The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042858	Klebsiella pneumoniae strain QD23 chromosome, complete genome	5803733	1178417	1187864	5803733	integrase	Enterobacteria_phage(85.71%)	10	1178176:1178189	1187884:1187897
1178176:1178189	attL	AAGCGTATACCAAT	NA	NA	NA	NA
WP_048988794.1|1178417_1180751_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.4	0.0e+00
WP_048988792.1|1180765_1181086_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_021536582.1|1181082_1181310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162887248.1|1181306_1181852_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	3.0e-33
WP_048988791.1|1181854_1182121_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_048988789.1|1182670_1183408_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	66.1	6.9e-81
WP_048988787.1|1183404_1183650_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	77.8	3.7e-31
WP_048988786.1|1183666_1184233_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	1.5e-56
WP_064152055.1|1184747_1186640_+	AIPR family protein	NA	NA	NA	NA	NA
WP_048986916.1|1186676_1187864_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	51.0	2.4e-107
1187884:1187897	attR	ATTGGTATACGCTT	NA	NA	NA	NA
>prophage 2
NZ_CP042858	Klebsiella pneumoniae strain QD23 chromosome, complete genome	5803733	1304169	1342272	5803733	terminase,tail,integrase	Salmonella_phage(34.09%)	49	1301596:1301611	1329004:1329019
1301596:1301611	attL	CGCTGCTGGCGCCGCC	NA	NA	NA	NA
WP_004151980.1|1304169_1305636_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1305703_1307281_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_064151765.1|1307472_1308723_+|integrase	site-specific integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.1	6.8e-206
WP_064151764.1|1308739_1308931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064106736.1|1308927_1309521_-	adenine methylase	NA	T1SA14	Salmonella_phage	91.4	3.7e-109
WP_071556204.1|1309517_1309676_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	80.8	5.1e-18
WP_023339275.1|1309668_1309962_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004144294.1|1310071_1310320_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_064106735.1|1310368_1311250_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	6.8e-136
WP_064151763.1|1311246_1312068_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.6	6.2e-131
WP_064151762.1|1312067_1312352_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	44.0	2.4e-10
WP_032439434.1|1312348_1312648_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	4.7e-20
WP_064151761.1|1312655_1313723_-	hypothetical protein	NA	A0A2H4JIB1	uncultured_Caudovirales_phage	74.8	3.2e-39
WP_162887241.1|1313719_1313869_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	2.3e-12
WP_048264076.1|1314087_1314669_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	2.1e-64
WP_004152538.1|1314822_1315056_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_064151760.1|1315202_1315412_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.4e-26
WP_040025502.1|1315411_1316173_+	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	90.2	1.6e-136
WP_032418532.1|1316169_1316955_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_064151759.1|1317074_1317422_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	83.5	1.7e-50
WP_064151780.1|1317614_1318154_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	41.9	1.5e-08
WP_064151758.1|1318430_1319192_+	ead/Ea22-like family protein	NA	C6ZR30	Salmonella_phage	65.2	6.8e-07
WP_064151757.1|1319188_1319368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064151756.1|1319364_1320108_+	hypothetical protein	NA	K7P7E4	Enterobacteria_phage	56.6	3.3e-14
WP_064151755.1|1320192_1320432_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	1.9e-08
WP_064151753.1|1320660_1320999_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	88.2	1.9e-49
WP_064151779.1|1321073_1321331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064151752.1|1321408_1321993_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	89.1	1.3e-90
WP_064151751.1|1321989_1323465_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.5	1.9e-279
WP_064151750.1|1323476_1323749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064151749.1|1323834_1324200_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	95.9	5.1e-61
WP_004141368.1|1324899_1325106_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_064151748.1|1325120_1326803_+|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	2.5e-264
WP_042632452.1|1326799_1327096_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	9.6e-34
WP_064151747.1|1327098_1327788_+	peptidase	NA	G9L6C4	Escherichia_phage	69.6	2.9e-65
WP_064151746.1|1327802_1328789_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.6	3.3e-179
WP_020953461.1|1328842_1329280_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
1329004:1329019	attR	CGCTGCTGGCGCCGCC	NA	NA	NA	NA
WP_064151745.1|1329290_1329632_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	71.9	1.1e-36
WP_004152441.1|1329682_1330006_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_064151744.1|1330005_1330611_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	79.0	3.3e-89
WP_064151743.1|1330610_1333088_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.2	0.0e+00
WP_004152438.1|1333087_1333552_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_064151742.1|1333551_1334091_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	79.4	3.0e-70
WP_064151741.1|1334101_1336915_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	93.3	0.0e+00
WP_064151740.1|1336911_1338717_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	73.3	1.7e-237
WP_064106698.1|1338720_1341195_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	87.0	0.0e+00
WP_004200533.1|1341393_1341690_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	94.8	4.4e-47
WP_072310952.1|1341724_1341877_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	3.3e-14
WP_004200532.1|1341975_1342272_-	hypothetical protein	NA	T1SA06	Salmonella_phage	65.1	2.4e-24
>prophage 3
NZ_CP042858	Klebsiella pneumoniae strain QD23 chromosome, complete genome	5803733	1688566	1695473	5803733	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_064151778.1|1688566_1689430_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.0	4.8e-09
WP_004899467.1|1689440_1690214_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|1690456_1691353_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1691595_1692957_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004201558.1|1693275_1693998_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_019705218.1|1693994_1695473_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 4
NZ_CP042858	Klebsiella pneumoniae strain QD23 chromosome, complete genome	5803733	1737036	1745432	5803733		Enterobacteria_phage(28.57%)	8	NA	NA
WP_015958700.1|1737036_1738443_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.9	1.6e-38
WP_015958698.1|1738684_1739749_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.1	6.4e-104
WP_060611727.1|1739775_1740645_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	7.5e-111
WP_004189149.1|1740676_1741567_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_021313307.1|1741581_1742136_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_004152483.1|1742316_1743483_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_060611729.1|1743906_1744029_-	small membrane protein	NA	NA	NA	NA	NA
WP_004149013.1|1744427_1745432_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.0e-31
>prophage 5
NZ_CP042858	Klebsiella pneumoniae strain QD23 chromosome, complete genome	5803733	2653002	2662417	5803733		Escherichia_phage(87.5%)	8	NA	NA
WP_162887244.1|2653002_2654637_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.8	4.0e-182
WP_064152923.1|2655987_2657076_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.4	2.0e-209
WP_004176262.1|2657162_2657423_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|2657720_2658581_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|2658601_2659363_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_164529522.1|2659624_2660527_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	98.0	1.2e-156
WP_064152921.1|2660538_2661804_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.0	1.5e-232
WP_002210516.1|2661796_2662417_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 6
NZ_CP042858	Klebsiella pneumoniae strain QD23 chromosome, complete genome	5803733	2941888	2960161	5803733	capsid,integrase,protease,transposase	Escherichia_phage(50.0%)	23	2935000:2935016	2967107:2967123
2935000:2935016	attL	GGTAAGGCGTCAGGCCG	NA	NA	NA	NA
WP_002901758.1|2941888_2942935_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_004225168.1|2942979_2943180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196459.1|2943189_2943951_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	1.2e-08
WP_002901749.1|2943947_2944538_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_002901746.1|2944598_2945501_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_162887245.1|2946085_2947936_-	hypothetical protein	NA	A0A1D7XFE4	Escherichia_phage	31.7	2.0e-65
WP_064151910.1|2947935_2948124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064151911.1|2948226_2949258_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_164529496.1|2949276_2949480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012569499.1|2949505_2950486_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_064151913.1|2950850_2951054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064151914.1|2951607_2951946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064151974.1|2951945_2952170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064151915.1|2952169_2952580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064151917.1|2952985_2953813_-|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_162887246.1|2953870_2954032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071556173.1|2954051_2954234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064151919.1|2955319_2955988_-	adenine methyltransferase	NA	A0A1W6JQI9	Staphylococcus_phage	32.1	1.6e-12
WP_048976334.1|2956692_2957253_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_048976332.1|2957257_2957455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048976330.1|2957541_2957799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048976329.1|2958138_2958429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077265941.1|2958478_2960161_-|integrase	integrase	integrase	NA	NA	NA	NA
2967107:2967123	attR	CGGCCTGACGCCTTACC	NA	NA	NA	NA
>prophage 7
NZ_CP042858	Klebsiella pneumoniae strain QD23 chromosome, complete genome	5803733	3088937	3124764	5803733	protease,tail,holin,portal,terminase,integrase	Klebsiella_phage(23.81%)	50	3088019:3088036	3130745:3130762
3088019:3088036	attL	CGCCGTTCGCATCCTGCC	NA	NA	NA	NA
WP_164529525.1|3088937_3092006_-	kinase	NA	A0A286S259	Klebsiella_phage	97.1	0.0e+00
WP_064151949.1|3092002_3092383_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.0e-72
WP_023343209.1|3092392_3092875_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	97.5	2.5e-84
WP_071961347.1|3092861_3093335_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	60.9	1.7e-53
WP_064151950.1|3093334_3096031_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.9	3.2e-200
WP_032420719.1|3096011_3096329_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
WP_023320799.1|3096349_3096745_-|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	28.2	1.1e-08
WP_023320798.1|3096787_3097270_-	hypothetical protein	NA	M9NYX0	Enterobacteria_phage	69.2	2.6e-60
WP_064151951.1|3097277_3097676_-	hypothetical protein	NA	K7PHM6	Enterobacterial_phage	57.8	6.4e-41
WP_020317346.1|3097672_3098224_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.9	5.3e-54
WP_020317349.1|3098213_3098507_-	sugar ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_064151952.1|3098499_3098826_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	65.4	8.9e-33
WP_074187891.1|3098906_3100922_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.6	0.0e+00
WP_064151954.1|3100866_3102366_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.6	1.1e-247
WP_020317294.1|3102362_3102578_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	77.1	7.7e-25
WP_064151955.1|3102574_3104683_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.2	0.0e+00
WP_014228567.1|3104682_3105174_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	84.0	6.4e-67
WP_072002796.1|3105495_3105681_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	61.1	2.4e-11
WP_108918987.1|3105748_3106009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019705415.1|3106235_3106481_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	97.5	2.1e-34
WP_064151976.1|3106585_3106879_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	72.2	1.5e-31
WP_064151956.1|3107046_3107238_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	83.3	1.0e-20
WP_064151957.1|3107194_3107464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064151958.1|3107460_3107808_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.9	1.0e-39
WP_004884314.1|3107804_3108344_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	99.4	6.7e-102
WP_024940884.1|3108340_3108640_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_064151960.1|3109251_3109698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184721.1|3109603_3109861_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	100.0	1.3e-42
WP_023284967.1|3110405_3111416_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	30.6	1.1e-39
WP_023284966.1|3111428_3111806_-	DUF1133 family protein	NA	U5P0A5	Shigella_phage	77.5	4.9e-51
WP_064151961.1|3111824_3112805_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	1.6e-133
WP_164529526.1|3112817_3113195_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	72.8	2.5e-47
WP_064151962.1|3113204_3114014_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	9.1e-111
WP_064151963.1|3114010_3114925_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	60.6	1.4e-30
WP_074187892.1|3114881_3115094_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	2.2e-16
WP_065806519.1|3115331_3115784_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.8	3.5e-67
WP_074187893.1|3115812_3116028_-	cell division protein	NA	NA	NA	NA	NA
WP_064151965.1|3116122_3116767_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	39.2	2.0e-36
WP_064151966.1|3117517_3118441_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.8	2.0e-106
WP_064151967.1|3118528_3118828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064151968.1|3118827_3119613_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.1	2.0e-62
WP_064151969.1|3119740_3120100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328761.1|3120096_3120303_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	100.0	1.6e-32
WP_064151970.1|3120299_3120869_+	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	27.8	1.2e-05
WP_071885116.1|3120868_3121084_+	molecular chaperone DnaJ	NA	R9TNC2	Aeromonas_phage	95.8	1.0e-37
WP_087759359.1|3121080_3121521_+	hypothetical protein	NA	R9TQX3	Aeromonas_phage	81.7	2.1e-21
WP_040176407.1|3121513_3121732_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	3.5e-09
WP_000089156.1|3122032_3122269_+	excisionase	NA	NA	NA	NA	NA
WP_023316692.1|3122258_3123401_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	82.5	5.3e-173
WP_004150800.1|3123513_3124764_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
3130745:3130762	attR	CGCCGTTCGCATCCTGCC	NA	NA	NA	NA
>prophage 8
NZ_CP042858	Klebsiella pneumoniae strain QD23 chromosome, complete genome	5803733	3364276	3373740	5803733	tRNA,protease	Bacillus_phage(16.67%)	8	NA	NA
WP_004209699.1|3364276_3365998_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.6	1.2e-14
WP_004141853.1|3366024_3366744_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3367097_3367316_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3367436_3369716_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3369746_3370064_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3370389_3370611_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_064152930.1|3370687_3372628_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	7.2e-37
WP_004191152.1|3372624_3373740_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 9
NZ_CP042858	Klebsiella pneumoniae strain QD23 chromosome, complete genome	5803733	3854250	3893237	5803733	terminase,integrase,holin	Salmonella_phage(32.65%)	64	3858246:3858259	3894360:3894373
WP_071888015.1|3854250_3855156_-	hypothetical protein	NA	A0A1I9SEW2	Klebsiella_phage	59.4	1.7e-49
WP_064151832.1|3855155_3855932_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	56.9	3.0e-79
WP_064151831.1|3855928_3857128_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	74.4	2.4e-160
WP_032729828.1|3857127_3857481_-	bacteriophage protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	1.5e-49
WP_064151830.1|3857482_3858136_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	57.9	1.2e-73
WP_134895025.1|3858175_3858559_-	hypothetical protein	NA	NA	NA	NA	NA
3858246:3858259	attL	TTTTGCAGCGTCAT	NA	NA	NA	NA
WP_085954966.1|3858561_3858897_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	84.0	5.0e-31
WP_064151829.1|3858906_3859968_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	68.2	7.4e-137
WP_074182661.1|3859970_3860198_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	52.0	7.4e-18
WP_023284792.1|3860273_3860849_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	68.1	1.2e-64
WP_064151827.1|3860848_3862855_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	49.1	2.2e-158
WP_064151866.1|3862844_3862997_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
WP_064151826.1|3863038_3863458_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	65.9	7.9e-42
WP_064151825.1|3863461_3863905_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	81.4	1.5e-62
WP_064151824.1|3863914_3865060_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.2	9.7e-167
WP_064151823.1|3865063_3865504_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	53.1	1.6e-40
WP_064151822.1|3865598_3865985_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	75.8	7.5e-47
WP_064151821.1|3865984_3866599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064151820.1|3866595_3867015_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_048265720.1|3866983_3867265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064151819.1|3867304_3868246_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	2.3e-137
WP_040217290.1|3868257_3868752_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_023284780.1|3868755_3869958_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.2	5.5e-112
WP_064151818.1|3870009_3870558_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	2.0e-48
WP_032428591.1|3870613_3872065_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_064151817.1|3872302_3873703_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	1.2e-187
WP_004218030.1|3873653_3874142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074182649.1|3874623_3875034_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.0	4.3e-24
WP_064151815.1|3875030_3875237_-	hypothetical protein	NA	A0A2P0PAP7	Pectobacterium_phage	28.8	6.3e-08
WP_064151814.1|3875233_3875683_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	71.8	5.3e-60
WP_025987688.1|3875669_3875975_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	97.9	8.6e-46
WP_032413621.1|3876428_3876929_-	antiterminator	NA	G8C7V7	Escherichia_phage	92.1	2.5e-87
WP_023283343.1|3876925_3877066_-	YlcG family protein	NA	NA	NA	NA	NA
WP_064151813.1|3877062_3877698_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	78.9	1.2e-81
WP_040027526.1|3877690_3877861_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	71.4	2.2e-14
WP_064151812.1|3877866_3878463_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.8	4.7e-56
WP_064151811.1|3878619_3878925_-	hypothetical protein	NA	Q7Y3Y0	Yersinia_phage	44.4	6.0e-15
WP_064151810.1|3878917_3879523_-	DUF551 domain-containing protein	NA	G9L6B4	Escherichia_phage	60.8	4.2e-20
WP_157772047.1|3879519_3879690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064151809.1|3879686_3880319_-	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	40.2	9.0e-05
WP_064151808.1|3880311_3880575_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	78.0	1.1e-30
WP_012542626.1|3880984_3881278_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
WP_012542627.1|3881274_3882144_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	70.1	4.0e-96
WP_001548453.1|3883066_3883288_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3883328_3883556_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_047671980.1|3883667_3884366_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	6.2e-108
WP_012542633.1|3884511_3884916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012542634.1|3885020_3885197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032717012.1|3885619_3885814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064151806.1|3885899_3886097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159181450.1|3886093_3886252_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	60.0	4.5e-06
WP_064151805.1|3886248_3886902_+	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	62.3	5.2e-64
WP_064151804.1|3886885_3887176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064151803.1|3887172_3887478_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064151802.1|3887474_3889481_+	phage N-6-adenine-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	46.0	7.5e-114
WP_017898877.1|3889477_3889699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064151801.1|3889695_3890040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064151800.1|3890032_3890620_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	47.9	1.2e-38
WP_064162978.1|3890670_3890838_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	56.9	2.7e-09
WP_040186416.1|3890837_3891077_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	43.6	4.6e-10
WP_071549006.1|3891089_3891425_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064151799.1|3891301_3892465_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	3.8e-203
WP_064151835.1|3892680_3892998_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.0	1.8e-22
WP_064151867.1|3892997_3893237_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	55.7	3.6e-15
3894360:3894373	attR	TTTTGCAGCGTCAT	NA	NA	NA	NA
>prophage 10
NZ_CP042858	Klebsiella pneumoniae strain QD23 chromosome, complete genome	5803733	3897016	3911521	5803733		uncultured_Caudovirales_phage(50.0%)	21	NA	NA
WP_071888015.1|3897016_3897922_-	hypothetical protein	NA	A0A1I9SEW2	Klebsiella_phage	59.4	1.7e-49
WP_064151832.1|3897921_3898698_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	56.9	3.0e-79
WP_064151831.1|3898694_3899894_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	74.4	2.4e-160
WP_032729828.1|3899893_3900247_-	bacteriophage protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	1.5e-49
WP_064151830.1|3900248_3900902_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	57.9	1.2e-73
WP_134895025.1|3900941_3901325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085954966.1|3901327_3901663_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	84.0	5.0e-31
WP_064151829.1|3901672_3902734_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	68.2	7.4e-137
WP_074182661.1|3902736_3902964_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	52.0	7.4e-18
WP_023284792.1|3903039_3903615_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	68.1	1.2e-64
WP_064151827.1|3903614_3905621_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	49.1	2.2e-158
WP_064151866.1|3905610_3905763_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
WP_064151826.1|3905804_3906224_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	65.9	7.9e-42
WP_064151825.1|3906227_3906671_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	81.4	1.5e-62
WP_064151824.1|3906680_3907826_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.2	9.7e-167
WP_064151823.1|3907829_3908270_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	53.1	1.6e-40
WP_064151822.1|3908364_3908751_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	75.8	7.5e-47
WP_064151821.1|3908750_3909365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064151820.1|3909361_3909781_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_048265720.1|3909749_3910031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040217290.1|3911026_3911521_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
>prophage 11
NZ_CP042858	Klebsiella pneumoniae strain QD23 chromosome, complete genome	5803733	3917424	3938211	5803733	tRNA,integrase,holin	Enterobacteria_phage(33.33%)	39	3922513:3922527	3942121:3942135
WP_074182649.1|3917424_3917835_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.0	4.3e-24
WP_064151815.1|3917831_3918038_-	hypothetical protein	NA	A0A2P0PAP7	Pectobacterium_phage	28.8	6.3e-08
WP_064151814.1|3918034_3918484_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	71.8	5.3e-60
WP_025987688.1|3918470_3918776_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	97.9	8.6e-46
WP_032413621.1|3919229_3919730_-	antiterminator	NA	G8C7V7	Escherichia_phage	92.1	2.5e-87
WP_023283343.1|3919726_3919867_-	YlcG family protein	NA	NA	NA	NA	NA
WP_064151813.1|3919863_3920499_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	78.9	1.2e-81
WP_040027526.1|3920491_3920662_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	71.4	2.2e-14
WP_064151812.1|3920667_3921264_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.8	4.7e-56
WP_064151811.1|3921420_3921726_-	hypothetical protein	NA	Q7Y3Y0	Yersinia_phage	44.4	6.0e-15
WP_064151810.1|3921718_3922324_-	DUF551 domain-containing protein	NA	G9L6B4	Escherichia_phage	60.8	4.2e-20
WP_157772047.1|3922320_3922491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064151809.1|3922487_3923120_-	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	40.2	9.0e-05
3922513:3922527	attL	GCGGCGGCCAGCGCT	NA	NA	NA	NA
WP_064151808.1|3923112_3923376_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	78.0	1.1e-30
WP_012542626.1|3923785_3924079_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
WP_012542627.1|3924075_3924945_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	70.1	4.0e-96
WP_024264479.1|3924929_3925784_-	replication protein	NA	K7PGT1	Enterobacteria_phage	54.8	1.7e-62
WP_001548453.1|3925869_3926091_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3926131_3926359_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_047671980.1|3926470_3927169_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	6.2e-108
WP_012542633.1|3927314_3927719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012542634.1|3927823_3928000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032717012.1|3928422_3928617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064151806.1|3928702_3928900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159181450.1|3928896_3929055_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	60.0	4.5e-06
WP_064151805.1|3929051_3929705_+	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	62.3	5.2e-64
WP_064151804.1|3929688_3929979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064151803.1|3929975_3930281_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064151802.1|3930277_3932284_+	phage N-6-adenine-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	46.0	7.5e-114
WP_017898877.1|3932280_3932502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064151801.1|3932498_3932843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064151800.1|3932835_3933423_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	47.9	1.2e-38
WP_064162978.1|3933473_3933641_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	56.9	2.7e-09
WP_040186416.1|3933640_3933880_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	43.6	4.6e-10
WP_071549006.1|3933892_3934228_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064151799.1|3934104_3935268_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	3.8e-203
WP_004143017.1|3935699_3936566_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|3936567_3936780_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|3936825_3938211_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
3942121:3942135	attR	GCGGCGGCCAGCGCT	NA	NA	NA	NA
>prophage 12
NZ_CP042858	Klebsiella pneumoniae strain QD23 chromosome, complete genome	5803733	4510610	4559999	5803733	transposase,integrase	Escherichia_phage(38.1%)	52	4511959:4512018	4560304:4560366
WP_004574636.1|4510610_4511900_+|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	9.5e-86
4511959:4512018	attL	AAAATAATAAAAGCAGACTTGACCTGATAGTTTGGCTGTGAGCAATTATGTGCTTAGTGC	NA	NA	NA	NA
WP_001261740.1|4512079_4512871_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
4511959:4512018	attL	AAAATAATAAAAGCAGACTTGACCTGATAGTTTGGCTGTGAGCAATTATGTGCTTAGTGC	NA	NA	NA	NA
WP_032084014.1|4512955_4514176_-	EreA family erythromycin esterase	NA	NA	NA	NA	NA
WP_032084013.1|4514368_4514842_-	trimethoprim-resistant dihydrofolate reductase DfrA32	NA	A0A1B2IBQ4	Erwinia_phage	33.1	6.5e-16
WP_015057121.1|4514999_4515959_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001067855.1|4515849_4516554_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000184001.1|4516707_4517913_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|4518068_4518272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|4518359_4519064_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_063102497.1|4519257_4519644_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_000084745.1|4519963_4520356_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_001067855.1|4520551_4521256_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|4521399_4521954_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|4522084_4522915_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|4523052_4523685_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|4523769_4524222_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|4524444_4524792_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
4524343:4524413	attR	GCACTAAGCACATAATTGCTCACAGCCAAACTATCAGGTCAAGTCTGCTTTTATTATTTTTAAGCGTGCAT	NA	NA	NA	NA
WP_124743826.1|4524785_4525625_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
4524343:4524413	attR	GCACTAAGCACATAATTGCTCACAGCCAAACTATCAGGTCAAGTCTGCTTTTATTATTTTTAAGCGTGCAT	NA	NA	NA	NA
WP_001067855.1|4525788_4526493_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|4526606_4527383_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000742814.1|4527611_4528637_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_164529535.1|4529058_4529811_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	38.2	1.2e-32
WP_061456197.1|4531621_4532107_+	phenol hydroxylase	NA	NA	NA	NA	NA
WP_085940648.1|4532303_4533394_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|4533483_4534299_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|4534385_4534688_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|4534581_4534833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344975.1|4534863_4536357_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|4536468_4536774_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|4536801_4538016_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001452812.1|4538232_4538946_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067784.1|4540041_4540746_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	41.8	3.0e-41
WP_046788546.1|4540830_4541232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124785907.1|4541240_4544192_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.4	0.0e+00
WP_001067858.1|4544573_4545278_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_002210551.1|4546373_4546502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342101.1|4546904_4547027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013188475.1|4547006_4547882_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_013362812.1|4547916_4548885_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001067855.1|4550635_4551340_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839980.1|4551725_4552142_+	fosfomycin resistance glutathione transferase FosA3	NA	NA	NA	NA	NA
WP_014839979.1|4552146_4552665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839978.1|4552664_4553453_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_049824851.1|4553472_4553943_-	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.7	5.3e-10
WP_001067855.1|4553952_4554657_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|4554786_4555602_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|4555791_4556496_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001038045.1|4557328_4557988_-	tetracycline resistance transcriptional repressor TetR(C)	NA	NA	NA	NA	NA
WP_053409934.1|4558080_4559271_+	tetracycline efflux MFS transporter Tet(C)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.0	8.1e-07
WP_002310911.1|4559174_4559513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071533317.1|4559509_4559695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000015696.1|4559720_4559999_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
4560304:4560366	attR	GGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCA	NA	NA	NA	NA
>prophage 13
NZ_CP042858	Klebsiella pneumoniae strain QD23 chromosome, complete genome	5803733	4609331	4652903	5803733	transposase,integrase	Escherichia_phage(47.37%)	49	4609522:4609536	4659520:4659534
WP_102140835.1|4609331_4610485_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	38.6	7.8e-47
4609522:4609536	attL	GCATTATCTAAACAT	NA	NA	NA	NA
WP_001043260.1|4610857_4611673_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|4611733_4612537_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|4612536_4613373_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|4613433_4614138_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|4614370_4615231_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067855.1|4615599_4616304_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|4616493_4617309_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|4617459_4618164_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|4618285_4619191_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|4619187_4620426_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|4620425_4621010_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|4621502_4622267_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	46.2	3.1e-44
WP_000130000.1|4622493_4622799_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|4622809_4624015_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|4624170_4624374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|4624461_4625166_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_063102497.1|4625359_4625746_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_000084745.1|4626065_4626458_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_001067855.1|4626653_4627358_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|4627501_4628056_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|4628186_4629017_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|4629154_4629787_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|4629871_4630324_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|4630546_4630894_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_124743826.1|4630887_4631727_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_001067855.1|4631890_4632595_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|4632827_4633688_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067855.1|4634056_4634761_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|4634950_4635766_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|4635916_4636621_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|4636742_4637648_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|4637644_4638883_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|4638882_4639467_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|4639959_4640724_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	46.2	3.1e-44
WP_000130000.1|4640950_4641256_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|4641266_4642472_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|4642627_4642831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|4642958_4643798_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4643791_4644139_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|4644302_4645094_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_071523897.1|4645099_4645345_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|4645501_4645999_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|4646143_4647157_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|4647431_4648136_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_016946353.1|4648273_4649341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016946352.1|4649426_4649681_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_023332914.1|4650193_4651681_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
WP_017901102.1|4651766_4652903_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
4659520:4659534	attR	GCATTATCTAAACAT	NA	NA	NA	NA
>prophage 14
NZ_CP042858	Klebsiella pneumoniae strain QD23 chromosome, complete genome	5803733	4657638	4723503	5803733	transposase	Stx2-converting_phage(23.81%)	51	NA	NA
WP_003031967.1|4657638_4658607_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_025999344.1|4659970_4660708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901253.1|4660787_4661270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072096726.1|4661351_4662464_+	tellurite resistance domain protein	NA	NA	NA	NA	NA
WP_023288354.1|4662513_4663962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901256.1|4663979_4667048_+	virulence factor SrfB	NA	NA	NA	NA	NA
WP_017901257.1|4667047_4669762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901258.1|4669755_4670775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901259.1|4670771_4672739_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017901260.1|4672738_4673464_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	3.1e-17
WP_017901261.1|4673492_4674668_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017901262.1|4674718_4676287_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_017901263.1|4676322_4676826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032747566.1|4676885_4677341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017901264.1|4677434_4679027_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	6.1e-175
WP_017901265.1|4679057_4679408_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.9	3.4e-38
WP_004189163.1|4679404_4679845_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
WP_004902307.1|4680041_4680224_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
WP_004117790.1|4681427_4682399_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_017900945.1|4682398_4683565_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	96.9	2.2e-222
WP_017900946.1|4684294_4685305_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
WP_049257067.1|4686956_4687100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017900948.1|4687614_4688151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032430783.1|4689389_4690406_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_049015454.1|4691984_4693082_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	42.9	1.5e-60
WP_074184122.1|4693656_4694625_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	2.2e-180
WP_025999290.1|4695055_4695964_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_017900727.1|4696351_4696702_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	4.2e-20
WP_000790483.1|4696845_4697277_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_004118652.1|4697527_4699003_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000697968.1|4698995_4699676_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000475503.1|4699865_4701251_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|4701279_4701633_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_017900726.1|4701746_4703039_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_000574021.1|4703049_4706196_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	NA	NA	NA	NA
WP_017900725.1|4706282_4706723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128306664.1|4706820_4709292_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	34.9	5.0e-83
WP_000843497.1|4709332_4709530_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_164529536.1|4709563_4710301_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	3.6e-13
WP_025999288.1|4710589_4711039_-	copper resistance protein	NA	NA	NA	NA	NA
WP_017900722.1|4711273_4713091_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|4713090_4713987_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|4714026_4714407_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_017900721.1|4714411_4715341_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|4715395_4716076_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|4716072_4717473_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_017900720.1|4717688_4718123_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_000612626.1|4719510_4719858_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_048337392.1|4719854_4720259_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.0	3.6e-68
WP_042948515.1|4721407_4722331_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	3.3e-173
WP_032440835.1|4723095_4723503_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.2	3.1e-14
>prophage 15
NZ_CP042858	Klebsiella pneumoniae strain QD23 chromosome, complete genome	5803733	4740144	4798363	5803733	transposase,protease	Stx2-converting_phage(25.0%)	47	NA	NA
WP_017901337.1|4740144_4740558_-	hypothetical protein	NA	A0A222YY57	Escherichia_phage	46.3	1.1e-19
WP_011251286.1|4740627_4741047_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011251285.1|4741043_4741355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118218.1|4742110_4742488_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	92.1	7.1e-58
WP_032430752.1|4742484_4742832_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	7.7e-59
WP_017901237.1|4742880_4744419_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	92.8	4.1e-277
WP_012569499.1|4745183_4746164_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_017901242.1|4746232_4747198_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017901243.1|4747194_4748013_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	2.1e-14
WP_017901244.1|4748017_4748680_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_017901245.1|4748676_4749348_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004118155.1|4749371_4750220_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_020481021.1|4750376_4751330_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017901247.1|4751416_4752628_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_074423483.1|4752966_4753935_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.7	1.1e-176
WP_017901409.1|4754239_4754500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072096747.1|4754688_4755657_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	8.5e-180
WP_032435794.1|4755658_4756609_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	8.1e-167
WP_004144067.1|4756740_4757211_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_023287184.1|4757207_4757651_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_074424072.1|4760488_4761457_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	3.8e-172
WP_000612626.1|4763630_4763978_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_048337390.1|4763974_4764379_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.3e-68
WP_017901367.1|4765116_4766079_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_017901366.1|4766065_4766554_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_017901365.1|4766565_4766904_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_017901364.1|4767052_4767244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017901363.1|4767243_4770039_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	40.9	1.2e-128
WP_017901362.1|4770119_4770689_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_017901361.1|4770722_4771004_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017901360.1|4771233_4771497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042948539.1|4771511_4771775_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000227969.1|4773311_4774388_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_164529537.1|4775585_4776998_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	44.3	3.4e-105
WP_025999355.1|4777201_4779067_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_017901461.1|4780406_4780931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071600446.1|4781123_4781537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026319.1|4782475_4782940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901463.1|4782939_4783728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529538.1|4784089_4785058_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	5.9e-181
WP_085955508.1|4786430_4787550_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	3.9e-51
WP_017901405.1|4788040_4789705_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_017901404.1|4789701_4790775_-	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
WP_048337400.1|4790982_4791906_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.2	3.3e-165
WP_077252861.1|4794625_4794739_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	81.1	3.6e-10
WP_049257520.1|4794830_4796402_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.5	1.3e-20
WP_077254762.1|4797394_4798363_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	5.0e-172
>prophage 16
NZ_CP042858	Klebsiella pneumoniae strain QD23 chromosome, complete genome	5803733	4805581	4874137	5803733	transposase	Escherichia_phage(25.0%)	59	NA	NA
WP_017901324.1|4805581_4806604_-|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.0	2.1e-173
WP_007372130.1|4808489_4808669_+	hypothetical protein	NA	A0A1B2IAL0	Erwinia_phage	60.7	6.8e-11
WP_025999313.1|4811606_4812089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900939.1|4812364_4812769_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_017900938.1|4813497_4814580_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.1	6.5e-189
WP_017900937.1|4814701_4817776_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.4	0.0e+00
WP_017900936.1|4817827_4819081_+	lactose permease	NA	NA	NA	NA	NA
WP_017900810.1|4820239_4820518_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004210286.1|4820611_4820824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048337402.1|4821736_4822189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186900.1|4823446_4824331_+	hypothetical protein	NA	J9Q7H0	Salmonella_phage	43.2	2.6e-50
WP_164529539.1|4824491_4825526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|4825675_4826380_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001300294.1|4827769_4828438_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|4828473_4828710_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|4828706_4829069_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|4829086_4830781_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001447540.1|4830832_4831255_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|4831290_4831566_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|4831579_4831930_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|4832001_4832436_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000027057.1|4832717_4833578_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_014342213.1|4834131_4834257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000971921.1|4834398_4835769_-|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_014342212.1|4835767_4835917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|4835883_4837020_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000248278.1|4837070_4837298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|4837321_4837513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|4837994_4838537_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|4838549_4839410_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067855.1|4839642_4840347_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|4840468_4841374_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001137892.1|4842607_4843192_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|4843684_4844449_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	46.2	3.1e-44
WP_000130000.1|4844675_4844981_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|4844991_4846197_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|4846352_4846556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|4846683_4847523_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4847516_4847864_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|4848086_4848539_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_032492661.1|4849279_4850092_+	subclass B1 metallo-beta-lactamase NDM-3	NA	NA	NA	NA	NA
WP_004201167.1|4850095_4850461_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|4851137_4852679_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|4853083_4853923_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4853916_4854264_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749984.1|4854380_4855226_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA16	NA	NA	NA	NA	NA
WP_001749985.1|4855406_4855880_-	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	J9Q7T1	Salmonella_phage	33.3	2.4e-10
WP_164529540.1|4856020_4856467_-	NAD(+)--rifampin ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_001137892.1|4864065_4864650_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|4865142_4865907_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	46.2	3.1e-44
WP_000130000.1|4866133_4866439_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|4866449_4867655_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|4867810_4868014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|4868141_4868981_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4868974_4869322_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|4869544_4869997_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_032492661.1|4870737_4871550_+	subclass B1 metallo-beta-lactamase NDM-3	NA	NA	NA	NA	NA
WP_004201167.1|4871553_4871919_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|4872595_4874137_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
