The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042857	Proteus mirabilis strain 1701092 chromosome, complete genome	4131513	50845	117269	4131513	integrase,terminase,tail,protease,capsid,lysis,portal,holin,head,tRNA,plate	Salmonella_phage(35.71%)	74	70309:70368	100236:100298
WP_017628695.1|50845_51349_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_164527266.1|51360_52527_-	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	57.2	1.7e-118
WP_164527267.1|52987_53986_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_020946542.1|53989_54523_-	acyltransferase	NA	NA	NA	NA	NA
WP_164527268.1|54519_56376_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	28.7	3.5e-33
WP_020946544.1|56388_57390_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_020946545.1|57390_58470_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_020946546.1|58483_59545_-	EpsG family protein	NA	NA	NA	NA	NA
WP_164527269.1|60502_61582_-	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_020946549.1|61593_62994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164527270.1|63058_64588_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_041701731.1|64641_65193_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	59.2	1.1e-54
WP_164527271.1|65192_66092_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	3.3e-109
WP_164527272.1|66672_67212_-	DUF707 domain-containing protein	NA	NA	NA	NA	NA
WP_004246433.1|67361_68750_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	27.3	4.4e-20
WP_004246432.1|68762_69461_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	31.1	8.1e-07
WP_004249721.1|69644_70211_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
70309:70368	attL	GACACCATCCCTGTCTTTTGCAGCCCCTCTGGAGAGGGGCTTTTTTTTATCTATTATATT	NA	NA	NA	NA
WP_124740830.1|70487_71459_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	64.7	7.1e-118
WP_036908544.1|71525_71831_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	49.5	8.4e-17
WP_124740831.1|71935_72226_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	62.5	5.1e-32
WP_049220106.1|72227_72416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157849310.1|72412_72562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049220105.1|72570_72966_+	DUF5347 family protein	NA	NA	NA	NA	NA
WP_164527273.1|72984_73242_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_129623451.1|73234_73456_+	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	52.1	2.6e-12
WP_087726417.1|73457_73766_+	DUF3850 domain-containing protein	NA	A0A218M496	Shigella_phage	41.1	6.5e-09
WP_164527274.1|73765_74593_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	47.1	5.7e-60
WP_012368206.1|74592_74916_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_164527275.1|74915_77294_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	47.2	1.6e-163
WP_164527276.1|77500_78184_+	hypothetical protein	NA	V9IQL5	Stenotrophomonas_phage	32.2	7.9e-15
WP_164527277.1|78185_78560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164527278.1|78972_80001_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	67.8	6.1e-136
WP_087726283.1|80000_81755_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	73.4	1.8e-260
WP_049256947.1|81927_82737_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	48.4	6.8e-66
WP_113976853.1|82752_83898_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	67.2	8.9e-128
WP_164527279.1|83897_84569_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	46.6	7.2e-45
WP_109397510.1|84643_85099_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	45.9	8.4e-29
WP_109397509.1|85098_85305_+|tail	phage tail protein	tail	S4TTA0	Salmonella_phage	54.4	9.0e-15
WP_109397508.1|85324_85639_+|holin	holin	holin	NA	NA	NA	NA
WP_164527280.1|85625_86036_+	M15 family metallopeptidase	NA	K4F776	Cronobacter_phage	58.9	1.1e-40
WP_109397506.1|86032_86536_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	30.1	4.2e-05
WP_164527281.1|86510_86951_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	47.8	1.2e-32
WP_164527282.1|86937_87573_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	35.8	2.6e-28
WP_164527283.1|87638_88265_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	60.1	4.8e-59
WP_071233987.1|88261_88600_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	50.5	3.8e-26
WP_164527284.1|88599_89508_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	66.9	4.8e-108
WP_164527285.1|89500_90112_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	68.4	7.2e-76
WP_121910117.1|91591_91945_+|tail	phage tail protein	tail	A0A218M4J2	Erwinia_phage	43.7	1.7e-08
WP_164527286.1|92037_93210_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	71.1	1.1e-165
WP_164527287.1|93213_93729_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	57.9	3.5e-55
WP_052124640.1|93748_94096_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	56.8	3.5e-19
WP_075204427.1|94056_94230_+|tail	GpE family phage tail protein	tail	A0A2I8TV82	Erwinia_phage	50.9	1.6e-09
WP_164527288.1|94222_97057_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	40.0	4.5e-112
WP_036907694.1|97056_97521_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	61.4	3.3e-41
WP_036908496.1|97520_98618_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	56.2	3.3e-111
WP_012368178.1|98670_98889_+	positive regulator of phage late gene transcription	NA	Q53ZE7	Salmonella_virus	70.3	1.7e-19
WP_036908495.1|99332_100040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049199266.1|100348_101134_-	glycosyltransferase family 25 protein	NA	A0A1V0SAA0	Catovirus	25.7	3.8e-05
100236:100298	attR	GACACCATCCCTGTCTTTTGCAGCCCCTCTGGAGAGGGGCTTTTTTTTATCTATTATATTTTA	NA	NA	NA	NA
WP_164527289.1|101201_102356_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_012368674.1|102565_103321_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_004246429.1|103854_104832_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_046334940.1|105126_106131_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017628681.1|106226_106997_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_004249899.1|107103_107739_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_004249714.1|107850_108279_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_004249898.1|108339_109086_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_004246423.1|109424_110609_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	24.2	2.0e-13
WP_004246422.1|110719_112252_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_004246421.1|112294_113110_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	28.4	2.9e-16
WP_012368679.1|113406_113649_+	cell division protein ZapB	NA	NA	NA	NA	NA
WP_004246419.1|113742_114261_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_004249712.1|114369_115287_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_004246417.1|115385_116726_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	27.1	8.7e-42
WP_004246416.1|116738_117269_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 2
NZ_CP042857	Proteus mirabilis strain 1701092 chromosome, complete genome	4131513	1099225	1111181	4131513		Mycobacterium_phage(25.0%)	13	NA	NA
WP_004247426.1|1099225_1100425_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_004247427.1|1101034_1102003_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
WP_004252248.1|1102028_1104155_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_004246072.1|1104183_1104588_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004246071.1|1104599_1104824_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246069.1|1105105_1105579_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|1105776_1105986_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246065.1|1106170_1106311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246058.1|1107054_1107429_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246057.1|1107444_1108410_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246056.1|1108511_1109156_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026090527.1|1109507_1109771_-	YbeD family protein	NA	NA	NA	NA	NA
WP_004246054.1|1109969_1111181_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
>prophage 3
NZ_CP042857	Proteus mirabilis strain 1701092 chromosome, complete genome	4131513	1310438	1387909	4131513	tRNA,protease,plate	Bacillus_phage(25.0%)	56	NA	NA
WP_004244558.1|1310438_1310753_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_164527401.1|1310783_1313078_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.7e-170
WP_004244560.1|1313197_1313416_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_049203584.1|1313735_1314428_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004244562.1|1314429_1316181_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.8	4.0e-18
WP_017628444.1|1316183_1317953_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_004244564.1|1318094_1319054_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	9.0e-65
WP_004244566.1|1319597_1320092_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_164527402.1|1320219_1324086_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.1	1.9e-89
WP_004244569.1|1324198_1324804_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_164527727.1|1324814_1326164_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.3	1.4e-79
WP_004244571.1|1326297_1327587_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
WP_004244572.1|1327766_1328099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049208319.1|1328498_1329548_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_004244574.1|1329620_1330526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244575.1|1330883_1331624_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244576.1|1331731_1334014_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244577.1|1334068_1334923_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_036971369.1|1335592_1337350_-	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_004244579.1|1337577_1338615_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_012367709.1|1338689_1339958_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017628442.1|1340094_1341525_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	25.1	4.4e-07
WP_004244582.1|1341661_1342750_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_004244584.1|1342946_1344233_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_020945417.1|1344521_1345199_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004244586.1|1345380_1347054_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|1347118_1347406_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_161734693.1|1347816_1350186_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.3	3.6e-22
WP_049213550.1|1350222_1351968_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_012367713.1|1351964_1352966_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|1353461_1353677_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|1354091_1354271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|1354275_1355037_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017827043.1|1355160_1355991_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004244596.1|1356370_1357144_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|1357153_1358476_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004247634.1|1358456_1359188_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_164527403.1|1359184_1363648_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_004247637.1|1363872_1364586_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_004244603.1|1364928_1366644_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004244605.1|1366975_1367524_+	YcbK family protein	NA	NA	NA	NA	NA
WP_004247640.1|1367573_1368224_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|1368316_1368790_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_164527404.1|1368880_1370617_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004244609.1|1370609_1371965_-	membrane protein	NA	NA	NA	NA	NA
WP_004244610.1|1372002_1375551_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004244611.1|1375553_1377017_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_164527405.1|1377022_1377673_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|1377674_1378463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164527406.1|1378466_1381190_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	4.2e-83
WP_164527407.1|1381198_1381954_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_026164596.1|1381946_1383305_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244619.1|1383306_1383858_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004247648.1|1383859_1385128_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_164527408.1|1385132_1386170_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_017628432.1|1386133_1387909_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 4
NZ_CP042857	Proteus mirabilis strain 1701092 chromosome, complete genome	4131513	1446003	1559658	4131513	integrase,tail,terminase,tRNA,capsid,holin,head,lysis,transposase	Morganella_phage(22.83%)	152	1518507:1518566	1560149:1560251
WP_164527414.1|1446003_1448055_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.1	8.7e-17
WP_004244689.1|1448059_1448518_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_164527415.1|1448657_1449071_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_036896040.1|1449135_1449453_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_004244692.1|1449655_1449940_+	acylphosphatase	NA	NA	NA	NA	NA
WP_004244693.1|1449942_1450272_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_071425905.1|1450714_1451899_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	57.3	2.8e-132
WP_063693452.1|1451902_1452109_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.8	8.7e-10
WP_142836745.1|1452320_1452923_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	58.1	2.7e-59
WP_096043071.1|1452909_1453266_-	DUF2591 family protein	NA	K7PH48	Enterobacterial_phage	33.9	2.3e-10
WP_156868475.1|1453258_1453426_-	hypothetical protein	NA	A0A1P8DTF6	Proteus_phage	96.2	1.5e-23
WP_063073714.1|1453573_1453942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073715.1|1453951_1454305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060558090.1|1454304_1454592_-	hypothetical protein	NA	A0A1B0UY37	Roseobacter_phage	41.9	5.3e-13
WP_164527416.1|1454681_1455179_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	80.3	1.7e-54
WP_081213867.1|1455168_1455867_-	YqaJ viral recombinase family protein	NA	A0A2R2Z325	Escherichia_phage	57.3	9.1e-75
WP_164527417.1|1455863_1456748_-	recombinase RecT	NA	A0A2L1IV84	Escherichia_phage	62.2	1.0e-94
WP_164527418.1|1456744_1456996_-	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	91.6	2.1e-37
WP_102086776.1|1456992_1457268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164527419.1|1457488_1458397_-	cell envelope biogenesis protein TolA	NA	A0A2I7QK72	Vibrio_phage	46.6	1.1e-19
WP_164527247.1|1458480_1458714_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	44.2	6.8e-11
WP_164527420.1|1458749_1459010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049220847.1|1459177_1459459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049220845.1|1459430_1459667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036970054.1|1459681_1459951_-	hypothetical protein	NA	A0A1P8DTK1	Proteus_phage	72.5	6.2e-24
WP_149127671.1|1460541_1460886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163769788.1|1461097_1461808_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	61.7	1.2e-79
WP_036895075.1|1461903_1462089_+	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	58.3	2.3e-09
WP_049220837.1|1462223_1462550_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	79.6	6.2e-42
WP_124740876.1|1462660_1463347_+	phage regulatory protein/antirepressor Ant	NA	A0A1P8DTE1	Proteus_phage	66.4	1.5e-74
WP_053091416.1|1463343_1464054_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	77.3	2.5e-32
WP_164527421.1|1464050_1464725_+	DNA replication protein	NA	A0A1P8DTF3	Proteus_phage	86.2	1.7e-110
WP_036905413.1|1464742_1464973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164527422.1|1464992_1465196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164527423.1|1466083_1466263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105874342.1|1466262_1466493_+	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	75.4	8.2e-25
WP_164527424.1|1466485_1466641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164527425.1|1466661_1466838_+	hypothetical protein	NA	U5P451	Shigella_phage	45.5	7.7e-07
WP_164527426.1|1466834_1467047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164527427.1|1467043_1467706_+	serine/threonine-protein phosphatase	NA	A0A2D1GLI5	Escherichia_phage	61.4	2.8e-73
WP_164527428.1|1467979_1468600_+	hypothetical protein	NA	A0A2I7RAC0	Vibrio_phage	53.1	8.7e-45
WP_036935854.1|1468599_1468791_+	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	85.7	8.9e-25
WP_164527429.1|1468922_1469426_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	38.1	1.8e-24
WP_036906009.1|1469934_1470231_+|holin	holin	holin	E7C9S8	Salmonella_phage	45.4	1.0e-19
WP_088207137.1|1470227_1470632_+	structural protein	NA	A0A2I7RXE2	Vibrio_phage	50.0	8.5e-25
WP_164527430.1|1470628_1471081_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	82.6	1.2e-54
WP_161748289.1|1471077_1471446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905457.1|1471906_1472689_+	DNA-binding protein	NA	K7PH51	Enterobacterial_phage	43.4	4.2e-52
WP_036905461.1|1472669_1473029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245977.1|1473201_1473810_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	69.6	4.4e-65
WP_036895049.1|1473812_1475297_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	88.7	3.6e-270
WP_109937969.1|1475298_1476675_+	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	79.5	4.8e-213
WP_121909317.1|1476683_1477748_+|capsid	minor capsid protein	capsid	A0A1W6JNT7	Morganella_phage	51.4	1.9e-103
WP_036971534.1|1477822_1478509_+	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	81.5	1.2e-74
WP_036971536.1|1478514_1479465_+	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	87.5	7.8e-154
WP_017628798.1|1479507_1479885_+	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	71.2	5.8e-44
WP_049199091.1|1479886_1480228_+	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	80.5	1.4e-52
WP_071425411.1|1480230_1480599_+	HK97 gp10 family phage protein	NA	A0A1W6JNX7	Morganella_phage	85.2	5.1e-53
WP_060554538.1|1480595_1480967_+	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	71.5	6.6e-48
WP_164527431.1|1481032_1481788_+	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	78.9	1.4e-105
WP_164527432.1|1481837_1482530_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	71.9	9.0e-91
WP_164527433.1|1482599_1482938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164527434.1|1483286_1484090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164527435.1|1484098_1484536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060556273.1|1484673_1485396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164527436.1|1485463_1485913_+	hypothetical protein	NA	A0A291AXC6	Shigella_phage	31.6	8.3e-05
WP_000813355.1|1485901_1487173_-|transposase	IS4-like element ISPa13 family transposase	transposase	NA	NA	NA	NA
WP_164527437.1|1487431_1490008_+	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	52.8	2.1e-100
WP_159298405.1|1490023_1490305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905509.1|1490272_1490590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063109161.1|1490736_1491066_+|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	72.5	7.3e-43
WP_036971552.1|1491062_1491761_+|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	84.1	4.8e-116
WP_164527438.1|1491764_1492484_+|tail	phage tail protein	tail	A0A1W6JNU8	Morganella_phage	74.5	2.8e-111
WP_049199070.1|1492420_1492987_+|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	77.4	1.4e-49
WP_164527439.1|1492986_1496433_+|tail	phage tail protein	tail	A0A1W6JNW2	Morganella_phage	63.0	0.0e+00
WP_058336219.1|1496435_1497476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164527440.1|1497520_1498981_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	55.9	2.8e-118
WP_164527441.1|1499073_1499379_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_049211401.1|1499769_1499961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164527442.1|1500034_1500265_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	90.8	3.4e-31
WP_164527443.1|1500672_1501203_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049255078.1|1501437_1501782_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_036908195.1|1501784_1502117_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_036908193.1|1502472_1503417_+	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	45.3	1.3e-07
WP_004247011.1|1503416_1503722_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_164527444.1|1503866_1504763_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036908191.1|1504819_1505623_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	39.1	1.1e-42
WP_164527445.1|1506184_1507681_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_164527446.1|1507759_1508656_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004247019.1|1509007_1509340_+	MliC family protein	NA	NA	NA	NA	NA
WP_164527447.1|1509634_1510492_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004247021.1|1510905_1511118_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	81.4	1.1e-26
WP_017827330.1|1511574_1512501_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	65.5	2.7e-98
WP_004247023.1|1512768_1513524_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012367748.1|1513669_1514170_+	membrane protein	NA	NA	NA	NA	NA
WP_004247025.1|1514458_1514617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247793.1|1515070_1515247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247794.1|1515423_1516170_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004247795.1|1516171_1516420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367750.1|1517020_1517599_+	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_129623476.1|1517711_1518338_-	LysE family translocator	NA	NA	NA	NA	NA
1518507:1518566	attL	GCAAATTCCAGACATAAAAAAACCAACCGTAAGTGGTTGGTTTTCTTAAATAAAAATGGT	NA	NA	NA	NA
WP_152964544.1|1519027_1519909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060557151.1|1521223_1522399_-|integrase	site-specific integrase	integrase	A0A2D1GN00	Marinobacter_phage	32.2	5.5e-32
WP_152964545.1|1522400_1522613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164527448.1|1523027_1523198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250516.1|1523225_1523405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074924453.1|1523452_1523953_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	56.4	2.1e-41
WP_150452763.1|1523952_1525920_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	39.1	1.0e-115
WP_004250523.1|1525932_1526193_-	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	45.3	7.9e-08
WP_036908171.1|1526192_1526525_-	hypothetical protein	NA	H9C158	Pectobacterium_phage	39.2	2.1e-05
WP_074924455.1|1527080_1527863_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_074924456.1|1527921_1528575_-	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	67.0	7.7e-76
WP_074924457.1|1528656_1528842_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	49.2	5.1e-09
WP_074924458.1|1528921_1529377_+|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	54.7	3.8e-29
WP_004250533.1|1529394_1529619_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	55.4	9.5e-18
WP_053087953.1|1529620_1530451_+	hypothetical protein	NA	H9C164	Pectobacterium_phage	59.3	4.4e-36
WP_041701082.1|1530440_1531859_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	61.2	1.4e-170
WP_049210194.1|1531913_1532090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335187.1|1532092_1532326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250545.1|1532322_1532934_+	hypothetical protein	NA	H2BDG4	Pseudomonas_virus	48.0	7.0e-47
WP_046335186.1|1532979_1533318_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	57.9	8.7e-31
WP_152964547.1|1533395_1533989_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	55.3	6.6e-58
WP_109910691.1|1534000_1534312_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	69.8	2.6e-34
WP_109910690.1|1534346_1534898_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	44.9	7.5e-32
WP_109910689.1|1535013_1535928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250558.1|1536237_1536507_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	47.8	3.3e-17
WP_104836572.1|1536506_1536977_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	57.5	2.9e-48
WP_109910688.1|1537119_1537584_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	76.0	1.0e-45
WP_109910687.1|1538171_1539182_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	37.0	8.3e-37
WP_164527449.1|1539389_1540994_+	TerL protein	NA	A9YWZ6	Burkholderia_phage	64.1	1.2e-199
WP_088206688.1|1540998_1542501_+	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	42.0	6.0e-100
WP_049197370.1|1542538_1543252_+|head	head protein	head	A0A2H5BG15	Pseudoalteromonas_phage	35.6	7.9e-34
WP_087726615.1|1543248_1544508_+	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	51.3	1.2e-45
WP_049209851.1|1544507_1545005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250578.1|1545004_1546072_+	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	39.3	1.1e-52
WP_109023906.1|1546141_1546483_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	35.5	2.7e-08
WP_082151820.1|1546485_1546917_+	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	32.4	1.5e-11
WP_049256452.1|1546916_1547375_+	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	39.6	1.1e-12
WP_020945484.1|1547374_1547746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109910684.1|1547732_1548248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164527450.1|1548256_1549744_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.3	1.3e-81
WP_004250586.1|1549754_1550207_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.1	5.8e-22
WP_004250588.1|1550247_1550706_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	6.7e-26
WP_164527451.1|1550789_1553084_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	28.7	2.6e-17
WP_164527452.1|1553080_1553608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164527453.1|1553607_1553925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164527454.1|1553890_1554625_+	hypothetical protein	NA	A1Z005	Burkholderia_virus	36.7	1.9e-06
WP_049197352.1|1554627_1555320_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	39.4	9.1e-35
WP_004250600.1|1555316_1555661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164527455.1|1555653_1556841_+	hypothetical protein	NA	Q6IWQ3	Burkholderia_phage	40.6	2.6e-69
WP_004250603.1|1556837_1557494_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.3	7.5e-39
WP_049199848.1|1558872_1559658_-	glycosyltransferase family 25 protein	NA	A0A1V0SAA0	Catovirus	27.5	4.5e-06
1560149:1560251	attR	GCAAATTCCAGACATAAAAAAACCAACCGTAAGTGGTTGGTTTTCTTAAATAAAAATGGTCGGCATGATAGGATTTGAACCTACGACCCCTGACACCCCATGA	NA	NA	NA	NA
>prophage 5
NZ_CP042857	Proteus mirabilis strain 1701092 chromosome, complete genome	4131513	1880635	1890627	4131513		Escherichia_phage(66.67%)	8	NA	NA
WP_004242885.1|1880635_1882693_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	4.8e-31
WP_036894912.1|1882704_1884405_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004242887.1|1884740_1885427_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004242888.1|1885426_1885888_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
WP_004242890.1|1885940_1886552_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	7.3e-28
WP_004242891.1|1886691_1887552_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.5	3.7e-25
WP_004242892.1|1887553_1888171_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_164527499.1|1888182_1890627_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.2	4.7e-219
>prophage 6
NZ_CP042857	Proteus mirabilis strain 1701092 chromosome, complete genome	4131513	2411009	2430019	4131513	holin,lysis	Burkholderia_phage(26.67%)	22	NA	NA
WP_012368081.1|2411009_2413448_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
WP_004243609.1|2413459_2414077_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_004243611.1|2414080_2414857_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004243612.1|2414972_2415515_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.9e-19
WP_017628013.1|2416083_2416263_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_164527557.1|2416523_2417777_-	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	34.1	2.5e-14
WP_004243615.1|2417782_2418439_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.9	2.3e-35
WP_017628010.1|2418435_2419623_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
WP_004243617.1|2419615_2419960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368086.1|2419956_2420649_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	37.1	1.6e-34
WP_164527558.1|2420651_2421464_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	1.2e-41
WP_004243623.1|2421432_2421753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250719.1|2421765_2422254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049198725.1|2422256_2424560_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.1	2.0e-14
WP_004243627.1|2424642_2425101_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_012368088.1|2425160_2425613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164527559.1|2425623_2427111_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.9	1.9e-77
WP_004248364.1|2427119_2427632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895256.1|2427668_2428118_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_094959519.1|2428114_2428519_-	structural protein	NA	A0A1B1IQT0	uncultured_Mediterranean_phage	40.8	3.5e-18
WP_004248367.1|2428521_2428821_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_094959520.1|2429203_2430019_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.3	7.2e-55
>prophage 7
NZ_CP042857	Proteus mirabilis strain 1701092 chromosome, complete genome	4131513	3193579	3202452	4131513		Caulobacter_phage(50.0%)	9	NA	NA
WP_004245601.1|3193579_3195148_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_004245602.1|3195547_3196228_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_164527630.1|3196324_3196900_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	39.8	3.4e-27
WP_004249446.1|3196976_3197555_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004249445.1|3197622_3198648_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|3198682_3199138_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_164527631.1|3199162_3200329_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_004245609.1|3200329_3200914_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_049212248.1|3201306_3202452_+	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	26.9	4.5e-31
>prophage 8
NZ_CP042857	Proteus mirabilis strain 1701092 chromosome, complete genome	4131513	3264612	3308845	4131513	integrase,transposase	Escherichia_phage(47.06%)	45	3265961:3266020	3309150:3309212
WP_004574636.1|3264612_3265902_+|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	9.5e-86
3265961:3266020	attL	AAAATAATAAAAGCAGACTTGACCTGATAGTTTGGCTGTGAGCAATTATGTGCTTAGTGC	NA	NA	NA	NA
WP_001261740.1|3266081_3266873_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
3265961:3266020	attL	AAAATAATAAAAGCAGACTTGACCTGATAGTTTGGCTGTGAGCAATTATGTGCTTAGTGC	NA	NA	NA	NA
WP_032084014.1|3266957_3268178_-	EreA family erythromycin esterase	NA	NA	NA	NA	NA
WP_032084013.1|3268370_3268844_-	trimethoprim-resistant dihydrofolate reductase DfrA32	NA	A0A1B2IBQ4	Erwinia_phage	33.1	6.5e-16
WP_015057121.1|3269001_3269961_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001067855.1|3269851_3270556_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000184001.1|3270709_3271915_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|3272070_3272274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|3272361_3273066_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_063102497.1|3273259_3273646_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_000084745.1|3273965_3274358_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_001067858.1|3274553_3275258_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_124743826.1|3275421_3276261_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3276254_3276602_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|3276824_3277277_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
3276645:3276715	attR	AAAATAATAAAAGCAGACTTGACCTGATAGTTTGGCTGTGAGCAATTATGTGCTTAGTGCATCTAACGCCG	NA	NA	NA	NA
WP_000186237.1|3277361_3277994_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
3276645:3276715	attR	AAAATAATAAAAGCAGACTTGACCTGATAGTTTGGCTGTGAGCAATTATGTGCTTAGTGCATCTAACGCCG	NA	NA	NA	NA
WP_001334766.1|3278131_3278962_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|3279092_3279647_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|3279790_3280495_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|3280608_3281385_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_164527634.1|3281613_3282639_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|3283060_3283813_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_061456197.1|3285623_3286109_+	phenol hydroxylase	NA	NA	NA	NA	NA
WP_085940648.1|3286305_3287396_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|3287485_3288301_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|3288387_3288690_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|3288583_3288835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344975.1|3288865_3290359_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|3290470_3290776_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|3290803_3292018_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|3292234_3293119_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067784.1|3294043_3294748_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_046788546.1|3294832_3295234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124785907.1|3295242_3298194_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.4	0.0e+00
WP_001067858.1|3298575_3299280_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000434930.1|3299877_3300504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342101.1|3300906_3301029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164527635.1|3301008_3301884_+	CTX-M family class A extended-spectrum beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	98.6	2.0e-151
WP_013362812.1|3301918_3302887_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001067855.1|3304637_3305342_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001038045.1|3306174_3306834_-	tetracycline resistance transcriptional repressor TetR(C)	NA	NA	NA	NA	NA
WP_053409934.1|3306926_3308117_+	tetracycline efflux MFS transporter Tet(C)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.0	8.1e-07
WP_002310911.1|3308020_3308359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071533317.1|3308355_3308541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000015696.1|3308566_3308845_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3309150:3309212	attR	GGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCA	NA	NA	NA	NA
>prophage 9
NZ_CP042857	Proteus mirabilis strain 1701092 chromosome, complete genome	4131513	3882537	3892300	4131513	integrase	Enterobacteria_phage(100.0%)	12	3882221:3882240	3892462:3892481
3882221:3882240	attL	TGGCGGAAGATCACAGGAGT	NA	NA	NA	NA
WP_071425248.1|3882537_3884871_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.2	0.0e+00
WP_071425247.1|3884885_3885206_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_064162286.1|3885202_3885430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071425246.1|3885426_3885978_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	67.2	8.6e-36
WP_071425245.1|3885974_3886241_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	7.5e-30
WP_164527697.1|3886345_3886483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071425244.1|3886780_3887518_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	64.9	1.3e-79
WP_007900390.1|3887514_3887760_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	76.5	8.2e-31
WP_064162289.1|3887776_3888343_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	61.1	3.2e-54
WP_071888955.1|3888797_3890285_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_132587622.1|3890285_3891017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164527698.1|3891127_3892300_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	93.0	2.3e-211
3892462:3892481	attR	TGGCGGAAGATCACAGGAGT	NA	NA	NA	NA
>prophage 10
NZ_CP042857	Proteus mirabilis strain 1701092 chromosome, complete genome	4131513	3989497	4095850	4131513	transposase,tRNA,protease,integrase	Escherichia_phage(37.5%)	88	4009211:4009225	4040910:4040924
WP_004246556.1|3989497_3990082_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_004246555.1|3990176_3991088_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_049203066.1|3992531_3992927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164527710.1|3993074_3995189_+	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_164527711.1|3995191_3997540_+	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_164527712.1|3997550_4001237_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_164527713.1|4001252_4001723_+	cellulose biosynthesis protein	NA	NA	NA	NA	NA
WP_004246548.1|4001761_4002667_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_164527714.1|4002840_4003803_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	44.7	9.6e-59
WP_049199575.1|4003876_4004905_+	endoglucanase	NA	NA	NA	NA	NA
WP_012368625.1|4005053_4006703_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_164527715.1|4006811_4008674_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.0	8.2e-14
WP_004249787.1|4008670_4010062_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
4009211:4009225	attL	CTGTTGCAAATAGTC	NA	NA	NA	NA
WP_004246539.1|4010077_4010998_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_004246538.1|4011196_4011853_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_004246537.1|4011849_4012788_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_080633831.1|4012799_4015847_-	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_004246534.1|4016026_4016857_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_164527716.1|4017016_4017892_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_164527717.1|4018183_4018726_-	flagellar protein	NA	NA	NA	NA	NA
WP_004246525.1|4018939_4019911_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_004249779.1|4020035_4020923_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004249956.1|4021336_4022149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164527718.1|4022323_4023676_+	DUF560 domain-containing protein	NA	NA	NA	NA	NA
WP_164527719.1|4023720_4026774_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_164527720.1|4026801_4027605_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_004249953.1|4027658_4029620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246518.1|4029651_4030581_-	phosphoesterase	NA	NA	NA	NA	NA
WP_004249773.1|4030765_4031230_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_004249772.1|4031632_4032946_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_004249771.1|4032946_4033204_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001145449.1|4033479_4034109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|4034456_4035221_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000376623.1|4035727_4036228_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000777554.1|4038242_4038716_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000845039.1|4038872_4039886_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|4040160_4040865_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|4041097_4041958_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
4040910:4040924	attR	GACTATTTGCAACAG	NA	NA	NA	NA
WP_000587837.1|4041970_4042513_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|4042994_4043186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|4043209_4043437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|4043487_4044624_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_014342212.1|4044590_4044740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000971921.1|4044738_4046109_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_014342213.1|4046250_4046376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|4046929_4047790_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001387387.1|4047939_4048341_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_002210549.1|4048765_4049107_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	7.3e-62
WP_002210549.1|4049143_4049485_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	7.3e-62
WP_001067855.1|4049521_4050226_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_052259183.1|4050877_4051783_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(42)	NA	NA	NA	NA	NA
WP_000813355.1|4052085_4053357_+|transposase	IS4-like element ISPa13 family transposase	transposase	NA	NA	NA	NA
WP_052259184.1|4053570_4054308_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|4054304_4054529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|4054739_4056233_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_021598067.1|4056263_4057148_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_164527721.1|4057364_4058579_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001255015.1|4058606_4058912_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|4061264_4061969_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001235713.1|4062815_4063373_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|4063555_4064416_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|4064585_4065341_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_014342204.1|4065421_4065970_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_014342205.1|4066005_4066383_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	58.1	8.2e-22
WP_012372820.1|4066609_4068142_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001253717.1|4068233_4069025_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001257840.1|4069045_4070221_-	tetracycline efflux MFS transporter Tet(G)	NA	NA	NA	NA	NA
WP_000163574.1|4070324_4070951_+	tetracycline resistance transcriptional repressor TetR(G)	NA	NA	NA	NA	NA
WP_001747812.1|4070947_4071130_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214125.1|4071157_4072372_-	chloramphenicol/florfenicol efflux MFS transporter FloR2	NA	S4TR35	Salmonella_phage	23.7	9.8e-16
WP_000259026.1|4072588_4073560_-	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_052238321.1|4073553_4073889_-	ethidium bromide resistance protein	NA	NA	NA	NA	NA
WP_025999322.1|4073781_4074147_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_004193231.1|4074150_4075026_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012579084.1|4075211_4075868_-	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
WP_164527722.1|4076131_4077673_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|4078077_4078917_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4078910_4079258_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|4079480_4079933_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_052238321.1|4085321_4085657_-	ethidium bromide resistance protein	NA	NA	NA	NA	NA
WP_025999322.1|4085549_4085915_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_004193231.1|4085918_4086794_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012579084.1|4086979_4087636_-	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
WP_164527722.1|4087899_4089441_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001749986.1|4091255_4091708_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_004201164.1|4092450_4093263_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|4093266_4093632_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|4094308_4095850_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
