The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047585	Lactobacillus fermentum strain AGR1487 chromosome, complete genome	1939032	16149	93723	1939032	protease,transposase	Staphylococcus_phage(18.18%)	57	NA	NA
WP_085013424.1|16149_17148_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.3e-50
WP_003685635.1|18928_19636_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.8	7.9e-42
WP_049184174.1|19647_21507_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	35.6	2.9e-35
WP_062813557.1|21490_22789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062813556.1|22790_23591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080983508.1|23605_24421_+	MBL fold metallo-hydrolase	NA	A0A2H4J3R0	uncultured_Caudovirales_phage	32.7	1.6e-33
WP_049184179.1|24495_25767_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.3	3.4e-19
WP_021350198.1|26274_26754_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_003685648.1|26968_27394_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_049184183.1|27399_28338_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_062813555.1|28808_30152_+	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_062813554.1|30164_32411_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_163601257.1|32557_33226_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_076810820.1|33308_34472_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_062813552.1|34533_35436_-	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.4	1.3e-17
WP_062813551.1|35687_36665_-	choloylglycine hydrolase family protein	NA	A7IWP6	Paramecium_bursaria_Chlorella_virus	30.2	3.6e-21
WP_057194181.1|36719_37655_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_049182901.1|37954_38947_-	D-2-hydroxyacid dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	32.2	8.7e-39
WP_049182899.1|38962_40147_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003685663.1|40495_40726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049182894.1|40810_42904_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.1	1.9e-120
WP_049182522.1|43199_44660_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_049182524.1|45143_48878_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_163601258.1|48884_52898_+	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	21.4	3.3e-12
WP_049182527.1|52897_53761_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	46.4	7.3e-58
WP_076810810.1|53998_55624_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_048339891.1|55917_56274_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	39.1	7.0e-15
WP_062813546.1|56312_57428_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_049182572.1|57420_58152_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	3.7e-26
WP_049182571.1|58289_58844_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003682354.1|58924_59899_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	69.0	4.9e-135
WP_163601259.1|60097_61387_+	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	37.6	3.2e-73
WP_049182569.1|61713_63096_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003685686.1|63377_63917_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_049182567.1|64035_64767_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_163601260.1|64766_65393_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	38.6	4.8e-35
WP_048339895.1|65492_65822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350374.1|66292_66685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015638436.1|66827_68366_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_163601261.1|68365_69862_+	accessory Sec system glycosyltransferase Asp1	NA	NA	NA	NA	NA
WP_003682375.1|70271_71114_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015638439.1|71139_72204_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	7.5e-28
WP_049182934.1|72196_72898_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_163601775.1|73023_74172_+	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_163601262.1|74355_75780_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.9	3.3e-71
WP_163601263.1|76944_77970_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	7.1e-44
WP_062813540.1|78028_79408_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_163601264.1|79767_79980_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_057194201.1|80163_80748_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_057194202.1|82664_83840_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_057194203.1|84099_84333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163601265.1|84415_85636_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	1.4e-94
WP_057195068.1|86403_87804_+	amino acid permease	NA	NA	NA	NA	NA
WP_062813536.1|87953_89282_+	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_163601266.1|89521_90742_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.0	5.3e-94
WP_163601267.1|91801_92746_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	35.8	4.6e-05
WP_163601268.1|92760_93723_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP047585	Lactobacillus fermentum strain AGR1487 chromosome, complete genome	1939032	98649	161368	1939032	tRNA,transposase	Streptococcus_phage(19.05%)	55	NA	NA
WP_076811120.1|98649_99102_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_163601270.1|99180_100431_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.6e-56
WP_070955325.1|100643_101777_+	exonuclease SbcCD subunit D	NA	R4JGS2	Bacillus_phage	25.0	3.1e-08
WP_163601271.1|101773_104878_+	SMC family ATPase	NA	NA	NA	NA	NA
WP_049182845.1|105165_106464_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.8	4.7e-93
WP_163601272.1|106966_107980_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_163601273.1|108237_109491_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	41.7	3.9e-84
WP_049184295.1|109960_111415_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_049184293.1|111418_112162_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.9	1.6e-32
WP_111522950.1|112621_113995_+	amino acid permease	NA	NA	NA	NA	NA
WP_163601274.1|114318_115569_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.3	1.8e-57
WP_012390701.1|115647_116100_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_163601275.1|116484_117672_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_015638455.1|118137_119337_+	nucleoside transporter	NA	NA	NA	NA	NA
WP_163601276.1|119572_120493_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_163601776.1|120681_121419_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_023465732.1|121437_122373_+	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	32.1	2.7e-13
WP_163601277.1|122386_123220_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	32.9	1.8e-16
WP_003682416.1|123232_123433_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_003685747.1|123448_124546_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_054173577.1|124579_125353_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_163601278.1|125625_126768_+	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	32.6	5.1e-59
WP_163601279.1|127117_128131_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163601280.1|128130_128901_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_163601281.1|128917_129658_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_163601282.1|129684_130455_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_163601283.1|130442_131111_+	sugar transferase	NA	NA	NA	NA	NA
WP_163601268.1|132095_133058_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_163601284.1|133621_134413_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_163601285.1|134409_135309_+	capsular polysaccharide synthesis family protein	NA	NA	NA	NA	NA
WP_163601286.1|135333_136320_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_163601287.1|136343_137534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163601288.1|137656_138151_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_163601289.1|138150_139590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163601777.1|139640_140759_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	78.1	2.0e-172
WP_163601290.1|140807_141617_+	beta-1,6-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_080965022.1|141862_142297_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	28.9	3.7e-10
WP_163601291.1|143490_143997_-	cupin domain-containing protein	NA	A0A291ATU0	Pandoravirus	34.1	7.4e-10
WP_031284839.1|144193_144883_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.6	1.8e-35
WP_163601292.1|145080_146223_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.5	2.5e-29
WP_163601293.1|146222_147518_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_163601294.1|147860_148736_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_057728087.1|148735_149155_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_076811459.1|149267_149528_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_076811457.1|149527_149875_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_062813508.1|149888_150434_+	esterase	NA	NA	NA	NA	NA
WP_163601295.1|150667_151855_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	33.0	4.0e-46
WP_163601296.1|151988_152177_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163601297.1|152331_153372_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_163601298.1|153459_155121_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_163601299.1|155402_155888_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.8	1.1e-21
WP_035424032.1|155871_157011_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_163601300.1|157029_158325_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.7	6.3e-21
WP_014081459.1|159794_160193_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	1.1e-45
WP_062813495.1|160192_161368_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	54.4	1.1e-112
>prophage 3
NZ_CP047585	Lactobacillus fermentum strain AGR1487 chromosome, complete genome	1939032	183738	207927	1939032	transposase	Lactobacillus_phage(44.44%)	23	NA	NA
WP_014081459.1|183738_184137_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	1.1e-45
WP_062813495.1|184136_185312_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	54.4	1.1e-112
WP_163601312.1|185463_185982_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_062813497.1|186029_186506_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	35.9	4.5e-17
WP_163601313.1|192222_193146_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.4	1.1e-32
WP_163601314.1|193448_194084_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_014081459.1|194206_194605_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	1.1e-45
WP_062813495.1|194604_195780_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	54.4	1.1e-112
WP_062813494.1|196061_196451_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_079247428.1|196445_196580_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049182491.1|196582_197101_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_062813492.1|197185_197842_+	nitroreductase	NA	NA	NA	NA	NA
WP_062813491.1|198688_199249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062813490.1|200040_200925_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062813489.1|201037_201547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062813488.1|201533_201890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163601315.1|201901_202645_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_062813486.1|202730_203552_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	36.1	9.5e-39
WP_062813485.1|203614_203809_+	CsbD family protein	NA	NA	NA	NA	NA
WP_163601316.1|204303_204672_+	DUF2255 family protein	NA	NA	NA	NA	NA
WP_062813483.1|205463_206048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012390701.1|206145_206598_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_163601317.1|206676_207927_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.2	1.9e-54
>prophage 4
NZ_CP047585	Lactobacillus fermentum strain AGR1487 chromosome, complete genome	1939032	225340	233660	1939032		Staphylococcus_phage(50.0%)	8	NA	NA
WP_012390781.1|225340_225988_+	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	27.1	1.8e-16
WP_003683956.1|225997_226729_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_003683957.1|226739_227054_+	DNA-binding protein	NA	A0A2R3ZXQ3	Staphylococcus_phage	40.4	6.6e-17
WP_049183165.1|227178_228219_+	Zn-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.3	2.4e-10
WP_049183163.1|228426_230952_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	26.4	9.3e-69
WP_049183161.1|231126_231687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049183159.1|231925_232783_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	36.9	1.6e-49
WP_163601321.1|232796_233660_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.8	1.7e-51
>prophage 5
NZ_CP047585	Lactobacillus fermentum strain AGR1487 chromosome, complete genome	1939032	358811	367283	1939032		Enterococcus_phage(33.33%)	10	NA	NA
WP_076810904.1|358811_360983_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	59.4	3.0e-249
WP_004563324.1|361082_361304_-	glutaredoxin-like protein NrdH	NA	X2KRY7	Enterococcus_phage	54.7	3.2e-10
WP_049184662.1|361590_362085_+	nucleoside deaminase	NA	A0A2H4PQS8	Staphylococcus_phage	34.4	7.5e-07
WP_062813443.1|362340_364032_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	38.6	3.9e-55
WP_004562761.1|364054_364363_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_049184668.1|364378_364978_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_004562763.1|364979_365228_+	YaaL family protein	NA	NA	NA	NA	NA
WP_062813442.1|365247_365892_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	53.1	2.8e-54
WP_004562765.1|365904_366225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163601346.1|366242_367283_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	32.3	2.1e-27
>prophage 6
NZ_CP047585	Lactobacillus fermentum strain AGR1487 chromosome, complete genome	1939032	443896	494309	1939032	tRNA,transposase	Streptococcus_phage(22.22%)	45	NA	NA
WP_163601354.1|443896_445141_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.6	2.1e-45
WP_004563273.1|445645_446128_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_163601355.1|447348_448488_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	1.4e-43
WP_135292835.1|448671_449835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012390875.1|450768_451782_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_163601356.1|451864_453070_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_163601357.1|453174_453909_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_135293564.1|453951_454726_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.4	4.8e-16
WP_163601358.1|454916_456239_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	70.1	2.6e-171
WP_163601359.1|456432_457827_+	amino acid permease	NA	NA	NA	NA	NA
WP_099032354.1|457916_459467_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_003682647.1|459544_459769_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_163601360.1|459821_462215_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.0	1.5e-89
WP_057194886.1|462235_462709_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	56.1	2.6e-41
WP_057727744.1|462736_463321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057194884.1|463458_464148_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	45.1	1.1e-45
WP_003682658.1|464181_465156_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003682659.1|465164_465617_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_163601361.1|465616_466132_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004563262.1|466261_466801_-	exonuclease	NA	A0A1S5SFA9	Streptococcus_phage	37.4	4.8e-23
WP_003682662.1|466928_467825_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_086439729.1|467839_468682_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_057194881.1|468671_469550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682665.1|469589_470948_+	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	26.9	3.6e-19
WP_163601362.1|471161_472982_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	35.2	9.9e-89
WP_004563258.1|473262_473574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163601363.1|473583_475434_+	acetyltransferase	NA	NA	NA	NA	NA
WP_163601364.1|475464_476283_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_057727752.1|476603_477185_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	51.6	3.4e-27
WP_163601365.1|477554_478478_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	2.5e-32
WP_057194878.1|478639_479668_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_062813400.1|479788_480694_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	41.2	7.5e-05
WP_076811363.1|480790_481753_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_163601366.1|481839_482679_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	39.8	1.1e-47
WP_079247423.1|482842_483358_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_163601367.1|483589_484531_-	Dyp-type peroxidase	NA	A0A0B5JDC7	Pandoravirus	30.4	2.0e-08
WP_062813396.1|485005_485989_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_057194873.1|486008_486812_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_057728115.1|486840_487761_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_163601368.1|487762_488113_+	DUF956 family protein	NA	NA	NA	NA	NA
WP_163601369.1|488660_489593_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.8	4.8e-39
WP_057728161.1|489778_490501_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_057728160.1|490500_492003_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	34.2	1.2e-34
WP_057194868.1|492205_493066_+	sugar transporter	NA	NA	NA	NA	NA
WP_163601780.1|493400_494309_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	26.9	8.9e-14
>prophage 7
NZ_CP047585	Lactobacillus fermentum strain AGR1487 chromosome, complete genome	1939032	693231	793142	1939032	portal,head,protease,integrase,terminase,tail,capsid,tRNA,transposase	Lactobacillus_phage(45.1%)	112	710550:710574	781792:781816
WP_049182889.1|693231_694482_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.9	4.8e-135
WP_049182890.1|694495_695089_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003682052.1|695088_695388_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	51.5	6.9e-24
WP_163601403.1|695654_695801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049183701.1|695988_696735_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	1.6e-29
WP_057728004.1|697061_698873_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_049183705.1|698937_700245_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_062813279.1|700271_701204_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_062813278.1|701224_702064_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_163601404.1|702136_704434_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.5	6.5e-69
WP_049183714.1|704447_704975_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.0	2.3e-30
WP_163601405.1|705342_705696_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_003682040.1|705775_706774_-	D-2-hydroxyacid dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	34.0	1.8e-47
WP_057728092.1|707275_708085_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_057728091.1|708247_708784_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_049183717.1|708794_709076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049183719.1|709075_709405_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_053093318.1|709751_710060_-	hypothetical protein	NA	NA	NA	NA	NA
710550:710574	attL	AGCCCACGGCCTGCCCGATGGTTGG	NA	NA	NA	NA
WP_163601406.1|710703_712293_-	asparagine synthase B	NA	A0A0G2Y369	Acanthamoeba_polyphaga_mimivirus	39.7	2.8e-103
WP_163601407.1|713161_714106_+	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_049183730.1|714187_714628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163601408.1|714638_715628_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_057728090.1|715649_716096_-	nucleoside 2-deoxyribosyltransferase	NA	A0A1D3SPR3	Enterococcus_phage	36.7	1.8e-20
WP_163601409.1|716196_716817_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_163601410.1|717061_718147_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	54.9	5.7e-108
WP_163601411.1|718175_718397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046948017.1|718747_719608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046948018.1|719673_720018_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_163601781.1|720157_720637_-	hypothetical protein	NA	E9LUL0	Lactobacillus_phage	65.5	1.0e-45
WP_085013424.1|720661_721660_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.3e-50
WP_157787456.1|721904_722078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163601412.1|722052_723057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163601413.1|723090_723618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163601414.1|723639_724083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163601415.1|724109_724334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163601416.1|724305_724605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163601417.1|724866_725259_-	ImmA/IrrE family metallo-endopeptidase	NA	E9LUL3	Lactobacillus_phage	95.4	5.1e-67
WP_163601418.1|725262_725586_-	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	77.6	1.5e-40
WP_163601419.1|725741_725957_+	helix-turn-helix transcriptional regulator	NA	E9LUL5	Lactobacillus_phage	54.9	1.6e-14
WP_163601420.1|725989_726778_+	phage antirepressor	NA	A0A0A7DN31	Lactobacillus_phage	75.7	1.7e-77
WP_163601421.1|726780_726996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163601422.1|727858_728179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163601423.1|728322_728490_+	hypothetical protein	NA	E9LUM1	Lactobacillus_phage	75.0	9.8e-12
WP_163601424.1|728526_728736_+	hypothetical protein	NA	E9LUM2	Lactobacillus_phage	73.9	1.1e-23
WP_035435754.1|729009_729531_+	single-stranded DNA-binding protein	NA	A0A286QMN2	Streptococcus_phage	50.7	1.3e-30
WP_163601425.1|729544_730237_+	helix-turn-helix domain-containing protein	NA	A0A1W6JQ30	Staphylococcus_phage	46.2	1.4e-14
WP_163601426.1|730307_730757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035435748.1|730874_731339_+	hypothetical protein	NA	A0A0A1EL23	Lactobacillus_phage	59.7	7.2e-44
WP_163601427.1|731788_732790_+	hypothetical protein	NA	A0A1L2JY39	Aeribacillus_phage	25.3	1.7e-05
WP_163601428.1|732831_733278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349255.1|733351_733558_-	CsbD family protein	NA	NA	NA	NA	NA
WP_070447750.1|733988_734579_+	hypothetical protein	NA	D2IYV7	Enterococcus_phage	33.0	4.7e-24
WP_163601429.1|734717_735224_+	HNH endonuclease	NA	B8R694	Lactobacillus_phage	58.6	6.0e-44
WP_163601782.1|735422_735884_+|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	52.3	8.2e-40
WP_163601783.1|735883_737785_+|terminase	terminase large subunit	terminase	B8R649	Lactobacillus_phage	63.6	1.9e-244
WP_163601430.1|737800_737983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163601431.1|737982_739203_+|portal	phage portal protein	portal	B8R650	Lactobacillus_phage	48.4	2.1e-95
WP_163601432.1|739135_740914_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	49.5	6.9e-135
WP_163601433.1|740934_741237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163601434.1|741208_741577_+|head	phage head closure protein	head	B8R652	Lactobacillus_phage	42.3	7.5e-20
WP_163601435.1|741569_742007_+	hypothetical protein	NA	A0A286QS23	Streptococcus_phage	50.0	3.3e-30
WP_163601436.1|742006_742378_+	DUF806 family protein	NA	A0A286QR13	Streptococcus_phage	37.1	4.7e-14
WP_163586955.1|742389_743013_+	hypothetical protein	NA	A0A286QSF8	Streptococcus_phage	27.9	2.0e-12
WP_163601437.1|743079_743409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163601438.1|743613_747804_+	transglycosylase SLT domain-containing protein	NA	E9LUR1	Lactobacillus_phage	31.6	1.1e-26
WP_163601439.1|747866_748706_+|tail	phage tail family protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	28.0	3.6e-17
WP_163601784.1|749702_751307_+	hypothetical protein	NA	E9LUJ4	Lactobacillus_phage	25.6	9.2e-38
WP_163601440.1|751293_753579_+	hypothetical protein	NA	E9LUJ5	Lactobacillus_phage	49.9	4.7e-120
WP_163601441.1|753571_753763_+	hypothetical protein	NA	E9LUJ6	Lactobacillus_phage	82.0	1.1e-14
WP_163601442.1|753765_754005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163601443.1|754018_754489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163601444.1|754488_754872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163601445.1|754885_755383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163601446.1|755521_755776_+	hypothetical protein	NA	D2KRC5	Lactobacillus_phage	49.4	8.5e-15
WP_163601447.1|755772_756207_+	hypothetical protein	NA	A0A0A1ELI5	Lactobacillus_phage	40.9	7.2e-14
WP_163601448.1|756157_757321_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A075KJD2	Lactobacillus_phage	39.1	1.6e-39
WP_163601268.1|757506_758469_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_163601449.1|759660_759861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012391635.1|759938_760631_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_163601785.1|760555_761506_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	30.2	4.5e-16
WP_016363744.1|761686_762007_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_163601450.1|762378_762720_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_163601451.1|762846_765993_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_163601452.1|766654_767236_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	35.5	2.0e-19
WP_163601453.1|768010_768931_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	5.8e-37
WP_088460938.1|769054_769198_+	MFS transporter	NA	NA	NA	NA	NA
WP_163601454.1|769280_769643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163601455.1|769788_770814_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.1	1.3e-42
WP_163601786.1|770886_771534_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	51.2	2.5e-55
WP_163601456.1|771562_771760_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_079247419.1|772258_773065_-|integrase	site-specific integrase	integrase	E9LUS1	Lactobacillus_phage	50.4	3.1e-66
WP_163601457.1|773214_773913_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	31.7	1.8e-22
WP_163601787.1|773849_774758_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	26.9	1.5e-13
WP_163601458.1|775168_775849_+	serine dehydratase	NA	NA	NA	NA	NA
WP_049183612.1|775849_776737_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_049183615.1|776733_777048_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_079247391.1|777511_778474_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_062813232.1|780429_781599_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_049183626.1|781953_782580_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	54.3	2.3e-16
781792:781816	attR	AGCCCACGGCCTGCCCGATGGTTGG	NA	NA	NA	NA
WP_057727693.1|782735_782987_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003685231.1|783063_783291_+	YneF family protein	NA	NA	NA	NA	NA
WP_163601459.1|783357_783990_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_062813231.1|784085_784838_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003681959.1|784830_785121_+	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	38.0	1.4e-05
WP_049183632.1|785274_786054_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_062813229.1|786144_787023_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_062813228.1|787103_787829_+	UMP kinase	NA	NA	NA	NA	NA
WP_021815941.1|787828_788389_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_057727688.1|788521_789289_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	36.0	5.9e-19
WP_012391092.1|789305_790094_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_057727687.1|790115_791387_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_049183645.1|791420_793142_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	25.9	1.8e-07
>prophage 8
NZ_CP047585	Lactobacillus fermentum strain AGR1487 chromosome, complete genome	1939032	811620	866027	1939032	tRNA,protease,transposase	Staphylococcus_phage(28.57%)	49	NA	NA
WP_049183669.1|811620_812517_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_163601464.1|812527_813493_+	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_049184606.1|815101_815467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057728137.1|815592_816639_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_014562322.1|816649_817237_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_057728138.1|817273_819130_+	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	45.4	4.2e-135
WP_062814009.1|819241_820402_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	29.3	6.5e-17
WP_062814008.1|820744_821356_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_049184619.1|821383_822136_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_163601327.1|822710_823643_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.7	6.7e-41
WP_163601789.1|823651_824311_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	33.3	6.4e-22
WP_163601788.1|824247_825156_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	26.9	8.9e-14
WP_163601465.1|825827_827660_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.1	1.9e-23
WP_049182614.1|828167_828671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049182615.1|828706_829330_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_163601466.1|830703_831777_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.9	2.0e-89
WP_062814005.1|831788_832964_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	41.5	8.4e-89
WP_049183413.1|833228_833699_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	44.1	4.0e-26
WP_062814004.1|833691_834885_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	2.5e-96
WP_057727952.1|834871_835480_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.1	1.4e-26
WP_163601467.1|835479_836538_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.9	1.3e-40
WP_163601468.1|836947_837433_-	flavodoxin	NA	NA	NA	NA	NA
WP_062814002.1|837605_838778_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_163601469.1|840123_840804_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_062814000.1|840978_841506_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_163601470.1|841780_841921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062813999.1|842010_842859_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_062813998.1|842871_843390_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_049185089.1|843829_844015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163601471.1|844247_845039_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_049185087.1|845127_845571_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_049185085.1|845585_846398_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_062813997.1|846459_847101_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_163601472.1|847265_848063_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_048339929.1|848064_848850_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_163601473.1|849188_851156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003688751.1|851585_851873_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_163601474.1|852805_853192_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_163601475.1|853332_854472_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	1.4e-43
WP_062813994.1|854583_855783_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_062813992.1|856206_857922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049184599.1|858536_859103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062813991.1|859276_860230_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_049184586.1|860838_861165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062813989.1|861217_862180_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_057727636.1|862179_862929_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_062813988.1|862988_863330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049184580.1|863345_865580_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A218M393	Acidovorax_phage	43.5	6.8e-07
WP_049184579.1|865589_866027_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP047585	Lactobacillus fermentum strain AGR1487 chromosome, complete genome	1939032	934756	943024	1939032	tRNA	Staphylococcus_phage(28.57%)	8	NA	NA
WP_062813950.1|934756_935959_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	48.6	7.6e-45
WP_062813949.1|935971_937858_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	1.0e-51
WP_062813948.1|937923_938883_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	63.1	7.0e-118
WP_062813947.1|938894_939392_+	dihydrofolate reductase	NA	A0A1Y0SUI9	Pseudomonas_phage	37.3	2.4e-21
WP_062813946.1|939377_940007_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_003684926.1|940173_941016_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	33.3	3.0e-16
WP_062813945.1|941149_942328_-	3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	36.3	2.5e-61
WP_012391200.1|942397_943024_+	chloramphenicol acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	40.8	4.0e-13
>prophage 10
NZ_CP047585	Lactobacillus fermentum strain AGR1487 chromosome, complete genome	1939032	1181854	1189912	1939032	transposase	Staphylococcus_phage(50.0%)	7	NA	NA
WP_135293564.1|1181854_1182629_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.4	4.8e-16
WP_069775620.1|1182679_1184371_+	fibronectin/fibrinogen-binding protein	NA	M1I5P2	Paramecium_bursaria_Chlorella_virus	36.2	8.5e-10
WP_163601543.1|1185500_1186721_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	1.1e-94
WP_012391386.1|1186909_1187326_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	46.8	1.0e-25
WP_012391387.1|1187337_1188375_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_012391388.1|1188425_1188743_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	51.1	4.0e-22
WP_163601545.1|1188895_1189912_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.1	5.6e-33
>prophage 11
NZ_CP047585	Lactobacillus fermentum strain AGR1487 chromosome, complete genome	1939032	1394447	1467210	1939032	integrase,tRNA,protease,transposase	Staphylococcus_phage(18.18%)	59	1466647:1466706	1467848:1467957
WP_062813692.1|1394447_1395371_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.1	6.7e-33
WP_163601601.1|1395473_1395851_+	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_062813762.1|1395895_1397542_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_003683636.1|1397654_1397918_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_057728147.1|1398238_1400656_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	66.8	0.0e+00
WP_062813761.1|1400984_1401725_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_062813760.1|1401983_1403225_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	55.1	1.1e-107
WP_057728100.1|1403227_1404019_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	38.7	4.7e-43
WP_049182478.1|1404301_1405489_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.6	3.5e-143
WP_057728099.1|1405682_1406414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062813758.1|1406497_1407034_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_062813757.1|1407072_1408506_-	MFS transporter	NA	NA	NA	NA	NA
WP_021349073.1|1408627_1409083_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_062813756.1|1409181_1410549_-	amino acid permease	NA	NA	NA	NA	NA
WP_003683616.1|1410720_1410879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049182473.1|1410888_1411506_+	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_003686118.1|1413462_1413894_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003686116.1|1414105_1414609_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_163601604.1|1414915_1415746_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	71.2	1.2e-20
WP_062813754.1|1416155_1417226_-	NAD(P)-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.5	3.9e-08
WP_163601607.1|1417434_1418772_-	purine permease	NA	NA	NA	NA	NA
WP_062813752.1|1418923_1419796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049184625.1|1419804_1420386_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	59.1	1.1e-52
WP_062814138.1|1420330_1422547_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	58.7	2.8e-247
WP_049184624.1|1422913_1423597_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_049184622.1|1423619_1424441_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_076810948.1|1424800_1425025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003684211.1|1432191_1432440_-	DUF1797 family protein	NA	NA	NA	NA	NA
WP_076811130.1|1432773_1433793_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_049183836.1|1433794_1434820_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_049183834.1|1434812_1436030_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_062813751.1|1436245_1437976_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_049183828.1|1437977_1438244_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_057728032.1|1438373_1438616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057728031.1|1438789_1441036_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	40.6	4.9e-122
WP_163601610.1|1441339_1442047_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_057728029.1|1442173_1442749_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	37.4	1.5e-27
WP_163601612.1|1444571_1445132_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_057728027.1|1445305_1445977_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	41.2	1.2e-34
WP_062813747.1|1445912_1447250_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	35.8	6.9e-63
WP_057728025.1|1447498_1448218_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_062813745.1|1448228_1449017_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	34.5	4.4e-25
WP_057728023.1|1449006_1449891_+	DMT family transporter	NA	NA	NA	NA	NA
WP_163601797.1|1449969_1451214_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_163601255.1|1451355_1451493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163601614.1|1451618_1452299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015639302.1|1452311_1453172_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	3.7e-17
WP_003684176.1|1453158_1453536_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163601616.1|1453644_1454577_-	dTDP-glucose 4,6-dehydratase	NA	M1H4P8	Acanthocystis_turfacea_Chlorella_virus	39.6	3.3e-56
WP_057728045.1|1454597_1455506_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_057728044.1|1455523_1456576_-	sugar transferase	NA	NA	NA	NA	NA
WP_163601618.1|1456593_1458174_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	25.6	3.0e-33
WP_163601620.1|1458392_1459370_-	glycosyltransferase family 2 protein	NA	B9UDL7	Salmonella_phage	36.7	1.7e-47
WP_163601622.1|1459458_1460568_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_163601624.1|1460567_1461500_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	50.0	7.6e-77
WP_163601626.1|1461540_1462473_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.1	2.8e-39
WP_075667525.1|1462658_1463222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163601628.1|1463364_1464960_-	hydrolase Nlp/P60	NA	A0A1W6DXV0	Rhodococcus_phage	48.7	1.6e-13
1466647:1466706	attL	CCAAAAAAGGACCGCCAGGGAGCAAAACAAACCTATCAAGATGAAAACCTACTAAATCGG	NA	NA	NA	NA
WP_100224342.1|1466757_1467210_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0N9SIX5	Staphylococcus_phage	31.2	6.4e-05
WP_100224342.1|1466757_1467210_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0N9SIX5	Staphylococcus_phage	31.2	6.4e-05
1467848:1467957	attR	CCAAAAAAGGACCGCCAGGGAGCAAAACAAACCTATCAAGATGAAAACCTACTAAATCGGCAATTTAAGCAAGAAAAGCCGAATCAGGTTTGGGTAACAGATACAACAGA	NA	NA	NA	NA
>prophage 12
NZ_CP047585	Lactobacillus fermentum strain AGR1487 chromosome, complete genome	1939032	1527492	1538930	1939032	transposase	Erysipelothrix_phage(37.5%)	13	NA	NA
WP_057727515.1|1527492_1528152_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.6e-41
WP_049184701.1|1529041_1529398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163601800.1|1529770_1530679_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	26.9	2.0e-13
WP_081011445.1|1530615_1531314_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	31.7	2.3e-22
WP_163601801.1|1531432_1531669_+	hypothetical protein	NA	H7BV84	unidentified_phage	60.6	9.7e-05
WP_163601672.1|1531779_1531947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163601674.1|1532010_1533528_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	40.6	2.6e-106
WP_128492372.1|1533534_1533948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128492792.1|1533963_1535529_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	49.5	4.5e-130
WP_163601676.1|1535591_1536134_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_128492370.1|1536130_1536460_-	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_128492369.1|1536471_1537365_-	ATP-binding protein	NA	J7KDG8	Streptococcus_phage	34.1	2.6e-13
WP_163601678.1|1537550_1538930_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	52.4	4.7e-131
