The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP034967	Aeromonas veronii strain ZfB1 chromosome, complete genome	4711383	981830	991121	4711383		Staphylococcus_phage(50.0%)	8	NA	NA
WP_164536183.1|981830_984656_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.5	9.5e-46
WP_139743394.1|984707_984992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040068624.1|985316_986570_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.2	3.0e-100
WP_005338880.1|986720_987170_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_164536184.1|987369_988479_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	34.1	2.3e-48
WP_043823065.1|988534_989188_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.2	3.5e-20
WP_164536185.1|989337_990447_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	39.2	4.7e-65
WP_005338866.1|990650_991121_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.3	5.1e-29
>prophage 2
NZ_CP034967	Aeromonas veronii strain ZfB1 chromosome, complete genome	4711383	1452878	1459918	4711383		Escherichia_phage(50.0%)	6	NA	NA
WP_164536406.1|1452878_1454054_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	48.3	5.6e-101
WP_164536407.1|1454114_1456076_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	26.0	5.8e-18
WP_164537916.1|1456279_1457386_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	50.9	7.9e-97
WP_164536408.1|1457385_1458273_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	2.4e-27
WP_164536409.1|1458386_1459298_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.4	2.1e-103
WP_164536410.1|1459378_1459918_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	45.1	7.8e-42
>prophage 3
NZ_CP034967	Aeromonas veronii strain ZfB1 chromosome, complete genome	4711383	1658274	1735432	4711383	lysis,terminase,portal,tail,capsid,protease,head,holin,transposase,plate,integrase	Salmonella_phage(17.02%)	92	1729728:1729783	1742785:1742840
WP_164535787.1|1658274_1659603_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_164536504.1|1660017_1661196_-	MFS transporter	NA	NA	NA	NA	NA
WP_164537927.1|1661539_1662547_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_164536505.1|1662708_1663512_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	31.7	4.0e-34
WP_164536506.1|1663577_1663874_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_005350859.1|1664489_1664894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043825711.1|1665085_1665988_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_164536507.1|1666159_1666393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164536508.1|1666586_1668563_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	55.7	5.1e-14
WP_139406514.1|1668789_1670292_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_069526680.1|1670346_1671195_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_005337540.1|1671684_1673043_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_005337538.1|1673145_1673904_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.6	3.3e-22
WP_164536509.1|1674221_1675709_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_164536510.1|1675815_1676904_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	32.1	3.9e-08
WP_005337529.1|1677122_1677605_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_005350885.1|1677903_1678275_+	DUF413 domain-containing protein	NA	NA	NA	NA	NA
WP_164536511.1|1678274_1679147_+	HTH-type transcriptional regulator HdfR	NA	NA	NA	NA	NA
WP_164536512.1|1679318_1680260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005350888.1|1680405_1681596_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_164537928.1|1681710_1682214_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_164536513.1|1682207_1682726_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_164536514.1|1682753_1684955_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_164536515.1|1685059_1686823_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	3.3e-57
WP_164536516.1|1686822_1687824_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005347033.1|1687945_1688134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128815636.1|1688130_1688880_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005337448.1|1689092_1689737_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_164536517.1|1689864_1691718_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_031227442.1|1691917_1692472_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_164537929.1|1693051_1694173_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	52.6	1.6e-97
WP_139461254.1|1694223_1694715_-|tail	phage tail protein	tail	A0A077K9Y7	Ralstonia_phage	57.9	5.7e-31
WP_164536518.1|1694727_1697094_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	36.6	3.1e-106
WP_108572652.1|1697090_1697222_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_164536519.1|1697230_1697515_-|tail	phage tail assembly protein	tail	E5FFG7	Burkholderia_phage	56.3	3.4e-20
WP_164536520.1|1697527_1697665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164536521.1|1697725_1698244_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	56.4	2.3e-51
WP_164536522.1|1698256_1699435_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	64.7	2.0e-143
WP_164536523.1|1699603_1700194_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	39.3	5.2e-23
WP_164536524.1|1700195_1701278_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	50.2	2.3e-64
WP_164536525.1|1701274_1701913_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	53.4	8.3e-59
WP_164536526.1|1701909_1702809_-|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	56.5	6.2e-84
WP_164536527.1|1702805_1703165_-|plate	baseplate assembly protein	plate	A4PE42	Ralstonia_virus	51.4	6.0e-22
WP_164536528.1|1703161_1703707_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	42.5	4.1e-30
WP_164536529.1|1703780_1704233_-	phage virion morphogenesis protein	NA	A0A077K9X5	Ralstonia_phage	47.5	4.7e-24
WP_164536530.1|1704235_1704685_-|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	44.7	1.2e-27
WP_164536531.1|1704780_1705254_-|lysis	phage lysis regulatory protein LysB	lysis	E5G6N2	Salmonella_phage	31.7	1.6e-06
WP_164536532.1|1705243_1705420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164536533.1|1705428_1706247_-	DUF3380 domain-containing protein	NA	A0A2H4JGJ9	uncultured_Caudovirales_phage	54.5	1.4e-66
WP_164536534.1|1706243_1706552_-|holin	phage holin family protein	holin	E5E3R8	Burkholderia_phage	47.3	6.7e-14
WP_073536721.1|1706553_1706916_-	hypothetical protein	NA	E5E3R9	Burkholderia_phage	41.3	1.2e-14
WP_159144636.1|1706937_1707168_-	conjugal transfer protein TraR	NA	U3PFL5	Vibrio_phage	40.6	1.7e-06
WP_159144500.1|1707170_1707374_-|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	59.1	8.9e-15
WP_164536535.1|1707373_1707844_-|head	head completion/stabilization protein	head	A0A2H4JCS4	uncultured_Caudovirales_phage	45.2	5.8e-25
WP_164536536.1|1707949_1708201_-	hypothetical protein	NA	A0A2H4P7H0	Pseudomonas_phage	41.0	1.1e-09
WP_164536537.1|1708197_1708881_-|terminase	terminase	terminase	A0A077K804	Ralstonia_phage	46.8	4.8e-44
WP_164536538.1|1708891_1709917_-|capsid	phage major capsid protein, P2 family	capsid	A4JWP9	Burkholderia_virus	59.5	8.9e-111
WP_164536539.1|1709929_1710772_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	47.9	1.5e-60
WP_164536540.1|1710919_1712683_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	69.1	4.3e-238
WP_164536541.1|1712682_1713747_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	57.7	1.2e-115
WP_164536542.1|1714550_1714916_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_164536543.1|1715457_1715646_-	DUF3283 family protein	NA	NA	NA	NA	NA
WP_164536544.1|1715726_1716017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164536545.1|1716026_1716368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164536546.1|1716367_1716568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164536547.1|1716782_1717394_-	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	48.9	2.3e-45
WP_164536548.1|1717405_1719796_-	replication endonuclease	NA	A5X9G4	Aeromonas_virus	37.0	1.5e-105
WP_164536549.1|1719792_1720800_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	44.9	7.2e-73
WP_164537930.1|1720796_1721132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164536550.1|1721245_1721497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164536551.1|1721493_1721715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164536552.1|1721711_1722038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073536735.1|1722034_1722571_-	DNA methyltransferase	NA	U3PDF3	Vibrio_phage	63.2	2.7e-66
WP_164536553.1|1722567_1722744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164536554.1|1722740_1723043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164536555.1|1723184_1723346_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	53.1	3.0e-05
WP_164536556.1|1723338_1723773_-	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	62.2	1.4e-41
WP_164536557.1|1723809_1724256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164536558.1|1724271_1724499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164536559.1|1724495_1724720_-	ogr/Delta-like zinc finger family protein	NA	A0A077K829	Ralstonia_phage	46.9	1.5e-10
WP_164536560.1|1724729_1725248_-	hypothetical protein	NA	A5X9F7	Aeromonas_virus	39.2	5.4e-24
WP_164536561.1|1725281_1725695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164537931.1|1726277_1726607_+	S24 family peptidase	NA	A5X9F5	Aeromonas_virus	63.3	4.8e-34
WP_164536562.1|1726622_1727084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164536563.1|1727108_1728548_+	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	38.0	1.2e-23
WP_164536564.1|1728556_1729615_+|integrase	tyrosine-type recombinase/integrase	integrase	A5X9F3	Aeromonas_virus	58.6	9.8e-113
1729728:1729783	attL	TTTTAAAATCCCTCGACGTTCGCGTCGTGCCGGTTCGATTCCGGCCTCGGGCACCA	NA	NA	NA	NA
WP_164536565.1|1729871_1730456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164535986.1|1730609_1732151_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	3.4e-130
WP_059296348.1|1732165_1732921_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.9	3.4e-59
WP_164536566.1|1732954_1733512_+|integrase	site-specific integrase	integrase	Q9T1P3	Pseudomonas_phage	30.0	7.1e-14
WP_147277440.1|1733738_1733924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164536567.1|1734034_1735432_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	42.0	1.5e-89
1742785:1742840	attR	TTTTAAAATCCCTCGACGTTCGCGTCGTGCCGGTTCGATTCCGGCCTCGGGCACCA	NA	NA	NA	NA
>prophage 4
NZ_CP034967	Aeromonas veronii strain ZfB1 chromosome, complete genome	4711383	2578150	2603874	4711383	transposase	Enterobacteria_phage(50.0%)	15	NA	NA
WP_164535787.1|2578150_2579479_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005336959.1|2579803_2581303_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_101530785.1|2581373_2582180_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_101530786.1|2582348_2584136_+	cyclic nucleotide-binding/CBS domain-containing protein	NA	NA	NA	NA	NA
WP_101530787.1|2584138_2584765_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_005336970.1|2584870_2585182_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_026035062.1|2585193_2586846_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_121463518.1|2586950_2588169_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.5	3.4e-16
WP_043155065.1|2588840_2590262_-|transposase	IS66-like element ISKpn15 family transposase	transposase	NA	NA	NA	NA
WP_121463519.1|2592575_2593514_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_039026395.1|2594043_2594424_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_121463520.1|2594541_2596167_-	MCR-3-related phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
WP_101531744.1|2599504_2599705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121463485.1|2601172_2602734_-|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
WP_042864152.1|2602833_2603874_-|transposase	IS481-like element ISAs19 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	41.8	1.7e-72
>prophage 5
NZ_CP034967	Aeromonas veronii strain ZfB1 chromosome, complete genome	4711383	2772160	2808978	4711383	bacteriocin,protease,transposase,integrase,tRNA	Bacillus_phage(21.43%)	31	2800303:2800337	2810680:2810714
WP_164537020.1|2772160_2772919_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_158113146.1|2773124_2774645_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.6	4.9e-89
WP_005337086.1|2774666_2775155_-|bacteriocin	bacteriocin production protein	bacteriocin	NA	NA	NA	NA
WP_164537021.1|2775163_2775340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005337087.1|2775342_2776638_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.4	3.6e-93
WP_164537952.1|2776944_2778288_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.2	9.0e-79
WP_041236057.1|2778358_2778967_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_164537022.1|2779047_2781588_-	cell division protein FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	9.6e-90
WP_005300047.1|2781766_2782258_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_076494667.1|2782408_2783524_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_042062225.1|2783709_2784660_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.5	1.4e-62
WP_164537023.1|2784722_2785970_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.2	2.5e-14
WP_164537024.1|2786078_2786549_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_164537025.1|2786568_2787276_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_088869181.1|2787272_2787989_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005300033.1|2788057_2788276_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_164537026.1|2788344_2790600_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.0	2.0e-168
WP_005337111.1|2790659_2790977_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	49.4	1.4e-14
WP_005300025.1|2791206_2791425_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.2	1.2e-17
WP_064338144.1|2791542_2792397_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	32.9	6.0e-28
WP_120414445.1|2793246_2793957_+	two-component system response regulator RstA	NA	W8CYM9	Bacillus_phage	31.9	1.3e-28
WP_164537027.1|2793978_2795304_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	4.3e-17
WP_005359970.1|2795358_2795541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164537028.1|2795691_2798241_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_164537029.1|2798252_2798975_+	virulence factor	NA	NA	NA	NA	NA
WP_164537030.1|2799303_2800266_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
2800303:2800337	attL	CAATTTGGCGGTGAGGGAGGGATTCGAACCCTCGA	NA	NA	NA	NA
WP_164537031.1|2800578_2802003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164537032.1|2802112_2803579_-	caspase family protein	NA	NA	NA	NA	NA
WP_164537033.1|2804747_2806103_-	ATPase	NA	A0A2I7QJQ6	Vibrio_phage	32.2	1.1e-18
WP_164537034.1|2806615_2807581_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_164537035.1|2807778_2808978_-|integrase	site-specific integrase	integrase	A0A2H4JGM5	uncultured_Caudovirales_phage	34.4	7.3e-32
2810680:2810714	attR	CAATTTGGCGGTGAGGGAGGGATTCGAACCCTCGA	NA	NA	NA	NA
>prophage 6
NZ_CP034967	Aeromonas veronii strain ZfB1 chromosome, complete genome	4711383	3299115	3356255	4711383	capsid,terminase,integrase,portal	Aeromonas_phage(80.36%)	69	3320358:3320372	3360378:3360392
WP_164537250.1|3299115_3306096_-	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	39.6	3.4e-44
WP_139399668.1|3306234_3306609_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_164537251.1|3306598_3307423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164537252.1|3307664_3309113_-	hypothetical protein	NA	A0A1I9KFD9	Aeromonas_phage	67.6	4.4e-180
WP_041980042.1|3309124_3309364_-	hypothetical protein	NA	A0A1I9KFI4	Aeromonas_phage	61.2	1.2e-15
WP_164537253.1|3309363_3309738_-	hypothetical protein	NA	A0A1I9KFD7	Aeromonas_phage	97.6	6.4e-59
WP_164537254.1|3309748_3310387_-	hypothetical protein	NA	A0A1I9KFE8	Aeromonas_phage	96.7	9.4e-103
WP_164537255.1|3310395_3310764_-	hypothetical protein	NA	A0A1I9KFI0	Aeromonas_phage	79.6	4.1e-50
WP_164537256.1|3310779_3312066_-	hypothetical protein	NA	A0A1I9KGC4	Aeromonas_phage	49.4	2.9e-34
WP_164537257.1|3312116_3313727_-	hypothetical protein	NA	A0A1I9KFD2	Aeromonas_phage	64.8	4.1e-211
WP_164537258.1|3314009_3315677_-	hypothetical protein	NA	A0A2I6PG27	Plesiomonas_phage	57.7	2.1e-37
WP_139401804.1|3315679_3316339_-	hypothetical protein	NA	A0A1I9KFD0	Aeromonas_phage	40.7	2.0e-39
WP_164537259.1|3316350_3316980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164537260.1|3316979_3317423_-	hypothetical protein	NA	A0A1I9KFH0	Aeromonas_phage	77.3	2.6e-51
WP_164537261.1|3317489_3317879_-	hypothetical protein	NA	A0A1I9KGB3	Aeromonas_phage	82.2	4.9e-54
WP_164537262.1|3317947_3319165_-|capsid	N4-gp56 family major capsid protein	capsid	A0A1I9KFC6	Aeromonas_phage	92.3	4.4e-218
WP_164537263.1|3319237_3320167_-	hypothetical protein	NA	A0A1I9KFD1	Aeromonas_phage	77.7	4.4e-125
WP_164537264.1|3320304_3320673_-	hypothetical protein	NA	A0A1I9KG26	Aeromonas_phage	91.7	9.1e-50
3320358:3320372	attL	ACTTGAGCCGCCAGC	NA	NA	NA	NA
WP_164537265.1|3320792_3322919_-|portal	portal protein	portal	A0A1I9KFF7	Aeromonas_phage	92.6	0.0e+00
WP_164537266.1|3322918_3324616_-|terminase	terminase	terminase	A0A1I9KFB6	Aeromonas_phage	90.6	1.2e-306
WP_164537267.1|3324706_3324907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164537268.1|3324949_3325840_-|terminase	terminase	terminase	A0A1I9KFG9	Aeromonas_phage	68.9	1.3e-89
WP_041980004.1|3325840_3326026_-	hypothetical protein	NA	A0A1I9KFC1	Aeromonas_phage	83.6	8.1e-23
WP_164537269.1|3326073_3326304_-	hypothetical protein	NA	A0A1I9KFC5	Aeromonas_phage	85.5	8.5e-30
WP_164537270.1|3326305_3326530_-	hypothetical protein	NA	A0A1I9KFG6	Aeromonas_phage	90.5	4.5e-28
WP_164537271.1|3326585_3327065_-	TIGR02594 family protein	NA	A0A1I9KGA3	Aeromonas_phage	94.2	1.3e-83
WP_164537272.1|3327064_3327382_-	hypothetical protein	NA	A0A1I9KFB8	Aeromonas_phage	98.1	2.2e-52
WP_164537273.1|3327517_3328216_-	hypothetical protein	NA	A0A1I9KFB9	Aeromonas_phage	81.0	9.0e-99
WP_164537274.1|3328212_3328638_-	hypothetical protein	NA	A0A1I9KG18	Aeromonas_phage	86.5	4.2e-67
WP_164537275.1|3328634_3328874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164537276.1|3328870_3329200_-	DUF1364 domain-containing protein	NA	A0A2K8HR56	Pseudomonas_phage	44.1	7.7e-16
WP_164537277.1|3329196_3329790_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	45.2	2.0e-46
WP_164537278.1|3329792_3330137_-	hypothetical protein	NA	A0A1I9KFB7	Aeromonas_phage	86.8	2.8e-53
WP_164537279.1|3330139_3330319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164537280.1|3330315_3330612_-	hypothetical protein	NA	A0A1I9KG94	Aeromonas_phage	81.1	1.1e-37
WP_164537281.1|3330687_3330990_-	hypothetical protein	NA	A0A1I9KFB1	Aeromonas_phage	78.8	7.2e-37
WP_164537282.1|3330976_3331648_-	hypothetical protein	NA	A0A1I9KFB0	Aeromonas_phage	82.5	2.1e-100
WP_164537283.1|3331647_3332790_-	hypothetical protein	NA	A0A1I9KG10	Aeromonas_phage	85.4	1.6e-76
WP_164537284.1|3332800_3334183_-	phosphoadenosine phosphosulfate reductase family protein	NA	Q8W6P3	Burkholderia_virus	30.7	3.8e-40
WP_164537285.1|3334179_3335094_-	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_164537286.1|3335090_3335243_-	hypothetical protein	NA	A0A1I9KFA1	Aeromonas_phage	62.5	7.6e-11
WP_042062778.1|3335293_3335512_-	hypothetical protein	NA	A0A1I9KFG0	Aeromonas_phage	69.7	3.3e-15
WP_164537287.1|3335517_3335916_-	hypothetical protein	NA	A0A1I9KF96	Aeromonas_phage	77.7	5.6e-45
WP_139401738.1|3335957_3336176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139401736.1|3336241_3336922_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_139441045.1|3337638_3337890_+	hypothetical protein	NA	A0A1I9KF98	Aeromonas_phage	45.8	1.7e-07
WP_164537288.1|3338205_3338562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164537289.1|3338890_3339577_+	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	43.8	1.9e-16
WP_164537290.1|3339652_3340018_+	hypothetical protein	NA	A0A1I9KFC9	Aeromonas_phage	63.6	2.4e-34
WP_164537291.1|3340014_3340494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164537292.1|3340490_3341333_+	exodeoxyribonuclease VIII	NA	A0A1I9KFF5	Aeromonas_phage	73.6	1.4e-125
WP_164537972.1|3341389_3342301_+	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	56.5	4.4e-77
WP_164535745.1|3343532_3344756_+	hypothetical protein	NA	A0A1I9KG78	Aeromonas_phage	49.6	1.2e-74
WP_164537293.1|3344752_3345208_+	hypothetical protein	NA	A0A1I9KF89	Aeromonas_phage	74.8	2.4e-60
WP_164537294.1|3345200_3345779_+	phage N-6-adenine-methyltransferase	NA	A0A1I9KF87	Aeromonas_phage	94.3	7.0e-105
WP_164537295.1|3345837_3346014_+	hypothetical protein	NA	A0A1I9KFZ1	Aeromonas_phage	74.6	1.7e-17
WP_164537296.1|3346036_3346975_+	recombination-associated protein RdgC	NA	A0A1I9KFB4	Aeromonas_phage	91.7	1.5e-160
WP_164537297.1|3346971_3347571_+	hypothetical protein	NA	A0A1I9KF82	Aeromonas_phage	58.6	1.2e-54
WP_164537973.1|3347564_3348260_+	DUF3850 domain-containing protein	NA	A0A059T699	Listeria_phage	60.6	5.6e-16
WP_164537298.1|3348223_3348442_+	hypothetical protein	NA	A0A1I9KF77	Aeromonas_phage	81.7	1.2e-28
WP_164537299.1|3348435_3348648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164537300.1|3348650_3348956_+	DUF4406 domain-containing protein	NA	A0A1I9KFD3	Aeromonas_phage	90.2	6.4e-41
WP_164537301.1|3349044_3349962_+	hypothetical protein	NA	H9C0Q8	Aeromonas_phage	31.4	4.5e-21
WP_164537302.1|3350018_3350459_+	hypothetical protein	NA	A0A1I9KG69	Aeromonas_phage	85.4	1.2e-51
WP_017411491.1|3350451_3350649_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	57.4	3.3e-14
WP_164537974.1|3350645_3351791_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	60.5	7.1e-125
WP_164537303.1|3352397_3353750_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	E5AGD0	Erwinia_phage	25.1	5.6e-12
WP_164537304.1|3354108_3355701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164537305.1|3356039_3356255_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	46.0	1.5e-07
3360378:3360392	attR	GCTGGCGGCTCAAGT	NA	NA	NA	NA
>prophage 7
NZ_CP034967	Aeromonas veronii strain ZfB1 chromosome, complete genome	4711383	4448038	4454348	4711383	tRNA	Bacillus_thuringiensis_phage(100.0%)	6	NA	NA
WP_150997203.1|4448038_4448986_+	DUF218 domain-containing protein	NA	Q56AS0	Bacillus_thuringiensis_phage	85.5	9.3e-22
WP_042081873.1|4449070_4449685_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	99.5	3.2e-116
WP_005354955.1|4449702_4450182_-	hypothetical protein	NA	Q56AR5	Bacillus_thuringiensis_phage	98.7	3.0e-37
WP_005335957.1|4450357_4451374_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	99.7	1.3e-191
WP_164537782.1|4451575_4452295_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q56AQ6	Bacillus_thuringiensis_phage	96.2	1.3e-129
WP_164537783.1|4452281_4454348_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	Q56AQ2	Bacillus_thuringiensis_phage	94.3	2.7e-98
>prophage 8
NZ_CP034967	Aeromonas veronii strain ZfB1 chromosome, complete genome	4711383	4548661	4559271	4711383		Bacillus_phage(16.67%)	8	NA	NA
WP_019446511.1|4548661_4549330_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.3	6.7e-27
WP_164537823.1|4549326_4550571_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_005340088.1|4550666_4551563_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.3	7.9e-39
WP_164537824.1|4551794_4555490_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	80.3	7.3e-22
WP_164537825.1|4555706_4556984_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	39.4	7.1e-41
WP_005340085.1|4557490_4557667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164537826.1|4557820_4558318_-	GNAT family N-acetyltransferase	NA	G9BWD5	Planktothrix_phage	28.3	1.7e-06
WP_129504839.1|4558449_4559271_-	HDOD domain-containing protein	NA	A0A1C3NFB0	Phage_NCTB	24.0	2.7e-09
