA
WP_001551203.1|580478_582740_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 35
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	588857	589685	5151952		Bacillus_virus(100.0%)	1	NA	NA
WP_000175037.1|588857_589685_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 36
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	597161	598382	5151952		Klosneuvirus(100.0%)	1	NA	NA
WP_001551210.1|597161_598382_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.3	2.5e-27
>prophage 37
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	605146	605800	5151952		Planktothrix_phage(100.0%)	1	NA	NA
WP_001328827.1|605146_605800_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.7	2.4e-13
>prophage 38
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	610190	612146	5151952		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235805.1|610190_612146_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
>prophage 39
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	617070	621156	5151952		Tupanvirus(50.0%)	4	NA	NA
WP_001135079.1|617070_617712_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.4	3.8e-19
WP_000438821.1|617804_619163_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|619280_620039_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723733.1|620175_621156_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	1.0e-07
>prophage 40
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	629969	630824	5151952		Indivirus(100.0%)	1	NA	NA
WP_001389767.1|629969_630824_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	25.0	3.0e-11
>prophage 41
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	634142	638719	5151952		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|634142_635426_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_001551217.1|635572_637048_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766137.1|637228_638719_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 42
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	653473	661578	5151952	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|653473_655159_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|655363_655945_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220981.1|655983_656679_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128845.1|656736_658647_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	3.5e-92
WP_001295493.1|658778_659123_+	RidA family protein	NA	NA	NA	NA	NA
WP_001322969.1|659484_659844_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|659963_660143_-	YoaH family protein	NA	NA	NA	NA	NA
WP_001551226.1|660216_661578_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.7	2.6e-41
>prophage 43
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	665440	666997	5151952		Moraxella_phage(100.0%)	1	NA	NA
WP_000394985.1|665440_666997_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 44
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	672637	672847	5151952		Morganella_phage(100.0%)	1	NA	NA
WP_160515929.1|672637_672847_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	9.1e-23
>prophage 45
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	678179	680228	5151952		Moraxella_phage(100.0%)	1	NA	NA
WP_001055785.1|678179_680228_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 46
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	687724	696059	5151952	transposase	Escherichia_phage(40.0%)	10	NA	NA
WP_163510366.1|687724_688381_-	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	48.6	2.6e-55
WP_000976472.1|688776_689118_-	YebY family protein	NA	NA	NA	NA	NA
WP_001551232.1|689130_690003_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|690006_690381_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|690519_690750_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011653.1|690851_691508_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|691531_692194_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_001551233.1|692190_694251_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000064873.1|694407_694833_-|transposase	IS200/IS605-like element ISEc46 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	49.6	8.9e-25
WP_001551234.1|694889_696059_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	99.0	1.7e-203
>prophage 47
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	702012	703488	5151952		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|702012_703488_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 48
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	707487	714554	5151952		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|707487_708810_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_011076428.1|708825_709758_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|709836_710592_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|710588_711374_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568522.1|711523_712534_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|712542_713154_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010723105.1|713292_713358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024929.1|713428_714031_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001551239.1|714032_714554_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 49
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	718572	720623	5151952		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_001563891.1|718572_719391_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	96.9	4.6e-70
WP_000252980.1|719443_719839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019591.1|719879_720623_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 50
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	727107	728841	5151952	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025308.1|727107_728841_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	4.4e-86
>prophage 51
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	733361	739005	5151952		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|733361_733751_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|733765_734815_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204341.1|734817_735678_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001563895.1|735696_737298_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.5	1.2e-13
WP_001370571.1|737343_739005_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	7.6e-11
>prophage 52
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	749091	750606	5151952		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187819.1|749091_750606_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 53
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	762599	763352	5151952		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|762599_763352_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 54
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	775571	776243	5151952		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001543845.1|775571_776243_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.6e-81
>prophage 55
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	791426	803876	5151952		Bacillus_phage(28.57%)	13	NA	NA
WP_001598510.1|791426_793121_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009306.1|793358_793541_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|793619_794537_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|794709_795630_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|795618_796089_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001543850.1|796069_797488_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_001543851.1|797554_798250_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001313057.1|798289_798655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824364.1|799221_800295_+	porin	NA	Q1MVN1	Enterobacteria_phage	51.9	2.8e-99
WP_001333883.1|800434_800680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218214.1|800887_801739_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826766.1|801846_803205_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.0	8.7e-05
WP_001339045.1|803204_803876_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 56
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	807419	852537	5151952	holin,portal,integrase,terminase,capsid,tail,protease,head,transposase	Escherichia_phage(48.0%)	63	820293:820307	854260:854274
WP_001079090.1|807419_807950_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_016245365.1|808930_809218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204583.1|809227_809506_-	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	46.2	3.0e-21
WP_001551243.1|809502_811569_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	62.5	2.4e-147
WP_032263296.1|811633_812233_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	97.0	8.2e-109
WP_163510375.1|812300_815696_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.9	0.0e+00
WP_000741589.1|815756_816404_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_163510377.1|816301_817045_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	1.0e-148
WP_021579748.1|817050_817749_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	2.4e-131
WP_001115183.1|817748_818090_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.4	7.1e-41
WP_163510378.1|818082_821310_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.5	0.0e+00
820293:820307	attL	GTTGCACTTCAGCAA	NA	NA	NA	NA
WP_000978930.1|821356_821635_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.8	3.6e-43
WP_000164661.1|821658_822030_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000097528.1|822044_822749_-	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	94.4	2.8e-116
WP_001206698.1|822808_823153_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	98.2	6.1e-56
WP_000968644.1|823149_823599_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|823595_823934_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719066.1|823942_824260_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_163510380.1|824336_825554_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.4	2.9e-161
WP_000999828.1|825568_826168_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923129.1|826160_827387_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.1	1.1e-203
WP_000811487.1|827376_827538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140907.1|827534_829292_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
WP_001523362.1|829291_829774_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	96.9	9.6e-84
WP_001140099.1|829921_830272_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_163510382.1|830376_830562_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.0	4.6e-18
WP_000992100.1|830778_831312_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_001545374.1|831375_831726_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.2e-37
WP_000839574.1|831730_831946_-|holin	holin	holin	M1FN85	Enterobacteria_phage	100.0	2.4e-34
WP_163510384.1|832691_833513_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	7.4e-76
WP_000139998.1|833527_833890_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	9.6e-36
WP_163510386.1|833890_834949_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.5e-89
WP_024175747.1|834950_835229_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
WP_000737636.1|835525_835918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001013636.1|836061_836274_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_000206826.1|836508_836853_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
WP_000207997.1|836849_837017_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000224227.1|837027_837291_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000206712.1|837292_837733_-	hypothetical protein	NA	A0A2I6PID2	Escherichia_phage	50.3	2.0e-19
WP_001514293.1|837734_838094_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	74.5	1.6e-38
WP_000753053.1|838090_838267_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
WP_001224665.1|838259_838442_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_000403785.1|838535_838892_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_117002471.1|838869_839379_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.1e-42
WP_000027851.1|839375_839882_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	68.2	3.8e-38
WP_103755936.1|839878_840064_-	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_163510387.1|840050_840317_-	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	95.0	6.1e-40
WP_001151257.1|840313_840739_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	1.4e-62
WP_163510388.1|840779_841850_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	3.8e-64
WP_163510389.1|841921_842347_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261754.1|842343_842571_-	cell division control protein	NA	NA	NA	NA	NA
WP_000444613.1|842670_843315_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	25.9	8.8e-08
WP_000379575.1|843592_843748_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171946.1|843907_844126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296188.1|844129_844294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|844693_844882_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|844878_845070_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_163510390.1|845163_847605_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.1	5.0e-112
WP_000096344.1|847663_847867_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_163510391.1|847866_848892_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_001598512.1|849127_849925_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000878218.1|851374_852241_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|852237_852537_-|transposase	transposase	transposase	NA	NA	NA	NA
854260:854274	attR	TTGCTGAAGTGCAAC	NA	NA	NA	NA
>prophage 57
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	869793	871595	5151952	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_001323403.1|869793_870573_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000255944.1|870572_871595_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 58
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	881373	883532	5151952		Yersinia_phage(33.33%)	4	NA	NA
WP_001234530.1|881373_882195_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000860076.1|882276_882756_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001186773.1|882771_883248_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|883310_883532_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 59
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	887873	895723	5151952	tail,integrase	Stx2-converting_phage(28.57%)	9	885321:885333	899992:900004
885321:885333	attL	TACGGGAAGCTGG	NA	NA	NA	NA
WP_001421515.1|887873_889040_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.5	6.1e-225
WP_000221969.1|890276_891356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000805577.1|891474_892068_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	63.1	7.3e-57
WP_000141754.1|892288_892576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000008235.1|893089_893626_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_001242744.1|893616_893979_+	hypothetical protein	NA	U5P092	Shigella_phage	96.7	3.4e-65
WP_000627693.1|893978_894284_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	3.4e-50
WP_000132739.1|894372_894564_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001007952.1|894544_895723_-|integrase	site-specific integrase	integrase	K7P7J2	Enterobacteria_phage	99.2	1.7e-230
899992:900004	attR	CCAGCTTCCCGTA	NA	NA	NA	NA
>prophage 60
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	902895	903795	5151952		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|902895_903795_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 61
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	911151	915758	5151952		Paramecium_bursaria_Chlorella_virus(25.0%)	4	NA	NA
WP_000704851.1|911151_912318_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.7	3.5e-111
WP_000043454.1|912566_913973_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	2.3e-37
WP_000286642.1|914094_915003_-	alpha-1,2-fucosyltransferase	NA	A0A2H4UUT1	Bodo_saltans_virus	34.1	4.1e-27
WP_000626461.1|915014_915758_-	glycosyltransferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	29.7	3.1e-12
>prophage 62
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	919020	930520	5151952		Bacillus_phage(25.0%)	10	NA	NA
WP_000736841.1|919020_920409_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.4	2.9e-32
WP_001286270.1|920412_921861_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.3	2.5e-58
WP_001421539.1|921853_922354_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043606.1|922356_923322_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
WP_001140914.1|923324_924446_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.5	5.3e-133
WP_000799972.1|924472_925489_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000234390.1|925507_926527_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.3	3.7e-85
WP_000183077.1|926836_927730_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000999474.1|927972_928968_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.7	8.6e-10
WP_001116010.1|929125_930520_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.6	2.6e-20
>prophage 63
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	936328	943210	5151952		Bacillus_phage(25.0%)	6	NA	NA
WP_023063704.1|936328_937699_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	1.9e-31
WP_000079285.1|937979_939416_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_000699772.1|939418_940642_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_001342585.1|940638_941118_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043654.1|941120_942086_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	51.1	1.3e-87
WP_000048190.1|942088_943210_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 64
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	947453	957929	5151952		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654503.1|947453_948293_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000137189.1|948470_950633_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|950635_951079_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978084.1|951084_952224_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_001300971.1|952882_954466_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252331.1|954739_956593_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|956614_957196_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|957287_957929_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 65
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	962593	963946	5151952		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469734.1|962593_963946_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.2e-06
>prophage 66
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	977387	983491	5151952	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_000675144.1|977387_978791_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137877.1|978787_979510_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|979689_980022_+	YegP family protein	NA	NA	NA	NA	NA
WP_001551329.1|980169_981531_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	98.6	1.0e-215
WP_001303579.1|981860_982178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807371.1|982591_983491_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
>prophage 67
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	992634	996191	5151952		Serratia_phage(50.0%)	4	NA	NA
WP_000846217.1|992634_993639_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_001551335.1|993635_994601_+	kinase	NA	NA	NA	NA	NA
WP_000434044.1|994574_995321_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001551336.1|995372_996191_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.9	2.3e-24
>prophage 68
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1006837	1008871	5151952	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001551343.1|1006837_1008871_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	1.8e-54
>prophage 69
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1024574	1034017	5151952		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001551350.1|1024574_1025711_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
WP_001551351.1|1025707_1027708_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|1027832_1028294_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001551352.1|1028335_1028806_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001308766.1|1028852_1029572_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1029568_1031254_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240398.1|1031475_1032207_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|1032266_1032374_+	protein YohO	NA	NA	NA	NA	NA
WP_000783134.1|1032354_1033086_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569343.1|1033090_1034017_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 70
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1054338	1055859	5151952		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255032.1|1054338_1055859_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 71
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1059553	1063327	5151952		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|1059553_1060222_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425456.1|1060479_1061316_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_163510395.1|1061347_1063327_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	1.9e-13
>prophage 72
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1067396	1068254	5151952		Catovirus(100.0%)	1	NA	NA
WP_000873880.1|1067396_1068254_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
>prophage 73
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1082748	1087049	5151952		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001091917.1|1082748_1084215_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	1.5e-42
WP_000198839.1|1084332_1085319_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001297918.1|1085357_1086071_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|1086482_1087049_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 74
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1092803	1100452	5151952		Vibrio_phage(50.0%)	7	NA	NA
WP_000194914.1|1092803_1094393_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|1094396_1094741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213361.1|1095073_1096264_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|1096291_1096987_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578079.1|1097136_1098897_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494186.1|1099021_1099306_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|1099444_1100452_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 75
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1112150	1112768	5151952		Bacillus_virus(100.0%)	1	NA	NA
WP_001328413.1|1112150_1112768_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 76
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1121534	1127303	5151952		Bacillus_phage(25.0%)	5	NA	NA
WP_000422197.1|1121534_1123178_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.2	7.2e-14
WP_000884957.1|1123253_1123904_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786434.1|1123903_1124968_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	38.5	3.1e-18
WP_000406119.1|1125041_1126097_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865539.1|1126208_1127303_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.2	2.0e-116
>prophage 77
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1131466	1136309	5151952		Hokovirus(50.0%)	2	NA	NA
WP_000876029.1|1131466_1134316_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.5	8.4e-42
WP_000559127.1|1134482_1136309_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	4.4e-20
>prophage 78
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1151232	1162972	5151952		Pseudomonas_phage(40.0%)	6	NA	NA
WP_001281227.1|1151232_1153860_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
WP_000990772.1|1154006_1154729_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_021519829.1|1154789_1158518_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.6	1.6e-21
WP_001075170.1|1159213_1161499_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332037.1|1161587_1162718_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_000135039.1|1162717_1162972_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	74.6	1.5e-24
>prophage 79
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1167733	1168810	5151952		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000779071.1|1167733_1168810_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.9e-08
>prophage 80
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1174702	1179017	5151952	transposase	Sodalis_phage(50.0%)	4	NA	NA
WP_001551378.1|1174702_1175605_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	45.2	7.4e-69
WP_000992992.1|1175645_1176449_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_163510397.1|1176465_1177755_-	MFS transporter	NA	NA	NA	NA	NA
WP_001551380.1|1177811_1179017_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	2.7e-26
>prophage 81
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1182620	1187624	5151952		Tupanvirus(50.0%)	4	NA	NA
WP_001306469.1|1182620_1183223_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
WP_001376970.1|1183530_1184670_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	30.1	6.5e-30
WP_000461642.1|1184673_1185642_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	4.0e-36
WP_001551384.1|1185641_1187624_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.1e-19
>prophage 82
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1203620	1204079	5151952	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_001550720.1|1203620_1204079_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	2.9e-13
>prophage 83
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1223088	1226316	5151952		Salmonella_phage(50.0%)	3	NA	NA
WP_000813860.1|1223088_1223688_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012889.1|1223746_1225579_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001551397.1|1225665_1226316_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	6.8e-08
>prophage 84
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1236875	1238736	5151952		Sodalis_phage(50.0%)	2	NA	NA
WP_000156122.1|1236875_1237766_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.2	3.1e-67
WP_001293612.1|1237962_1238736_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 85
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1242947	1244465	5151952		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|1242947_1244465_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 86
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1250850	1251987	5151952		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_001551402.1|1250850_1251987_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	1.7e-22
>prophage 87
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1260524	1261610	5151952		Pandoravirus(100.0%)	1	NA	NA
WP_001551407.1|1260524_1261610_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	5.3e-90
>prophage 88
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1279691	1280624	5151952		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|1279691_1280624_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 89
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1283663	1285097	5151952		Bacillus_phage(100.0%)	1	NA	NA
WP_001551412.1|1283663_1285097_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	5.3e-29
>prophage 90
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1291750	1299326	5151952		Bacillus_phage(50.0%)	4	NA	NA
WP_001551418.1|1291750_1295344_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
WP_001314918.1|1295399_1296545_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|1296618_1297563_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001551419.1|1297631_1299326_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.4	4.0e-23
>prophage 91
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1303016	1303937	5151952		Morganella_phage(100.0%)	1	NA	NA
WP_001551422.1|1303016_1303937_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.4	3.2e-75
>prophage 92
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1307755	1308490	5151952		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|1307755_1308490_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 93
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1335335	1350717	5151952		Streptococcus_phage(33.33%)	15	NA	NA
WP_001551434.1|1335335_1337351_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.3	1.1e-149
WP_001317975.1|1337421_1338420_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|1338649_1339411_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|1339595_1340567_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|1340950_1341208_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|1341252_1342980_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|1343020_1343530_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096660.1|1343571_1344423_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_001551436.1|1344527_1344896_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001295461.1|1344898_1345810_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	7.7e-58
WP_000021031.1|1345943_1347041_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852686.1|1347030_1347906_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458406.1|1347905_1348739_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290240.1|1348738_1349755_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000517443.1|1349925_1350717_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
>prophage 94
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1354195	1359130	5151952		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001520983.1|1354195_1355497_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_021515101.1|1355554_1356454_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.9	7.7e-26
WP_000838945.1|1356549_1357125_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001296281.1|1357185_1357635_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|1357621_1358047_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102892.1|1358260_1359130_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
>prophage 95
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1378083	1379034	5151952		Cyanophage(100.0%)	1	NA	NA
WP_001003734.1|1378083_1379034_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 96
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1396301	1397015	5151952		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1396301_1397015_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 97
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1418283	1422996	5151952	transposase	Enterobacteria_phage(25.0%)	5	NA	NA
WP_000198328.1|1418283_1419573_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_000526135.1|1419723_1420182_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001295473.1|1420369_1420996_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|1421320_1422358_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028621.1|1422357_1422996_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.9	9.0e-29
>prophage 98
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1429242	1435727	5151952		Escherichia_phage(66.67%)	7	NA	NA
WP_000017552.1|1429242_1429395_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|1429412_1429604_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001295476.1|1429914_1430433_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_001551456.1|1430448_1430988_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.3	3.2e-43
WP_001551457.1|1431082_1432660_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|1432728_1434195_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_001551458.1|1434356_1435727_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
>prophage 99
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1444557	1444989	5151952		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|1444557_1444989_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 100
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1454858	1461382	5151952		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133560.1|1454858_1456142_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	4.9e-34
WP_000523616.1|1456386_1456587_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124471.1|1456598_1456934_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196617.1|1456935_1458786_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001551463.1|1458802_1459318_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|1459413_1459737_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|1459753_1460140_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|1460167_1461382_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 101
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1476518	1478030	5151952		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493485.1|1476518_1478030_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 102
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1483788	1495096	5151952		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|1483788_1485042_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_001551472.1|1485369_1486560_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|1486604_1486943_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|1487003_1488338_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215901.1|1488327_1489041_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_019842313.1|1489205_1490633_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.0	1.4e-16
WP_163510407.1|1491208_1495096_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	1.7e-130
>prophage 103
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1499214	1499475	5151952		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196285.1|1499214_1499475_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
>prophage 104
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1502934	1506677	5151952		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|1502934_1503615_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|1503887_1504862_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|1504877_1506677_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 105
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1512448	1518537	5151952	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|1512448_1513783_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001551513.1|1513815_1514697_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001521088.1|1514799_1515387_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|1515448_1515832_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262721.1|1516136_1516826_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	9.3e-56
WP_001521090.1|1516873_1517911_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1518117_1518537_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 106
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1523830	1526786	5151952	transposase	Burkholderia_virus(50.0%)	2	NA	NA
WP_000841103.1|1523830_1525129_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_100190661.1|1525437_1526786_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.1	5.1e-74
>prophage 107
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1532366	1534940	5151952		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|1532366_1534940_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 108
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1540846	1541917	5151952		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168045.1|1540846_1541917_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 109
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1555661	1556144	5151952		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000162574.1|1555661_1556144_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 110
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1571575	1575627	5151952		Klosneuvirus(50.0%)	4	NA	NA
WP_001551531.1|1571575_1572856_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	5.4e-33
WP_001295173.1|1573093_1574494_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|1574514_1575177_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522413.1|1575177_1575627_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	38.2	7.5e-06
>prophage 111
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1581433	1586731	5151952		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|1581433_1581679_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001551533.1|1581675_1582086_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	43.5	3.9e-17
WP_001551534.1|1582058_1584203_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	3.8e-196
WP_001521117.1|1584212_1585172_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	7.0e-134
WP_000985490.1|1585528_1586731_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 112
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1599714	1605100	5151952	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|1599714_1599900_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047168.1|1600134_1602765_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140506.1|1602892_1603393_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|1603461_1604523_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|1604602_1605100_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 113
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1610567	1611533	5151952		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|1610567_1611533_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 114
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1618938	1619949	5151952		Enterobacteria_phage(100.0%)	1	NA	NA
WP_029130985.1|1618938_1619949_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.3	1.0e-26
>prophage 115
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1639057	1646197	5151952		Escherichia_phage(83.33%)	6	NA	NA
WP_001272891.1|1639057_1641619_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	2.7e-31
WP_001141345.1|1641724_1642381_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001295181.1|1642431_1643199_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_000847985.1|1643394_1644303_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001551546.1|1644299_1645562_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	3.7e-135
WP_001278994.1|1645558_1646197_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 116
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1652466	1655127	5151952		uncultured_Mediterranean_phage(66.67%)	3	NA	NA
WP_001272592.1|1652466_1653606_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|1653745_1654372_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|1654365_1655127_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 117
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1658239	1660272	5151952		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|1658239_1658845_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001551550.1|1658844_1660272_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 118
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1679726	1681074	5151952	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_163510420.1|1679726_1681074_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.7	4.3e-73
>prophage 119
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1685743	1686529	5151952		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_001551559.1|1685743_1686529_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	7.7e-22
>prophage 120
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1691610	1696531	5151952		Vibrio_phage(33.33%)	3	NA	NA
WP_001199973.1|1691610_1692282_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_000036723.1|1693507_1694806_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|1694893_1696531_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 121
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1700564	1704679	5151952		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_001551563.1|1700564_1701866_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	9.7e-38
WP_000186450.1|1701922_1704679_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 122
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1712222	1713071	5151952		Vibrio_phage(100.0%)	1	NA	NA
WP_000100411.1|1712222_1713071_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	3.6e-41
>prophage 123
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1717837	1718683	5151952		Bacillus_phage(100.0%)	1	NA	NA
WP_001214569.1|1717837_1718683_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	4.3e-10
>prophage 124
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1730209	1745594	5151952	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_001299106.1|1730209_1731415_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	1.7e-73
WP_000184256.1|1731414_1731858_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|1731908_1732715_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|1732790_1733888_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|1734466_1735720_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|1735951_1737283_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775943.1|1737344_1739171_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	5.9e-25
WP_001551572.1|1739170_1742713_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
WP_001138160.1|1742705_1745594_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	4.0e-68
>prophage 125
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1751071	1757844	5151952		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|1751071_1751866_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|1751872_1752748_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957914.1|1752898_1755145_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|1755157_1755688_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|1756372_1757062_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|1757130_1757844_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 126
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1767545	1770681	5151952	transposase	Saccharomonospora_phage(33.33%)	3	NA	NA
WP_001550737.1|1767545_1768004_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	1.0e-13
WP_000256426.1|1768186_1769605_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|1769919_1770681_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 127
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1802488	1803241	5151952		Clostridium_phage(100.0%)	1	NA	NA
WP_001309712.1|1802488_1803241_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 128
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1827521	1842913	5151952	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|1827521_1828922_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001564001.1|1828939_1830256_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|1830291_1831659_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838428.1|1831694_1832183_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001564003.1|1832182_1834102_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|1834537_1835986_+	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001050745.1|1835987_1836113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|1836109_1836181_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192788.1|1836235_1836784_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|1836826_1838344_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|1838353_1839452_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_001564004.1|1839542_1841276_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	4.1e-60
WP_001564005.1|1841281_1841992_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|1842016_1842913_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 129
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1846718	1851191	5151952		Pandoravirus(50.0%)	2	NA	NA
WP_163510421.1|1846718_1848152_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	2.6e-31
WP_001564010.1|1848317_1851191_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	3.1e-262
>prophage 130
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1859326	1860559	5151952		Catovirus(100.0%)	1	NA	NA
WP_001151611.1|1859326_1860559_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.1	1.6e-103
>prophage 131
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1878398	1879076	5151952		Bacillus_virus(100.0%)	1	NA	NA
WP_000956898.1|1878398_1879076_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	4.2e-08
>prophage 132
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1884778	1885687	5151952		Yersinia_phage(100.0%)	1	NA	NA
WP_000646940.1|1884778_1885687_+	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	56.1	5.2e-54
>prophage 133
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1893511	1894666	5151952		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|1893511_1894666_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 134
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1920527	1921793	5151952	integrase	Enterobacteria_phage(100.0%)	1	1912154:1912167	1922921:1922934
1912154:1912167	attL	TATAACCGTCAATA	NA	NA	NA	NA
WP_001218773.1|1920527_1921793_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	7.2e-78
WP_001218773.1|1920527_1921793_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	7.2e-78
1922921:1922934	attR	TATAACCGTCAATA	NA	NA	NA	NA
>prophage 135
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1932416	1934272	5151952		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502858.1|1932416_1933055_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	3.0e-56
WP_022645126.1|1933039_1934272_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.9	1.7e-60
>prophage 136
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1949988	1950564	5151952		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000722279.1|1949988_1950564_+	DJ-1/PfpI family protein	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	31.8	1.5e-14
>prophage 137
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1957389	1960971	5151952		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000792585.1|1957389_1958619_+	ATPase	NA	Q9EYF3	Enterobacteria_phage	30.3	5.6e-19
WP_000494233.1|1958635_1959691_+	response regulator	NA	NA	NA	NA	NA
WP_001001003.1|1959819_1960971_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	55.2	1.3e-107
>prophage 138
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1980977	1983317	5151952		Yersinia_phage(33.33%)	4	NA	NA
WP_001175165.1|1980977_1981796_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.5	6.5e-48
WP_163510423.1|1982061_1982541_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	4.0e-13
WP_001186774.1|1982556_1983033_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692341.1|1983095_1983317_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	4.2e-10
>prophage 139
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1986983	1987967	5151952		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001296394.1|1986983_1987967_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	6.2e-37
>prophage 140
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	1995203	1996382	5151952		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_001305084.1|1995203_1996382_-	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.6	2.1e-108
>prophage 141
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2003101	2003776	5151952		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000590243.1|2003101_2003776_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.4	2.7e-07
>prophage 142
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2036419	2037592	5151952		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524940.1|2036419_2037592_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	9.4e-40
>prophage 143
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2059752	2060637	5151952		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018777.1|2059752_2060637_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	3.7e-65
>prophage 144
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2066480	2078611	5151952		Staphylococcus_phage(25.0%)	10	NA	NA
WP_000013149.1|2066480_2067308_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_001551654.1|2067507_2068434_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848523.1|2068484_2068742_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_001551655.1|2068783_2071003_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|2071113_2072526_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965711.1|2072600_2073338_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_060626348.1|2073571_2075830_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	7.0e-84
WP_001551657.1|2075967_2077575_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000183492.1|2077683_2078166_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|2078218_2078611_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 145
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2085362	2097808	5151952		uncultured_Caudovirales_phage(16.67%)	11	NA	NA
WP_001551660.1|2085362_2086346_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.6	8.5e-10
WP_000940876.1|2086342_2087152_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	2.7e-14
WP_001551661.1|2087525_2089667_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000195292.1|2089730_2091623_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.9	7.6e-92
WP_001551663.1|2091651_2092233_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|2092232_2093060_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|2093084_2093507_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|2093507_2094137_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|2094341_2095823_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|2095970_2096642_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|2096647_2097808_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
>prophage 146
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2103700	2104354	5151952		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001551665.1|2103700_2104354_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	1.7e-46
>prophage 147
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2108642	2110076	5151952		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|2108642_2110076_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 148
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2115213	2116452	5151952	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_001551671.1|2115213_2116452_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 149
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2122754	2138815	5151952	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264352.1|2122754_2123768_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|2124005_2124221_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|2124331_2126077_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|2126271_2128113_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|2128191_2128698_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001551675.1|2128951_2129716_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018005.1|2129993_2130617_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094690.1|2130645_2132166_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_001551676.1|2132472_2133963_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	1.4e-32
WP_000450588.1|2134004_2134337_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212438.1|2134555_2135539_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001551677.1|2135722_2138815_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	5.9e-158
>prophage 150
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2152443	2153409	5151952		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|2152443_2153409_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 151
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2174128	2176423	5151952		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|2174128_2176423_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 152
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2184243	2185389	5151952		Streptococcus_phage(100.0%)	1	NA	NA
WP_001309778.1|2184243_2185389_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	42.0	4.0e-51
>prophage 153
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2203010	2210815	5151952		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809263.1|2203010_2203874_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
WP_001551699.1|2203938_2205975_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246828.1|2205932_2206328_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|2206347_2206938_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646049.1|2206947_2207523_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001551701.1|2207644_2208685_-	permease	NA	NA	NA	NA	NA
WP_000084526.1|2208757_2209393_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|2209520_2210039_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001551702.1|2210018_2210462_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189315.1|2210512_2210815_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 154
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2216517	2218407	5151952		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|2216517_2218407_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 155
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2223888	2230527	5151952		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|2223888_2226561_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031055.1|2226585_2228073_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|2228100_2228553_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|2229183_2230527_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 156
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2234601	2237474	5151952	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|2234601_2235450_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|2235539_2237474_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 157
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2244102	2245580	5151952		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|2244102_2245074_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445407.1|2245301_2245580_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	3.4e-17
>prophage 158
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2249648	2264442	5151952		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|2249648_2250458_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_001551707.1|2250667_2251645_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|2251658_2252645_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030006.1|2252665_2253232_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.5	6.5e-55
WP_000030537.1|2253228_2253804_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|2253772_2254330_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|2254336_2255062_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|2255109_2256543_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|2256565_2256853_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|2256970_2257462_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|2257507_2258362_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|2258358_2258631_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620396.1|2258843_2259476_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047064.1|2259472_2260201_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001300411.1|2260197_2260851_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|2261080_2263417_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001551710.1|2263512_2264442_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 159
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2271191	2275924	5151952		Salmonella_phage(50.0%)	5	NA	NA
WP_000445130.1|2271191_2272304_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	89.2	1.2e-73
WP_000979887.1|2272363_2272828_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_001551712.1|2272824_2273700_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|2273696_2274386_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_001551713.1|2274433_2275924_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 160
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2279629	2280127	5151952	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366126.1|2279629_2280127_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 161
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2284093	2286618	5151952	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|2284093_2285461_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|2285550_2286618_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 162
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2303113	2304157	5151952		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2303113_2304157_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 163
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2314721	2315606	5151952		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258949.1|2314721_2315606_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	9.2e-24
>prophage 164
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2322110	2326264	5151952		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738583.1|2322110_2323136_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	40.1	8.1e-72
WP_000019662.1|2323203_2324385_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001308990.1|2324394_2325498_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078348.1|2325505_2326264_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	6.9e-20
>prophage 165
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2336763	2338235	5151952	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114986.1|2336763_2337273_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.1e-18
WP_000004443.1|2337287_2338235_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.1	1.4e-06
>prophage 166
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2358112	2363686	5151952		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_000031783.1|2358112_2359297_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|2359367_2361482_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|2361578_2362049_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|2362145_2362520_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903375.1|2362645_2362933_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820713.1|2362940_2363300_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209685.1|2363299_2363686_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	3.3e-18
>prophage 167
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2369257	2378803	5151952		Tupanvirus(25.0%)	9	NA	NA
WP_001551739.1|2369257_2371177_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	3.3e-74
WP_001551740.1|2371176_2372199_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|2372192_2372411_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|2372464_2373334_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|2373388_2373793_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|2374094_2374727_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|2374777_2376868_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_001551741.1|2376930_2378154_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001551743.1|2378239_2378803_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	2.7e-61
>prophage 168
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2397709	2398546	5151952		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|2397709_2398546_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 169
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2415523	2420035	5151952		Bacillus_phage(66.67%)	5	NA	NA
WP_001551762.1|2415523_2417146_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	1.2e-141
WP_000493756.1|2417262_2417580_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000650973.1|2417638_2417935_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001253707.1|2417966_2419319_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	4.7e-11
WP_001157751.1|2419315_2420035_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 170
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2426600	2427494	5151952		Sodalis_phage(100.0%)	1	NA	NA
WP_000039100.1|2426600_2427494_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.5e-69
>prophage 171
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2433654	2436048	5151952		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_001551766.1|2433654_2436048_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 172
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2440438	2441665	5151952		Ralstonia_phage(100.0%)	1	NA	NA
WP_001551770.1|2440438_2441665_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	3.4e-133
>prophage 173
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2450572	2453020	5151952		Dickeya_phage(100.0%)	1	NA	NA
WP_000993450.1|2450572_2453020_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 174
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2463349	2465446	5151952		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_001551777.1|2463349_2465446_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	33.8	1.0e-41
>prophage 175
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2476458	2478269	5151952		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073563.1|2476458_2477202_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	2.2e-10
WP_000907822.1|2477198_2478269_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 176
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2482716	2484199	5151952		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416901.1|2482716_2483430_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	7.0e-14
WP_000082101.1|2483431_2484199_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 177
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2489933	2492752	5151952		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|2489933_2490788_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|2491032_2492091_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|2492083_2492752_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 178
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2495758	2499891	5151952		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|2495758_2496385_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_001551784.1|2496458_2498657_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.5	8.5e-119
WP_000130615.1|2498758_2499004_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|2499225_2499891_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 179
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2507784	2513399	5151952		Bacillus_virus(50.0%)	3	NA	NA
WP_001521512.1|2507784_2508591_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	5.9e-17
WP_001190062.1|2508595_2508997_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_163510431.1|2509199_2513399_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.8	2.0e-23
>prophage 180
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2520834	2523570	5151952		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001551789.1|2520834_2523570_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 181
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2536980	2539023	5151952		Indivirus(100.0%)	1	NA	NA
WP_001298719.1|2536980_2539023_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 182
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2542371	2544507	5151952		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_001551793.1|2542371_2542725_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	7.4e-25
WP_001551794.1|2542779_2544069_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	6.6e-172
WP_000065800.1|2544081_2544507_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	2.5e-51
>prophage 183
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2557574	2559044	5151952		Pithovirus(50.0%)	2	NA	NA
WP_001521540.1|2557574_2558345_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	2.3e-18
WP_032284189.1|2558396_2559044_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	39.7	3.0e-16
>prophage 184
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2605942	2607927	5151952		Bacillus_virus(50.0%)	2	NA	NA
WP_000103574.1|2605942_2606947_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196487.1|2606943_2607927_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 185
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2618036	2620370	5151952		Escherichia_phage(100.0%)	1	NA	NA
WP_001551816.1|2618036_2620370_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	1.2e-70
>prophage 186
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2624024	2626048	5151952	transposase	Morganella_phage(50.0%)	3	NA	NA
WP_000014594.1|2624024_2624237_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_019842825.1|2624424_2624577_-	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_085948682.1|2624678_2626048_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	4.8e-112
>prophage 187
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2629913	2630909	5151952		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001551822.1|2629913_2630909_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	28.1	9.1e-12
>prophage 188
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2636226	2637768	5151952		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146509.1|2636226_2637768_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 189
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2659238	2659851	5151952		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000499744.1|2659238_2659649_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	39.0	6.4e-20
WP_000833473.1|2659665_2659851_-	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	54.2	4.4e-13
>prophage 190
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2663199	2671509	5151952	tRNA	Tupanvirus(50.0%)	4	NA	NA
WP_001551838.1|2663199_2665044_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
WP_000206248.1|2665040_2666432_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|2666529_2667138_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_127904476.1|2667366_2671509_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	45.0	7.4e-23
>prophage 191
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2693798	2703305	5151952		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|2693798_2694050_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156174.1|2694191_2694623_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|2694867_2696412_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214156.1|2696421_2697705_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_001551846.1|2697708_2698668_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982075.1|2698654_2699689_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	1.3e-08
WP_000646014.1|2699927_2700953_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|2700962_2702159_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000587750.1|2702372_2703305_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 192
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2706659	2708493	5151952		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_001052917.1|2706659_2707433_-	glycosyltransferase family 25 protein	NA	A0A0P0YNC5	Yellowstone_lake_phycodnavirus	33.7	7.6e-06
WP_000364807.1|2707464_2708493_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.5	1.6e-11
>prophage 193
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2715931	2731328	5151952	transposase	uncultured_Mediterranean_phage(11.11%)	18	NA	NA
WP_001171866.1|2715931_2716411_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114542.1|2716449_2717259_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.2	5.9e-25
WP_001051798.1|2717356_2717524_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|2717544_2717781_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|2717997_2718666_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050171.1|2718837_2720058_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	5.0e-44
WP_000976070.1|2720035_2720494_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
WP_000818601.1|2720600_2721197_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_000806177.1|2721233_2721875_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001550720.1|2722017_2722476_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	2.9e-13
WP_001247093.1|2722651_2723368_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_000621336.1|2723494_2724358_+	YicC family protein	NA	NA	NA	NA	NA
WP_001551850.1|2724578_2725403_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	79.0	1.2e-97
WP_000924289.1|2725693_2726311_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001445719.1|2726307_2727990_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	2.5e-22
WP_001295237.1|2728247_2728871_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|2728925_2729201_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|2729219_2731328_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 194
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2735629	2737021	5151952		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|2735629_2737021_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 195
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2775750	2777085	5151952		Moraxella_phage(100.0%)	1	NA	NA
WP_001551896.1|2775750_2777085_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	3.0e-66
>prophage 196
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2787889	2796910	5151952		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_001551901.1|2787889_2789578_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	9.3e-57
WP_001300753.1|2789683_2789782_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|2790346_2790436_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001306726.1|2790715_2791900_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	6.8e-14
WP_001551902.1|2791907_2792405_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|2792401_2792764_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703955.1|2792753_2793101_-	YidH family protein	NA	NA	NA	NA	NA
WP_001551904.1|2793208_2793658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551905.1|2793704_2795198_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	28.6	6.6e-30
WP_001551906.1|2795194_2796910_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	3.3e-41
>prophage 197
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2803770	2804724	5151952		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|2803770_2804199_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|2804310_2804724_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 198
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2809151	2810300	5151952		Oenococcus_phage(100.0%)	1	NA	NA
WP_001551912.1|2809151_2810300_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	2.7e-52
>prophage 199
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2815004	2822373	5151952		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|2815004_2817419_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|2817447_2818521_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|2818520_2819621_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|2819625_2821029_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122134670.1|2821325_2821406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|2821635_2821776_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|2821792_2822152_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|2822115_2822373_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 200
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2835047	2836385	5151952		Moraxella_phage(100.0%)	1	NA	NA
WP_001316740.1|2835047_2836385_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 201
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2845391	2852863	5151952		Bacillus_phage(50.0%)	7	NA	NA
WP_000063125.1|2845391_2846165_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|2846255_2847146_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|2847145_2848105_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867161.1|2848191_2849232_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_163510445.1|2850034_2850274_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_000777554.1|2851770_2852244_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000704156.1|2852338_2852863_+	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
>prophage 202
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2863617	2866979	5151952		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334086.1|2863617_2865447_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_001551936.1|2865608_2866979_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	2.4e-34
>prophage 203
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2878933	2879926	5151952		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845104.1|2878933_2879926_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 204
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2883094	2888947	5151952		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|2883094_2884963_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_000715936.1|2885129_2885549_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_001551940.1|2885556_2887062_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.6e-15
WP_000211858.1|2887066_2888032_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|2888056_2888947_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 205
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2902341	2903988	5151952		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001551957.1|2902341_2903988_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	2.2e-66
>prophage 206
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2912316	2917730	5151952		Bacillus_phage(33.33%)	4	NA	NA
WP_001238886.1|2912316_2914338_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
WP_001366744.1|2914384_2915869_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|2916004_2917270_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|2917400_2917730_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 207
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2921760	2927904	5151952		Enterobacteria_phage(40.0%)	6	NA	NA
WP_001551962.1|2921760_2922891_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.4	1.5e-26
WP_001551963.1|2922887_2924150_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.2	9.2e-25
WP_001551965.1|2924149_2925217_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	5.1e-101
WP_000676062.1|2925235_2926117_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.0	2.5e-106
WP_001145185.1|2926094_2926769_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_001551966.1|2926773_2927904_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 208
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2935922	2937578	5151952		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395844.1|2935922_2937578_-	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 209
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2947885	2951744	5151952		Bacillus_phage(100.0%)	3	NA	NA
WP_001551974.1|2947885_2948782_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	5.0e-25
WP_001213584.1|2948781_2949498_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383407.1|2949581_2951744_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 210
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2959120	2960950	5151952		Catovirus(100.0%)	1	NA	NA
WP_024186454.1|2959120_2960950_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 211
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2975589	2978876	5151952		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187543.1|2975589_2977230_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
WP_001295260.1|2977308_2977578_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|2977581_2978097_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|2978099_2978876_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 212
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	2987665	2988280	5151952		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|2987665_2988280_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 213
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3001959	3004746	5151952		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|3001959_3004746_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 214
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3008824	3011295	5151952		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|3008824_3010234_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|3010245_3011295_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 215
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3028290	3031070	5151952		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718901.1|3028290_3029187_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_001521800.1|3029354_3030251_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|3030284_3031070_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 216
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3042579	3045630	5151952		Escherichia_phage(100.0%)	1	NA	NA
WP_077626238.1|3042579_3045630_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 217
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3061388	3066399	5151952		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001297064.1|3061388_3062009_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166043.1|3062268_3063252_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270252.1|3063400_3064075_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|3064330_3065704_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|3065700_3066399_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 218
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3077973	3082476	5151952		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|3077973_3078819_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3079243_3079489_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|3079573_3080059_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|3080151_3081078_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|3081144_3082476_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 219
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3088113	3092343	5151952		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_163510448.1|3088113_3092343_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	45.0	6.4e-22
>prophage 220
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3112288	3119535	5151952		Synechococcus_phage(33.33%)	5	NA	NA
WP_001550384.1|3112288_3112951_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	2.7e-28
WP_001185146.1|3112962_3115464_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004446.1|3115772_3116852_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|3116866_3117187_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001550385.1|3117237_3119535_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 221
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3134300	3135818	5151952		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_163510449.1|3134300_3135818_+	sugar ABC transporter ATP-binding protein	NA	A7IVC2	Paramecium_bursaria_Chlorella_virus	22.8	1.0e-06
>prophage 222
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3140709	3141924	5151952		Oenococcus_phage(100.0%)	1	NA	NA
WP_001550400.1|3140709_3141924_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	5.9e-45
>prophage 223
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3148676	3150521	5151952		Acinetobacter_phage(100.0%)	1	NA	NA
WP_001366808.1|3148676_3150521_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 224
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3158863	3161916	5151952		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023085.1|3158863_3159814_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	1.1e-27
WP_000031784.1|3160731_3161916_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 225
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3166032	3174361	5151952		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|3166032_3170061_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|3170137_3174361_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 226
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3183578	3185342	5151952		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|3183578_3184250_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000941119.1|3184292_3184883_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|3185069_3185342_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 227
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3190731	3192321	5151952		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_163510451.1|3190731_3192321_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 228
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3208246	3211930	5151952		Dickeya_phage(100.0%)	1	NA	NA
WP_000096053.1|3208246_3211930_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 229
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3235360	3236476	5151952		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|3235360_3236476_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 230
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3245600	3246209	5151952		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3245600_3246209_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 231
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3252776	3255324	5151952		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|3252776_3254192_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001550427.1|3254244_3255324_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	6.8e-29
>prophage 232
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3259530	3263144	5151952		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|3259530_3262353_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|3262607_3263144_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 233
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3266961	3268311	5151952		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|3266961_3268311_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 234
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3273921	3275880	5151952		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001550433.1|3273921_3275880_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.7	8.7e-91
>prophage 235
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3285164	3287312	5151952		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|3285164_3287312_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 236
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3292557	3294543	5151952		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001522248.1|3292557_3294543_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	45.2	4.6e-148
>prophage 237
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3298477	3300027	5151952		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_001564234.1|3298477_3299158_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.1	7.1e-08
WP_001075519.1|3299268_3300027_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	4.7e-16
>prophage 238
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3305586	3306375	5151952		Pithovirus(100.0%)	1	NA	NA
WP_001193403.1|3305586_3306375_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	3.2e-12
>prophage 239
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3311214	3312717	5151952		Burkholderia_virus(100.0%)	1	NA	NA
WP_001305708.1|3311214_3312717_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	7.0e-56
>prophage 240
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3333925	3337137	5151952	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001550472.1|3333925_3335443_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.2	2.0e-87
WP_001550473.1|3335679_3337137_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	1.2e-47
>prophage 241
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3351413	3353397	5151952		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|3351413_3351707_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3351750_3353397_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 242
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3357600	3358134	5151952		Morganella_phage(100.0%)	1	NA	NA
WP_001550477.1|3357600_3358134_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 243
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3363053	3364031	5151952		Tupanvirus(100.0%)	1	NA	NA
WP_001550479.1|3363053_3364031_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	4.0e-28
>prophage 244
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3371459	3372005	5151952		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001358360.1|3371459_3372005_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	1.7e-28
>prophage 245
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3375920	3388951	5151952	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
WP_024215836.1|3375920_3377258_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.5	2.0e-17
WP_001350387.1|3377267_3379115_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|3379107_3380058_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3380143_3380452_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|3380527_3381808_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|3381893_3383153_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3383155_3384160_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3384241_3384439_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_163510461.1|3384542_3385841_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	9.9e-67
WP_001177639.1|3386045_3386471_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076332.1|3386509_3388951_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
>prophage 246
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3398005	3399169	5151952		Ralstonia_phage(100.0%)	1	NA	NA
WP_000944017.1|3398005_3399169_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	4.1e-80
>prophage 247
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3433567	3434098	5151952		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000055075.1|3433567_3434098_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
>prophage 248
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3439056	3506471	5151952	tRNA,protease,transposase,integrase	Enterobacteria_phage(22.22%)	57	3454161:3454175	3486965:3486979
WP_000853755.1|3439056_3440055_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.4	9.6e-70
WP_001219817.1|3440230_3441604_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166271.1|3441759_3442311_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162162.1|3442404_3443757_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232240.1|3443812_3444199_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106222.1|3444243_3444708_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	1.1e-52
WP_163510463.1|3444865_3447004_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.4	4.5e-266
WP_001311336.1|3447397_3449053_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001299664.1|3449102_3450524_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181328.1|3450642_3451590_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
WP_001387276.1|3451774_3451828_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471847.1|3451968_3454665_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
3454161:3454175	attL	TATTCAGAACCTGCT	NA	NA	NA	NA
WP_000399648.1|3454892_3455873_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000047539.1|3456149_3456536_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3456608_3457070_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|3457082_3458018_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|3458021_3458156_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230273.1|3458436_3458832_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500696.1|3458962_3459676_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256667.1|3459746_3460340_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000583470.1|3460484_3460937_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_001074114.1|3461059_3462571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012903.1|3462783_3463788_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|3463949_3464366_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059402.1|3464411_3464915_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000079651.1|3465107_3466304_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416392.1|3466359_3469215_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_000786399.1|3469214_3469658_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3469817_3471329_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584117.1|3471595_3472696_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|3472695_3473778_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_163510464.1|3473938_3475441_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_014639402.1|3475570_3476590_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	2.4e-44
WP_001218936.1|3477069_3478323_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.9	3.0e-84
WP_001273407.1|3478591_3480976_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000354454.1|3480978_3482823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000136568.1|3482971_3483811_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0F7L647	uncultured_marine_virus	34.7	2.7e-25
WP_000160682.1|3483803_3487136_-	hypothetical protein	NA	NA	NA	NA	NA
3486965:3486979	attR	TATTCAGAACCTGCT	NA	NA	NA	NA
WP_000929962.1|3487128_3488019_-	DUF4007 family protein	NA	NA	NA	NA	NA
WP_000416151.1|3488849_3489881_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	1.4e-18
WP_000916805.1|3490151_3490595_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705930.1|3490610_3490898_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345350.1|3490910_3492167_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001327567.1|3492413_3492668_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
WP_000107474.1|3493088_3494102_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_115189095.1|3494113_3495430_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|3495457_3496378_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|3496683_3497466_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001387298.1|3497467_3497566_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_001422798.1|3498668_3498797_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000251885.1|3498977_3499352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001424065.1|3499523_3500546_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	7.8e-200
WP_001323403.1|3500545_3501325_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000145479.1|3501375_3501594_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001409274.1|3501747_3503118_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293435.1|3503180_3505178_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_163510466.1|3505331_3506471_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	6.0e-68
>prophage 249
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3512124	3516822	5151952		Pseudomonas_phage(33.33%)	4	NA	NA
WP_001189111.1|3512124_3513633_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000177059.1|3514283_3514541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|3515097_3515865_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_138809988.1|3515865_3516822_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	8.2e-18
>prophage 250
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3526982	3589359	5151952	transposase	Escherichia_phage(27.78%)	60	NA	NA
WP_000998098.1|3526982_3528368_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	2.2e-258
WP_000612632.1|3528417_3528765_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
WP_001171523.1|3528761_3529142_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001221615.1|3529496_3529931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000270978.1|3529918_3530320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163510470.1|3530579_3531149_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001344112.1|3531893_3532070_-	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000840364.1|3532370_3532637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001329787.1|3532705_3532984_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000813456.1|3533078_3533681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329788.1|3533852_3534050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000250228.1|3534883_3535801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001360328.1|3535885_3536758_+	GTPase family protein	NA	NA	NA	NA	NA
WP_163510472.1|3537130_3539977_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001323397.1|3540047_3540206_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234652.1|3540360_3541179_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	1.6e-46
WP_163510474.1|3541520_3541994_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_001186768.1|3542009_3542486_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692286.1|3542554_3542776_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	7.2e-10
WP_001360327.1|3542938_3543307_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_001514886.1|3543396_3543771_+	toxin YeeV	NA	NA	NA	NA	NA
WP_155105063.1|3543910_3545139_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	5.4e-171
WP_000466620.1|3545202_3545595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839290.1|3545611_3545788_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001467148.1|3545887_3546046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001395333.1|3546697_3549589_+	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	53.8	2.3e-289
WP_000049830.1|3549609_3552714_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	27.3	5.5e-23
WP_001085526.1|3552716_3556097_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_000421876.1|3556143_3556446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001327357.1|3557276_3557399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991431.1|3557406_3558387_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	56.3	1.6e-101
WP_001301174.1|3558451_3559558_-	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_163510476.1|3559577_3560294_-	N-acetylneuraminic acid outer membrane channel NanC	NA	NA	NA	NA	NA
WP_000558251.1|3562595_3563939_-	gluconate permease GntP	NA	NA	NA	NA	NA
WP_000438582.1|3564278_3565463_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_000208180.1|3565543_3567004_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
WP_000833684.1|3567218_3567992_+	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_001298053.1|3568405_3568789_+	anti-adapter protein IraD	NA	NA	NA	NA	NA
WP_001677288.1|3569214_3570126_-	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_001534825.1|3570190_3571363_-	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000211971.1|3571375_3571837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001298014.1|3571833_3572517_-	YjiH family protein	NA	NA	NA	NA	NA
WP_001151839.1|3572766_3573321_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	4.6e-37
WP_163510478.1|3573333_3574512_-	MFS transporter	NA	NA	NA	NA	NA
WP_001300028.1|3574579_3575440_-	YjiK family protein	NA	NA	NA	NA	NA
WP_000666413.1|3575504_3575762_-	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_001297641.1|3575758_3576526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551998.1|3576535_3577687_-	2-hydroxyacyl-CoA dehydratase subunit D	NA	NA	NA	NA	NA
WP_001067855.1|3577755_3578460_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|3578603_3579158_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|3579288_3580119_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|3580750_3581455_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557452.1|3581561_3582422_+	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_002063889.1|3582434_3582977_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067855.1|3584170_3584875_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|3585366_3586227_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001550555.1|3586321_3586612_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	41.8	5.2e-08
WP_001039466.1|3586706_3587891_-	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
WP_000113282.1|3587986_3588643_+	tetracycline resistance transcriptional repressor TetR(D)	NA	NA	NA	NA	NA
WP_001067855.1|3588654_3589359_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 251
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3600062	3603552	5151952		Hepacivirus(50.0%)	2	NA	NA
WP_001082319.1|3600062_3600866_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001550561.1|3601932_3603552_-	type I restriction-modification system subunit M	NA	A0A2H4UVW8	Bodo_saltans_virus	22.4	8.5e-07
>prophage 252
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3609234	3614599	5151952		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919568.1|3609234_3610899_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_001534847.1|3610947_3612309_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091572.1|3612523_3613438_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106043.1|3613576_3614599_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 253
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3617824	3619104	5151952		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|3617824_3618562_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_001535806.1|3618564_3619104_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	3.8e-28
>prophage 254
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3626933	3629809	5151952		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175940.1|3626933_3628523_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|3628915_3629521_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3629647_3629809_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 255
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3635313	3636636	5151952		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477829.1|3635313_3636636_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	5.2e-79
>prophage 256
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3643356	3644589	5151952		Enterococcus_phage(100.0%)	1	NA	NA
WP_000093813.1|3643356_3644589_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
>prophage 257
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3648863	3652679	5151952		Klosneuvirus(50.0%)	2	NA	NA
WP_000046743.1|3648863_3650531_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.2	8.3e-42
WP_000409451.1|3650741_3652679_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 258
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3655865	3657979	5151952		Bacillus_phage(50.0%)	2	NA	NA
WP_001188679.1|3655865_3656555_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219577.1|3656554_3657979_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	1.2e-09
>prophage 259
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3669634	3678702	5151952		Cyanophage(20.0%)	9	NA	NA
WP_000130187.1|3669634_3670588_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001094685.1|3670702_3671290_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|3671324_3671891_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102367.1|3672039_3672753_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843562.1|3672778_3673183_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|3673558_3675475_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|3675563_3676694_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000935262.1|3676797_3677007_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001550578.1|3677535_3678702_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
>prophage 260
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3688189	3691006	5151952	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286869.1|3688189_3691006_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	4.6e-77
>prophage 261
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3695412	3696561	5151952		Halovirus(100.0%)	1	NA	NA
WP_001445800.1|3695412_3696561_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 262
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3702061	3707722	5151952		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001309938.1|3702061_3703615_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	1.2e-34
WP_000349954.1|3703688_3704906_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347137.1|3705034_3706177_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787109.1|3706207_3707722_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 263
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3715616	3717564	5151952		Bacillus_phage(50.0%)	3	NA	NA
WP_000624375.1|3715616_3716096_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000125566.1|3716181_3716415_+	antitoxin	NA	NA	NA	NA	NA
WP_000257196.1|3716715_3717564_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 264
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3726637	3732059	5151952		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001550591.1|3726637_3729544_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_001550592.1|3729707_3732059_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	26.0	4.5e-33
>prophage 265
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3738391	3739090	5151952		Planktothrix_phage(100.0%)	1	NA	NA
WP_001550594.1|3738391_3739090_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.8	2.1e-23
>prophage 266
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3742406	3743776	5151952	transposase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_163510480.1|3742406_3743776_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	4.8e-112
>prophage 267
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3753027	3754752	5151952		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001550599.1|3753027_3754752_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 268
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3780722	3781766	5151952		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217337.1|3780722_3781766_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 269
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3786012	3786564	5151952		Sphingobium_phage(100.0%)	1	NA	NA
WP_001550610.1|3786012_3786564_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.4	1.1e-11
>prophage 270
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3795191	3796616	5151952		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|3795191_3796616_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 271
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3804383	3810851	5151952		Mamastrovirus(33.33%)	5	NA	NA
WP_001550615.1|3804383_3805934_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	4.6e-18
WP_001306211.1|3805980_3808371_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|3808576_3809113_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|3809153_3809816_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|3809924_3810851_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 272
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3814113	3815058	5151952	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000339900.1|3814113_3815058_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	1.3e-60
>prophage 273
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3824544	3831350	5151952	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_163510482.1|3824544_3825963_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_001550621.1|3826001_3826928_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|3826964_3827420_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396050.1|3827597_3828302_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294687.1|3828316_3828847_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001550622.1|3828920_3831350_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.9	1.1e-39
>prophage 274
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3836437	3837235	5151952		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|3836437_3837235_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 275
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3843146	3843491	5151952		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|3843146_3843491_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 276
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3847420	3848845	5151952	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|3847420_3848845_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 277
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3860692	3935322	5151952	transposase,protease,tRNA,plate	Flavobacterium_phage(10.0%)	60	NA	NA
WP_001295562.1|3860692_3861451_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_019842250.1|3861463_3862321_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001520521.1|3862332_3863685_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|3863714_3866147_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|3866268_3866754_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139287.1|3866757_3867783_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3867887_3868343_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|3868346_3869135_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_001550626.1|3869134_3870283_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_001550627.1|3870279_3870876_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	7.9e-27
WP_001294781.1|3870912_3874395_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	2.2e-209
WP_000055748.1|3874407_3875367_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|3875464_3877606_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|3877662_3878052_+	VOC family protein	NA	NA	NA	NA	NA
WP_001550628.1|3878116_3879415_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062311.1|3879463_3879724_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|3879710_3879911_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185287.1|3880076_3880622_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635534.1|3880618_3881041_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239188.1|3881054_3881765_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001550629.1|3881795_3882620_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260708.1|3882672_3884391_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094022.1|3884501_3885209_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|3885205_3885610_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|3885727_3886543_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|3886582_3887236_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|3887228_3888260_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140178.1|3888446_3889019_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997053.1|3894770_3895574_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	5.4e-39
WP_000648583.1|3895570_3896485_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3896725_3897526_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001550637.1|3897603_3898374_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|3898420_3899779_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052732.1|3899850_3900606_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001308373.1|3900639_3901362_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3901358_3901826_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308374.1|3901890_3902622_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_001086163.1|3903160_3903946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236629.1|3904094_3904562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908071.1|3904571_3905486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002621.1|3905529_3906012_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001563736.1|3906035_3907388_-	type VI secretion system protein VasL	NA	NA	NA	NA	NA
WP_122989438.1|3907398_3910833_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240537.1|3910941_3912354_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001550641.1|3912358_3913102_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_096790905.1|3913098_3915906_-	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	30.3	2.0e-80
WP_001521863.1|3915914_3916676_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246418.1|3916680_3918012_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|3918014_3918539_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001550643.1|3918535_3919816_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348804.1|3919840_3920923_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001521865.1|3920886_3922737_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001521866.1|3922740_3923154_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_001550644.1|3923160_3924636_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_001521869.1|3924686_3924911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001550646.1|3924945_3925446_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|3926142_3926661_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001550647.1|3926870_3929012_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.8e-25
WP_001077735.1|3933587_3933965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024192499.1|3934185_3935322_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 278
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3939870	3943082	5151952		Caulobacter_phage(50.0%)	4	NA	NA
WP_000284050.1|3939870_3940449_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|3940553_3941321_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|3941291_3942032_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001550651.1|3942323_3943082_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
>prophage 279
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3953540	3957252	5151952		Streptococcus_phage(66.67%)	3	NA	NA
WP_000749881.1|3953540_3954596_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|3954883_3955987_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_163510486.1|3955998_3957252_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	3.4e-96
>prophage 280
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3968888	3971087	5151952		Acinetobacter_phage(100.0%)	1	NA	NA
WP_001550666.1|3968888_3971087_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	7.4e-38
>prophage 281
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3989308	3990160	5151952		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001550672.1|3989308_3990160_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.3	2.6e-47
>prophage 282
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	3996204	3999509	5151952		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001309281.1|3996204_3997074_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	1.2e-52
WP_001306921.1|3997233_3997827_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474077.1|3997838_3998075_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001543522.1|3998183_3999509_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
>prophage 283
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4005084	4011004	5151952	holin	Catovirus(50.0%)	4	NA	NA
WP_001550677.1|4005084_4006755_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	4.0e-60
WP_001550678.1|4006768_4008241_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001376735.1|4008254_4008842_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131040.1|4008970_4011004_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 284
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4023685	4028223	5151952		Bacillus_virus(50.0%)	4	NA	NA
WP_001550685.1|4023685_4025170_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	1.0e-11
WP_000818889.1|4025162_4026134_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001550686.1|4026130_4027087_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001550687.1|4027173_4028223_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	2.2e-72
>prophage 285
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4036603	4042198	5151952		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000010270.1|4036603_4038490_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	3.1e-53
WP_000076225.1|4038726_4039986_+	cytosine permease	NA	NA	NA	NA	NA
WP_001550690.1|4039975_4041259_+	cytosine/isoguanine deaminase	NA	NA	NA	NA	NA
WP_001550692.1|4041298_4042198_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 286
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4046724	4051004	5151952		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_001550695.1|4046724_4049799_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.0	0.0e+00
WP_019842507.1|4049921_4051004_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.7	2.2e-192
>prophage 287
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4056414	4058375	5151952		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_001550700.1|4056414_4057365_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001550701.1|4057361_4058375_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	30.8	7.1e-44
>prophage 288
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4061454	4062564	5151952		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|4061454_4062564_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 289
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4067856	4068624	5151952		Planktothrix_phage(100.0%)	1	NA	NA
WP_001550706.1|4067856_4068624_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	1.2e-24
>prophage 290
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4075493	4076651	5151952		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001550711.1|4075493_4076651_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 291
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4084064	4085180	5151952		Bacillus_phage(100.0%)	1	NA	NA
WP_000484041.1|4084064_4085180_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 292
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4089466	4101817	5151952	transposase	Bacillus_phage(50.0%)	9	NA	NA
WP_001366457.1|4089466_4090378_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001550716.1|4090502_4091411_+	fructokinase	NA	NA	NA	NA	NA
WP_001304835.1|4091553_4092738_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001550718.1|4092863_4096007_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001550719.1|4096003_4097206_-	exonuclease subunit SbcD	NA	L0LAJ8	Bacillus_phage	25.1	9.1e-06
WP_000113933.1|4097395_4098085_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893603.1|4098142_4099438_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
WP_000149639.1|4099844_4101164_+	branched-chain amino acid transporter carrier protein BrnQ	NA	NA	NA	NA	NA
WP_001550720.1|4101358_4101817_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	2.9e-13
>prophage 293
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4108889	4119617	5151952	tRNA,transposase	uncultured_Mediterranean_phage(50.0%)	10	NA	NA
WP_000667319.1|4108889_4110017_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|4110039_4110372_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|4110399_4112247_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|4112257_4113229_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|4113357_4113705_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|4113881_4114766_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_024189688.1|4115969_4117178_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	1.7e-209
WP_000543535.1|4117501_4117951_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150479.1|4117954_4119058_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	2.2e-54
WP_001021161.1|4119146_4119617_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 294
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4142974	4148021	5151952	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|4142974_4143598_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|4143723_4144998_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|4145185_4147540_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|4147748_4148021_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 295
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4151161	4159438	5151952	transposase	Bacillus_phage(50.0%)	7	NA	NA
WP_000817229.1|4151161_4151857_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
WP_001238217.1|4151921_4153622_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001309304.1|4153721_4154540_+	HMP-PP phosphatase	NA	NA	NA	NA	NA
WP_163510491.1|4154723_4155182_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	5.9e-14
WP_000884589.1|4155403_4155862_+	DNA-binding transcriptional regulator DecR	NA	NA	NA	NA	NA
WP_001550738.1|4155891_4157664_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.0e-49
WP_001550739.1|4157656_4159438_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.8e-42
>prophage 296
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4168274	4171424	5151952		Leptospira_phage(100.0%)	1	NA	NA
WP_001132480.1|4168274_4171424_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 297
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4178262	4186720	5151952		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|4178262_4178814_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122013.1|4178942_4180874_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|4180926_4181256_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|4181255_4181861_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|4181970_4183845_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|4184025_4184670_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250117.1|4184801_4185764_+	ferrochelatase	NA	NA	NA	NA	NA
WP_163510493.1|4185760_4186720_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	25.7	7.2e-14
>prophage 298
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4195252	4197757	5151952		uncultured_virus(100.0%)	1	NA	NA
WP_001550745.1|4195252_4197757_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.6	7.7e-116
>prophage 299
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4221025	4223188	5151952		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_001550749.1|4221025_4223188_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.9	1.9e-17
>prophage 300
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4228891	4229569	5151952		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|4228891_4229569_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 301
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4232705	4233392	5151952		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|4232705_4233392_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 302
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4240299	4242081	5151952		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001305518.1|4240299_4242081_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.1	2.1e-38
>prophage 303
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4248272	4249418	5151952		Streptococcus_phage(100.0%)	1	NA	NA
WP_001550755.1|4248272_4249418_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	4.1e-48
>prophage 304
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4260839	4263970	5151952	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_000912345.1|4260839_4262225_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001522081.1|4262260_4262782_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190286.1|4262889_4263102_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|4263103_4263970_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
>prophage 305
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4283523	4293624	5151952		uncultured_Caudovirales_phage(25.0%)	5	NA	NA
WP_061089646.1|4283523_4288356_-	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	39.4	5.4e-17
WP_001160804.1|4288375_4288837_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_001550773.1|4288864_4290766_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.1	1.0e-27
WP_000253856.1|4291502_4292951_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.5	1.7e-11
WP_000770953.1|4292940_4293624_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 306
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4296769	4299913	5151952		Leptospira_phage(100.0%)	1	NA	NA
WP_001550776.1|4296769_4299913_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
>prophage 307
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4310853	4316896	5151952		Tupanvirus(50.0%)	3	NA	NA
WP_163510497.1|4310853_4314735_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.7	4.4e-62
WP_001550786.1|4314950_4316084_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140646.1|4316080_4316896_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 308
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4331202	4333025	5151952		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502941.1|4331202_4331832_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029782.1|4331804_4333025_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	6.1e-58
>prophage 309
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4336133	4338248	5151952		Bacillus_virus(50.0%)	2	NA	NA
WP_001366511.1|4336133_4337699_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.9e-44
WP_001308472.1|4337819_4338248_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	3.3e-19
>prophage 310
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4352337	4352984	5151952		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|4352337_4352547_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|4352600_4352984_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 311
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4357803	4360243	5151952		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|4357803_4359015_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231416.1|4359154_4360243_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 312
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4367253	4372376	5151952	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
WP_001157896.1|4367253_4369836_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	1.2e-183
WP_001044880.1|4370070_4370553_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_001207528.1|4370597_4371533_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|4371650_4372376_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 313
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4378259	4379339	5151952		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|4378259_4379339_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 314
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4383435	4385100	5151952		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_000337082.1|4383435_4385100_-	asparagine synthase B	NA	E5EQ62	Micromonas_sp._RCC1109_virus	38.5	1.4e-84
>prophage 315
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4389726	4393540	5151952	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023126.1|4389726_4391673_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
WP_001287134.1|4391875_4393540_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
>prophage 316
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4397693	4398458	5151952		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001550797.1|4397693_4398458_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	32.4	5.8e-06
>prophage 317
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4405114	4423456	5151952		Hokovirus(28.57%)	13	NA	NA
WP_001550800.1|4405114_4405792_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.1	2.6e-26
WP_001328700.1|4405788_4408473_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	2.5e-11
WP_001550801.1|4408465_4409038_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001550802.1|4409046_4411095_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.7	7.1e-27
WP_001550803.1|4411117_4412791_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|4412790_4412880_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424926.1|4413192_4413399_+	YbfA family protein	NA	NA	NA	NA	NA
WP_106106660.1|4413646_4417798_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.6	1.1e-23
WP_000720081.1|4417794_4418298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136512020.1|4418415_4418991_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	37.5	6.9e-20
WP_001522578.1|4420007_4420517_+	YbgA family protein	NA	NA	NA	NA	NA
WP_001550810.1|4420513_4421932_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	5.6e-63
WP_001550812.1|4421974_4423456_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 318
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4426834	4427626	5151952		Kaumoebavirus(100.0%)	1	NA	NA
WP_001550815.1|4426834_4427626_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.5	1.3e-08
>prophage 319
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4471559	4475079	5151952		Vibrio_phage(33.33%)	4	NA	NA
WP_001550829.1|4471559_4472279_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.2	1.4e-22
WP_001550830.1|4472275_4473217_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	1.3e-23
WP_000784342.1|4473330_4473711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001550831.1|4474026_4475079_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 320
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4479441	4486017	5151952		Tupanvirus(33.33%)	7	NA	NA
WP_001265443.1|4479441_4480458_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
WP_001550833.1|4480720_4482193_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	4.2e-13
WP_001147439.1|4482260_4483049_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|4483177_4483327_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001550835.1|4483493_4484267_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604039.1|4484266_4484956_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891692.1|4484958_4486017_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
>prophage 321
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4496208	4497498	5151952		Klosneuvirus(100.0%)	1	NA	NA
WP_001550860.1|4496208_4497498_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.4	5.9e-19
>prophage 322
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4503940	4504849	5151952		Streptococcus_phage(100.0%)	1	NA	NA
WP_163510503.1|4503940_4504849_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.3	7.0e-27
>prophage 323
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4515125	4530063	5151952		Anomala_cuprea_entomopoxvirus(16.67%)	14	NA	NA
WP_001550869.1|4515125_4516862_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_000976400.1|4516854_4517853_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|4517852_4518524_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001550870.1|4518752_4520117_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001522657.1|4520273_4520714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001522659.1|4520713_4520995_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_001550871.1|4521165_4523316_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	6.3e-42
WP_000386515.1|4523343_4524306_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001550872.1|4524446_4525532_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000849301.1|4525671_4525932_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146357.1|4526196_4526463_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000990146.1|4526536_4527214_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_001550873.1|4527255_4529538_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|4529802_4530063_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 324
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4533603	4538828	5151952		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|4533603_4534326_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|4534322_4534982_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|4535120_4535867_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|4536270_4536774_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001550876.1|4537072_4537960_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|4538194_4538260_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|4538312_4538828_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 325
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4543824	4545420	5151952		Tupanvirus(100.0%)	1	NA	NA
WP_000961457.1|4543824_4545420_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	5.3e-62
>prophage 326
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4553021	4557152	5151952		Citrobacter_phage(50.0%)	3	NA	NA
WP_000209345.1|4553021_4555454_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001550881.1|4555459_4556359_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001550882.1|4556489_4557152_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.1	1.3e-25
>prophage 327
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4560378	4562250	5151952		Planktothrix_phage(100.0%)	1	NA	NA
WP_001445743.1|4560378_4562250_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	8.8e-16
>prophage 328
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4574539	4575742	5151952		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|4574539_4575742_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 329
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4584307	4593448	5151952		Vibrio_phage(25.0%)	11	NA	NA
WP_001195231.1|4584307_4584565_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001550889.1|4584724_4585012_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_146883298.1|4584995_4585718_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|4585778_4586681_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|4586768_4587245_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126069.1|4587595_4588708_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_001550891.1|4588802_4589936_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105416.1|4589945_4590890_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|4590886_4591732_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389258.1|4591791_4592280_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149712.1|4592320_4593448_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	7.9e-28
>prophage 330
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4596573	4597302	5151952		Planktothrix_phage(100.0%)	1	NA	NA
WP_000027205.1|4596573_4597302_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 331
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4600982	4601813	5151952		Roseobacter_phage(100.0%)	1	NA	NA
WP_001550894.1|4600982_4601813_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	4.3e-07
>prophage 332
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4605400	4607119	5151952		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815339.1|4605400_4607119_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	3.1e-31
>prophage 333
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4616405	4651641	5151952	integrase,terminase,capsid,protease,head,tRNA	Escherichia_phage(17.65%)	29	4605809:4605823	4629613:4629627
4605809:4605823	attL	GCTAAAACCGCCATC	NA	NA	NA	NA
WP_000188187.1|4616405_4618352_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|4618424_4618649_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_023063565.1|4619053_4620292_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.7	4.0e-126
WP_001302637.1|4620709_4620919_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.1	1.8e-15
WP_001113142.1|4621960_4622281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023063568.1|4622287_4622587_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_023063569.1|4622583_4624401_+	DNA primase phage-associated	NA	Q7M2A8	Enterobacteria_phage	47.9	1.1e-127
WP_024210327.1|4624688_4624934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126638.1|4624930_4625353_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001281836.1|4625626_4626667_+|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.7	6.7e-66
WP_000190775.1|4626676_4627018_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000572593.1|4627027_4627372_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001390169.1|4627439_4627574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023063570.1|4627573_4628116_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	48.1	2.9e-36
WP_000133431.1|4628189_4628471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520781.1|4629550_4629871_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
4629613:4629627	attR	GCTAAAACCGCCATC	NA	NA	NA	NA
WP_163510507.1|4629901_4632178_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.6	1.1e-166
WP_001040187.1|4633756_4633975_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|4634259_4634964_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001550899.1|4635005_4636727_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	3.8e-21
WP_001043596.1|4636727_4638494_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_000537418.1|4638616_4639582_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|4640126_4640621_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_001550902.1|4640755_4644823_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001522754.1|4644981_4645593_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|4645603_4646947_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|4647037_4648330_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850305.1|4648568_4651013_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
WP_000213098.1|4651023_4651641_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 334
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4656479	4659694	5151952		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|4656479_4657220_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292809.1|4657411_4659694_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
>prophage 335
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4663792	4664881	5151952		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057132.1|4663792_4664881_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	2.0e-81
>prophage 336
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4669967	4674508	5151952		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|4669967_4670252_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_001550905.1|4670458_4672723_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|4672759_4674508_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 337
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4689213	4699997	5151952	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|4689213_4689762_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109449.1|4689788_4690436_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|4690486_4691677_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977905.1|4691861_4692935_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	55.1	2.3e-101
WP_000117881.1|4693537_4694938_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001305916.1|4695107_4696310_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001550911.1|4696575_4699188_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.2	1.6e-18
WP_001550912.1|4699229_4699997_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	7.5e-30
>prophage 338
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4717194	4719102	5151952		Tupanvirus(100.0%)	1	NA	NA
WP_000053080.1|4717194_4719102_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 339
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4731712	4733767	5151952		Bacillus_phage(100.0%)	1	NA	NA
WP_001550921.1|4731712_4733767_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
>prophage 340
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4738000	4738660	5151952	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|4738000_4738660_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 341
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4749654	4761969	5151952		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|4749654_4749867_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071528143.1|4749877_4750066_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|4750040_4750271_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|4750260_4750434_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001550932.1|4750482_4751556_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_023909335.1|4751627_4754372_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.8	2.4e-38
WP_001550934.1|4754454_4755483_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120121.1|4755455_4756148_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001550935.1|4756277_4757450_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001550936.1|4757449_4759996_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.0	6.9e-72
WP_001544437.1|4759992_4760592_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|4760743_4761049_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420641.1|4761048_4761969_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
>prophage 342
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4766272	4768372	5151952		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|4766272_4766446_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001365093.1|4766528_4767857_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	2.8e-234
WP_001028095.1|4767877_4768372_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 343
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4783261	4784185	5151952		Cronobacter_phage(100.0%)	1	NA	NA
WP_001304747.1|4783261_4784185_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	3.1e-91
>prophage 344
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4791009	4793858	5151952	integrase	Bacillus_phage(50.0%)	2	4791885:4791899	4795217:4795231
WP_001550941.1|4791009_4792377_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.5	9.6e-20
4791885:4791899	attL	CAGAAATTATTTTTT	NA	NA	NA	NA
WP_000279872.1|4792655_4793858_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_000279872.1|4792655_4793858_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
4795217:4795231	attR	CAGAAATTATTTTTT	NA	NA	NA	NA
>prophage 345
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4816290	4817518	5151952	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_104976704.1|4816290_4817518_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	2.7e-170
>prophage 346
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4824658	4828158	5151952	transposase	Escherichia_phage(50.0%)	4	NA	NA
WP_032262852.1|4824658_4825438_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.3e-138
WP_000179884.1|4825681_4825858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000483766.1|4826213_4827560_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_021513032.1|4827699_4828158_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
>prophage 347
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4841479	4845773	5151952		Mycobacterium_phage(33.33%)	5	NA	NA
WP_001285504.1|4841479_4842712_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.9	5.0e-60
WP_000502842.1|4842696_4843335_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.9e-55
WP_000226519.1|4843413_4843683_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001333354.1|4843703_4844348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422760.1|4845347_4845773_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	1.5e-43
>prophage 348
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4851005	4854078	5151952		Yersinia_phage(25.0%)	6	NA	NA
WP_163510514.1|4851005_4851827_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	5.0e-48
WP_001164966.1|4851826_4852072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542276.1|4852165_4852639_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001186727.1|4852654_4853131_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692315.1|4853193_4853415_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_000086759.1|4853433_4854078_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.7	2.7e-25
>prophage 349
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4859993	4860827	5151952		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|4859993_4860827_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 350
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4864961	4865495	5151952		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857406.1|4864961_4865495_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
>prophage 351
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4874803	4875724	5151952		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|4874803_4875724_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 352
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4880380	4880626	5151952		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|4880380_4880626_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 353
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4896472	4897414	5151952		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001366226.1|4896472_4897414_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 354
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4910587	4911769	5151952		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|4910587_4911322_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|4911532_4911769_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 355
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4915041	4916684	5151952		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257002.1|4915041_4915683_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267924.1|4915679_4916684_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 356
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4928937	4929195	5151952		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|4928937_4929195_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 357
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4936483	4940206	5151952		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033695.1|4936483_4937185_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_019842380.1|4937184_4938429_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001550961.1|4938457_4939369_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|4939384_4940206_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 358
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	4943648	5011527	5151952	holin,portal,integrase,terminase,capsid,tail,head,tRNA,transposase	Escherichia_phage(33.87%)	85	4941948:4941962	4985041:4985055
4941948:4941962	attL	CGGCCACACCACATC	NA	NA	NA	NA
WP_000074983.1|4943648_4944767_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|4944735_4945005_-	excisionase	NA	NA	NA	NA	NA
WP_032284123.1|4945066_4947538_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_000199480.1|4947633_4947822_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001405662.1|4947818_4948007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000935597.1|4948017_4948872_-	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_012601410.1|4949379_4949646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394541.1|4949634_4949973_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_000379587.1|4949984_4950137_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_001003379.1|4950326_4950734_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476988.1|4950811_4951039_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705383.1|4951022_4951574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020541.1|4951545_4952586_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_001309414.1|4952497_4953040_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_001673352.1|4953073_4953844_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.0	2.5e-86
WP_001141099.1|4953859_4954252_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|4954248_4954545_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209475.1|4954541_4955003_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_000403782.1|4954980_4955337_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.4e-58
WP_032234226.1|4955432_4955615_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	1.5e-26
WP_001514294.1|4955607_4955784_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	91.4	2.8e-25
WP_163510520.1|4955780_4956296_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	76.3	7.2e-37
WP_001336454.1|4956377_4956596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|4956854_4957010_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980988.1|4957226_4957478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001405664.1|4957544_4957823_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	5.1e-05
WP_001554968.1|4957824_4958871_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.3	1.2e-110
WP_000904112.1|4958883_4959258_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762915.1|4959254_4960076_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	1.6e-78
WP_000562553.1|4960971_4961103_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_001336019.1|4961383_4961719_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.7	1.4e-44
WP_001538589.1|4961979_4963941_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.1	4.3e-239
WP_023143432.1|4964077_4964260_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	85.0	5.1e-22
WP_001538590.1|4964297_4964543_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	92.6	8.8e-17
WP_000284506.1|4964619_4964835_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_021534707.1|4964839_4965646_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	95.5	8.1e-144
WP_000551290.1|4965655_4965970_-	hypothetical protein	NA	Q08J99	Stx2-converting_phage	100.0	4.7e-55
WP_001092910.1|4966098_4966632_+	lysozyme	NA	Q08J98	Stx2-converting_phage	96.6	1.1e-101
WP_032140280.1|4967186_4967273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|4967494_4967680_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000235436.1|4968190_4968700_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_060624626.1|4968671_4970600_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.0e-261
WP_000258993.1|4970583_4970790_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001322425.1|4970786_4972379_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
WP_001253888.1|4972368_4973874_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.0e-99
WP_000256814.1|4973910_4974258_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
WP_001573716.1|4974315_4975344_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	4.1e-116
WP_000201530.1|4975395_4975770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204533.1|4975762_4976116_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000974996.1|4976131_4976665_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
WP_000683079.1|4976661_4977057_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235047.1|4977064_4977814_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.8	2.7e-125
WP_001309426.1|4977832_4978264_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	7.4e-43
WP_000533401.1|4978290_4978704_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	4.6e-42
WP_001556919.1|4978684_4981246_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.7	0.0e+00
WP_000847298.1|4981242_4981572_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032346844.1|4981571_4982270_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	4.2e-128
WP_000194711.1|4982280_4983024_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	7.7e-149
WP_072037205.1|4982969_4983602_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.4e-103
WP_032198501.1|4983945_4987638_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	86.0	0.0e+00
4985041:4985055	attR	GATGTGGTGTGGCCG	NA	NA	NA	NA
WP_001228261.1|4987705_4988305_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.5	4.4e-102
WP_163510522.1|4988456_4991483_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	54.5	9.1e-55
WP_001545928.1|4991482_4992067_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.0e-104
WP_000240999.1|4992121_4992790_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937481.1|4992846_4993113_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
WP_000799406.1|4993344_4994208_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|4994191_4995328_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|4995577_4996804_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|4996852_4997974_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|4998049_4999510_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|4999509_5000181_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|5000349_5001720_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|5001723_5002365_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001295972.1|5002400_5003507_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476103.1|5003560_5004022_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_000873387.1|5004031_5004670_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_012602377.1|5005002_5005353_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_000381622.1|5005337_5005787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522898.1|5006368_5007619_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	6.5e-23
WP_000526135.1|5007814_5008273_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001309448.1|5008430_5008754_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	63.6	1.3e-39
WP_000526135.1|5009392_5009851_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_019842521.1|5010007_5010118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522899.1|5010170_5010575_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332298.1|5010795_5011527_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
>prophage 359
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	5017072	5019736	5151952		Escherichia_phage(100.0%)	1	NA	NA
WP_001563811.1|5017072_5019736_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.0	1.7e-84
>prophage 360
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	5031300	5032988	5151952		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|5031300_5031720_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001550982.1|5031719_5032988_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	82.7	1.6e-207
>prophage 361
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	5052538	5053297	5151952		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_001563812.1|5052538_5053297_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.5e-14
>prophage 362
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	5069154	5071906	5151952		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033363.1|5069154_5070834_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	7.9e-24
WP_001298109.1|5070958_5071906_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 363
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	5075042	5082556	5151952	transposase	Pseudomonas_phage(25.0%)	10	NA	NA
WP_001550996.1|5075042_5076125_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456570.1|5076124_5076958_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200377.1|5076954_5077347_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|5077350_5078160_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|5078195_5079050_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000526135.1|5079244_5079703_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000176713.1|5079908_5080016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170955.1|5080443_5080551_-	small toxic polypeptide LdrA/LdrC	NA	NA	NA	NA	NA
WP_001309461.1|5080955_5082056_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146444.1|5082325_5082556_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 364
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	5093689	5104056	5151952		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|5093689_5095228_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571705.1|5095224_5095935_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|5095934_5096612_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|5097693_5098536_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001314642.1|5098585_5099044_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|5099156_5100062_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|5100153_5101167_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|5101368_5102277_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|5102421_5102835_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|5103438_5104056_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
>prophage 365
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	5112467	5114482	5151952		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|5112467_5113481_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_001551001.1|5113477_5114482_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 366
NZ_CP048934	Escherichia coli strain 190693 chromosome, complete genome	5151952	5122418	5151103	5151952	integrase,holin	Escherichia_phage(45.95%)	50	5118370:5118383	5136448:5136461
5118370:5118383	attL	CTGCTTCCAGCGAT	NA	NA	NA	NA
WP_000113674.1|5122418_5123549_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|5123526_5123775_-	excisionase	NA	NA	NA	NA	NA
WP_061089777.1|5123839_5126314_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001093903.1|5126406_5126598_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450218.1|5126594_5126783_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000935596.1|5126793_5127648_-	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_000358771.1|5128205_5128484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394529.1|5128443_5128845_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	1.0e-09
WP_163510525.1|5128867_5129086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379612.1|5129245_5129401_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_000753626.1|5129654_5130116_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	99.3	7.6e-78
WP_001053425.1|5130223_5130499_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	97.6	1.1e-39
WP_000702041.1|5130482_5130908_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262415.1|5130979_5132020_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	89.8	1.0e-98
WP_001309414.1|5131931_5132474_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_001673352.1|5132507_5133278_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.0	2.5e-86
WP_001141099.1|5133293_5133686_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|5133682_5133979_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209475.1|5133975_5134437_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_000403782.1|5134414_5134771_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.4e-58
WP_032234226.1|5134866_5135049_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	1.5e-26
WP_001514294.1|5135041_5135218_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	91.4	2.8e-25
WP_001289987.1|5135214_5135574_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	76.5	9.2e-39
WP_001167296.1|5135576_5136068_+	hypothetical protein	NA	G9L661	Escherichia_phage	92.0	3.7e-83
WP_000224227.1|5136069_5136333_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207997.1|5136343_5136511_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
5136448:5136461	attR	ATCGCTGGAAGCAG	NA	NA	NA	NA
WP_000206826.1|5136507_5136852_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
WP_000967408.1|5137086_5137299_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001004956.1|5137464_5138115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|5138095_5139199_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000687431.1|5139356_5139530_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	68.5	6.8e-16
WP_001403449.1|5139589_5139862_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
WP_001265091.1|5139863_5140910_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	4.5e-110
WP_000904114.1|5140922_5141297_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762880.1|5141293_5142115_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917767.1|5142341_5142539_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_032299157.1|5142689_5143739_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	7.5e-198
WP_106104550.1|5144036_5144123_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001333559.1|5144611_5144824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001586961.1|5144894_5145230_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	4.0e-44
WP_047938340.1|5145490_5147347_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	89.2	0.0e+00
WP_000284510.1|5147497_5147713_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|5147717_5148062_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369851.1|5148027_5148300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992072.1|5148405_5148939_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.4	2.4e-99
WP_032140280.1|5149493_5149580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|5149801_5149987_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000736383.1|5150072_5150297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|5150495_5150696_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|5150737_5151103_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
