The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	0	50249	4658723	capsid,portal,holin,tail,terminase,lysis,head,plate,tRNA	Escherichia_phage(52.78%)	52	NA	NA
WP_164538391.1|0_2277_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.4	0.0e+00
WP_021530418.1|2764_4309_-	RNA-directed DNA polymerase	NA	Q2P9X0	Enterobacteria_phage	99.0	1.4e-288
WP_072731811.1|4704_5739_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.7	1.9e-201
WP_118014781.1|5738_7511_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001074418.1|7684_8539_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.3e-136
WP_016237184.1|8597_9671_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.7	5.1e-202
WP_021548483.1|9674_10418_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	4.6e-125
WP_000988633.1|10517_11027_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|11026_11230_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|11233_11515_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|11514_12012_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_162107463.1|12026_12452_+	protein lysA	NA	U5N096	Enterobacteria_phage	94.3	1.2e-56
WP_118014779.1|12439_12865_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	1.2e-66
WP_072146842.1|12836_13010_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	2.6e-23
WP_001406878.1|12972_13440_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	6.7e-82
WP_001001780.1|13432_13885_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_118014777.1|13951_14587_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	9.3e-111
WP_118014775.1|14583_14931_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	1.1e-57
WP_118014773.1|14935_15844_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	2.2e-161
WP_089560875.1|15836_16448_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	6.4e-117
WP_164538392.1|16444_17746_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.1	1.9e-174
WP_164538393.1|17745_18339_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	62.4	2.5e-57
WP_001752131.1|18310_18745_-|tail	caudovirales tail fiber assembly family protein	tail	A0A0F7LDZ0	Escherichia_phage	43.4	6.5e-23
WP_164538394.1|18747_19593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000905108.1|19623_20217_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	8.7e-103
WP_118014769.1|20276_21467_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_001251408.1|21479_21998_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|22054_22330_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|22362_22482_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_164538395.1|22474_24922_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	96.3	0.0e+00
WP_000978896.1|24936_25416_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	100.0	6.6e-85
WP_164538396.1|25415_26579_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	2.0e-204
WP_000468308.1|26660_26879_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292822.1|27198_29481_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000642546.1|29535_30393_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_001295344.1|30798_32559_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642849.1|32688_33381_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057138.1|33579_34668_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000445231.1|34738_36022_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001295345.1|36190_36955_+	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000125016.1|37127_37811_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|37921_39595_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|39754_40039_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705764.1|40246_42511_+	ComEC family protein	NA	NA	NA	NA	NA
WP_164538397.1|42547_44296_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.0	8.7e-58
WP_000570539.1|44292_45279_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056538.1|45315_46548_+	winged helix DNA-binding protein YcaQ	NA	NA	NA	NA	NA
WP_000350058.1|46599_46782_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011603.1|46778_47525_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436922.1|47678_48572_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899600.1|48548_49328_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001298300.1|49463_50249_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	59001	69971	4658723	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|59001_59550_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109486.1|59576_60224_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|60445_61636_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977920.1|61820_62909_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|63511_64912_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001307697.1|65080_66283_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193841.1|66548_69161_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001090506.1|69203_69971_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 3
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	85889	87797	4658723		Tupanvirus(100.0%)	1	NA	NA
WP_000053099.1|85889_87797_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 4
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	100396	102451	4658723		Bacillus_phage(100.0%)	1	NA	NA
WP_164538577.1|100396_102451_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 5
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	106684	107344	4658723	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|106684_107344_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 6
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	126609	138924	4658723		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|126609_126822_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|126832_127021_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|126995_127226_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|127215_127389_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000829662.1|127437_128511_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001300633.1|128582_131327_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	2.7e-37
WP_001264933.1|131409_132438_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120125.1|132410_133103_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|133232_134405_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001062091.1|134404_136951_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	1.2e-71
WP_000209868.1|136947_137547_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|137698_138004_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420621.1|138003_138924_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 7
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	144006	146281	4658723		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|144006_144180_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001338446.1|144437_145766_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
WP_001028083.1|145786_146281_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 8
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	160919	161984	4658723		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258765.1|160919_161984_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 9
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	168803	171069	4658723	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_000409873.1|168803_170162_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
WP_164538400.1|170202_171069_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	4.3e-50
>prophage 10
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	177321	178155	4658723		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|177321_178155_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 11
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	183066	183600	4658723		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|183066_183600_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 12
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	192907	193828	4658723		Morganella_phage(100.0%)	1	NA	NA
WP_100032090.1|192907_193828_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 13
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	198488	198734	4658723		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|198488_198734_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 14
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	214617	215559	4658723		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|214617_215559_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 15
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	227916	229098	4658723		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|227916_228651_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|228861_229098_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 16
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	232370	234013	4658723		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|232370_233012_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267956.1|233008_234013_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	31.8	6.4e-05
>prophage 17
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	246319	246577	4658723		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|246319_246577_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 18
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	253865	257606	4658723		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033694.1|253865_254567_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
WP_001251348.1|254566_255811_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|255839_256751_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952737.1|256766_257606_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.7e-23
>prophage 19
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	260863	262841	4658723		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|260863_261721_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|261704_262841_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 20
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	267862	269233	4658723		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423742.1|267862_269233_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
>prophage 21
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	272369	276101	4658723		Enterobacteria_phage(66.67%)	5	NA	NA
WP_164538404.1|272369_273620_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	3.2e-22
WP_001295666.1|273722_274046_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|274581_274692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|274744_275149_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|275369_276101_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 22
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	281921	284315	4658723	transposase	Salmonella_phage(100.0%)	2	NA	NA
WP_000608644.1|281921_283184_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_015387340.1|283439_284315_+	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
>prophage 23
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	295732	297420	4658723		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|295732_296152_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457616.1|296151_297420_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 24
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	325642	328394	4658723		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|325642_327322_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|327446_328394_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 25
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	331530	335538	4658723		Pseudomonas_phage(50.0%)	5	NA	NA
WP_164538407.1|331530_332613_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456467.1|332612_333446_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200374.1|333442_333835_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|333838_334648_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_164538408.1|334683_335538_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	3.7e-46
>prophage 26
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	338637	338868	4658723		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146444.1|338637_338868_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 27
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	350122	363164	4658723	transposase	Escherichia_phage(20.0%)	11	NA	NA
WP_000702660.1|350122_351661_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|351657_352368_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|352367_353045_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555857.1|354300_355143_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001307143.1|355192_355651_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001295622.1|355763_356669_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_164538410.1|356760_357774_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|357975_358884_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|359027_359441_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068077.1|360045_360663_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_088895425.1|361935_363164_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 28
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	372185	374200	4658723		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|372185_373199_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|373195_374200_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 29
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	385858	388816	4658723		Acinetobacter_phage(100.0%)	2	NA	NA
WP_021570766.1|385858_387217_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	3.3e-36
WP_000763511.1|387220_388816_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
>prophage 30
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	395785	401077	4658723	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_164538411.1|395785_396544_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	5.7e-06
WP_000422045.1|396763_397813_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|397848_398100_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|398479_401077_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 31
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	406001	406592	4658723		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|406001_406592_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 32
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	414409	420066	4658723		Lactococcus_phage(50.0%)	5	NA	NA
WP_021570768.1|414409_416344_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_001335988.1|416411_417539_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|417682_418471_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_072134956.1|418838_419192_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|419259_420066_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 33
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	432981	434247	4658723		Klosneuvirus(100.0%)	1	NA	NA
WP_000069229.1|432981_434247_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.0e-24
>prophage 34
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	448252	449335	4658723		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057985.1|448252_449335_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 35
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	465953	466469	4658723		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|465953_466469_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 36
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	472795	480843	4658723	tRNA	Bacillus_phage(20.0%)	6	NA	NA
WP_000628058.1|472795_474028_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|474282_475266_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|475743_477117_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000081417.1|477245_478181_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_001300461.1|479134_479569_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|479709_480843_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 37
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	485803	486793	4658723		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762236.1|485803_486793_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
>prophage 38
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	509750	510979	4658723	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_088895425.1|509750_510979_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 39
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	519085	522988	4658723		Klosneuvirus(100.0%)	1	NA	NA
WP_000139543.1|519085_522988_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 40
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	526926	527875	4658723		Escherichia_phage(50.0%)	2	NA	NA
WP_000428998.1|526926_527457_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|527701_527875_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 41
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	539681	549855	4658723	transposase	Escherichia_phage(20.0%)	10	NA	NA
WP_064735206.1|539681_540890_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	89.1	6.2e-196
WP_001326689.1|540929_542144_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429155.1|542196_542733_+	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001303492.1|542805_544767_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	3.5e-23
WP_000494244.1|544858_545089_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|545310_545487_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270286.1|545532_545949_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_164538416.1|546027_547434_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047424.1|547678_548824_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220396.1|548841_549855_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 42
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	556987	559090	4658723		Salmonella_phage(100.0%)	1	NA	NA
WP_164538417.1|556987_559090_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	5.3e-134
>prophage 43
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	563996	568712	4658723		Ralstonia_phage(100.0%)	1	NA	NA
WP_164538419.1|563996_568712_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	3.2e-22
>prophage 44
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	576082	577627	4658723		Escherichia_phage(100.0%)	1	NA	NA
WP_000702535.1|576082_577627_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 45
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	584511	584802	4658723		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|584511_584802_-	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 46
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	590993	592434	4658723		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|590993_591278_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_001568846.1|591423_592434_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.0	4.7e-24
>prophage 47
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	595707	597613	4658723		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285536.1|595707_596634_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
WP_021570789.1|596626_597613_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
>prophage 48
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	601929	605736	4658723		Klosneuvirus(50.0%)	2	NA	NA
WP_001360132.1|601929_604329_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426292.1|604353_605736_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 49
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	617029	618715	4658723		Bacillus_phage(100.0%)	1	NA	NA
WP_164538421.1|617029_618715_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.5	7.7e-11
>prophage 50
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	638674	643445	4658723	integrase,transposase	Shigella_phage(50.0%)	4	NA	NA
WP_088895425.1|638674_639903_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_041124212.1|639978_641586_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_000169496.1|642282_642582_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000878219.1|642578_643445_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 51
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	655984	657520	4658723		Staphylococcus_phage(100.0%)	1	NA	NA
WP_021570792.1|655984_657520_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	2.2e-20
>prophage 52
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	665401	666820	4658723		Bacillus_phage(100.0%)	1	NA	NA
WP_000558029.1|665401_666820_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.9e-18
>prophage 53
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	674566	674950	4658723		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091199.1|674566_674950_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 54
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	677952	678843	4658723		Bacillus_phage(100.0%)	1	NA	NA
WP_000592814.1|677952_678843_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
>prophage 55
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	684207	699644	4658723		Escherichia_phage(44.44%)	15	NA	NA
WP_000214712.1|684207_684411_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527809.1|684445_685906_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_000151243.1|685994_687362_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000836066.1|687419_688439_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|688450_689665_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|689870_690197_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|690331_690673_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|690707_691268_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|691270_691981_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|692088_692394_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041681.1|692592_695019_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	4.5e-214
WP_001340362.1|695079_697503_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|697513_698131_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|698132_698987_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|699029_699644_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 56
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	728784	730596	4658723		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|728784_730596_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 57
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	750472	751747	4658723	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|750472_751747_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 58
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	758658	760157	4658723		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|758658_759180_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250656.1|759260_760157_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 59
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	768960	777841	4658723		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|768960_769776_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|769903_770485_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_164538425.1|770719_771889_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|772054_772144_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_021570807.1|772442_773468_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.3	6.3e-32
WP_000269501.1|773464_774397_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182363.1|774509_775721_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|776011_777160_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|777199_777841_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 60
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	783351	785618	4658723		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587525.1|783351_784164_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069979.1|784167_784953_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001310861.1|784949_785618_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 61
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	793907	798991	4658723		environmental_halophage(33.33%)	5	NA	NA
WP_000577988.1|793907_795128_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000907979.1|795124_796396_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948863.1|796370_797117_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	31.4	8.4e-10
WP_000089364.1|797126_798614_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|798622_798991_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 62
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	817727	837267	4658723	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_000869246.1|817727_819374_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.0e-32
WP_000069375.1|819430_821809_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|822141_822975_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082229.1|823131_824178_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|824309_824501_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175606.1|824504_825941_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001301292.1|826003_826717_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209795.1|826963_827428_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_032176331.1|827505_828255_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	1.2e-08
WP_001154168.1|828254_828806_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956528.1|828868_829849_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|829949_830249_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672380.1|830253_832641_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|832655_833639_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|833922_833967_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|834089_834446_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|834498_834696_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|834792_835335_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|835338_837267_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 63
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	848563	850825	4658723		Tupanvirus(100.0%)	1	NA	NA
WP_000077873.1|848563_850825_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 64
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	857154	857982	4658723		Bacillus_virus(100.0%)	1	NA	NA
WP_000175026.1|857154_857982_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.7e-72
>prophage 65
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	865457	866678	4658723		Klosneuvirus(100.0%)	1	NA	NA
WP_000081986.1|865457_866678_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	4.2e-27
>prophage 66
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	873442	874096	4658723		Planktothrix_phage(100.0%)	1	NA	NA
WP_001300558.1|873442_874096_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.2	1.2e-12
>prophage 67
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	879694	881656	4658723		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|879694_881656_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 68
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	886582	890668	4658723		Tupanvirus(50.0%)	4	NA	NA
WP_001135066.1|886582_887224_+	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
WP_164538431.1|887316_888675_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|888792_889551_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723723.1|889687_890668_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	7.9e-08
>prophage 69
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	899478	900333	4658723		Indivirus(100.0%)	1	NA	NA
WP_001186374.1|899478_900333_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 70
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	903651	908228	4658723		Bacillus_phage(100.0%)	3	NA	NA
WP_000219687.1|903651_904935_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616433.1|905081_906557_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_164538433.1|906737_908228_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 71
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	922757	930863	4658723	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|922757_924443_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|924647_925229_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220966.1|925268_925964_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_164538435.1|926021_927932_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	2.6e-92
WP_001295493.1|928063_928408_+	RidA family protein	NA	NA	NA	NA	NA
WP_071840897.1|928769_929129_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|929248_929428_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000855022.1|929501_930863_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
>prophage 72
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	934725	936282	4658723		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|934725_936282_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 73
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	941922	942132	4658723		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|941922_942132_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 74
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	947462	949511	4658723		Moraxella_phage(100.0%)	1	NA	NA
WP_001055779.1|947462_949511_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.8e-86
>prophage 75
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	957007	961477	4658723		Escherichia_phage(33.33%)	7	NA	NA
WP_164538437.1|957007_957664_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	5.2e-56
WP_000976472.1|958059_958401_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879295.1|958413_959286_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|959289_959664_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|959802_960033_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|960134_960791_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944258.1|960814_961477_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 76
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	969533	971009	4658723		Cyanophage(100.0%)	1	NA	NA
WP_000301719.1|969533_971009_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	3.7e-78
>prophage 77
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	975007	1045212	4658723	transposase,tRNA	Salmonella_phage(26.09%)	62	NA	NA
WP_001184045.1|975007_976330_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|976345_977278_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|977356_978112_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|978108_978894_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|979040_980051_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|980059_980671_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072134965.1|980809_980875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024932.1|980945_981548_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|981549_982071_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907248.1|982105_982846_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001300367.1|982874_983327_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258678.1|983444_985217_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_164538439.1|985526_986093_+	hydrolase	NA	NA	NA	NA	NA
WP_000639274.1|986089_986908_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|986960_987356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019590.1|987396_988140_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
WP_064670318.1|988136_989108_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176782.1|989272_991702_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214290.1|991726_992827_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185741.1|993214_993961_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001326725.1|993974_994541_-	VOC family protein	NA	NA	NA	NA	NA
WP_164538440.1|994756_996490_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	1.7e-85
WP_064670317.1|996666_997155_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|997274_997667_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_164538441.1|997666_999745_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278954.1|999737_1000886_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|1001087_1001732_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|1001742_1002132_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036361.1|1002146_1003196_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	7.9e-06
WP_000204337.1|1003198_1004059_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483239.1|1004077_1005679_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	6.4e-15
WP_001297437.1|1005724_1007386_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|1007530_1008034_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001300654.1|1008054_1010019_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_164538442.1|1010023_1010950_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906340.1|1010946_1011834_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001556670.1|1011960_1012539_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|1012541_1012892_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122426.1|1013671_1014100_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|1014106_1015531_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001295645.1|1015505_1016306_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100205.1|1016472_1017459_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|1017473_1018988_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|1019057_1020047_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000608644.1|1020328_1021591_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000134999.1|1021830_1022472_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_072037363.1|1022907_1023153_+	transcriptional regulator	NA	A0A222YWG0	Escherichia_phage	81.5	2.7e-34
WP_001067855.1|1025136_1025841_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_034167704.1|1026080_1026587_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_034167705.1|1026583_1027918_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_034167706.1|1027914_1029936_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_034167707.1|1029945_1032408_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_001067855.1|1032750_1033455_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032319017.1|1033602_1035876_+	thiosulfate reductase PhsA	NA	NA	NA	NA	NA
WP_016153548.1|1035890_1036469_+	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.0	2.1e-21
WP_032319018.1|1036465_1037233_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001323889.1|1037812_1039390_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_001323888.1|1039543_1039711_-	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_001161490.1|1039699_1040260_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|1040263_1043230_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001067855.1|1043284_1043989_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_031942297.1|1044243_1045212_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.5e-184
>prophage 78
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1058045	1058798	4658723		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|1058045_1058798_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 79
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1071019	1071688	4658723		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334608.1|1071019_1071688_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	7.3e-82
>prophage 80
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1083028	1096799	4658723	transposase	Bacillus_phage(25.0%)	14	NA	NA
WP_001564714.1|1083028_1084723_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.7e-18
WP_000009306.1|1084960_1085143_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|1085221_1086139_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001507517.1|1086311_1087232_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|1087220_1087691_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_164538447.1|1087671_1089090_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.7	1.8e-101
WP_000365561.1|1089156_1089852_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001313057.1|1089891_1090257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072134966.1|1090823_1091633_+	porin	NA	Q1MVN1	Enterobacteria_phage	50.3	8.1e-67
WP_088895425.1|1091721_1092949_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_089660501.1|1092990_1093218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218214.1|1093810_1094662_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826787.1|1094769_1096128_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	6.6e-05
WP_001339045.1|1096127_1096799_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 81
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1100343	1104025	4658723	integrase	Escherichia_phage(33.33%)	4	1102521:1102580	1116857:1116936
WP_001079074.1|1100343_1100874_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_001442913.1|1101626_1102424_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1102521:1102580	attL	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTC	NA	NA	NA	NA
WP_000055688.1|1102762_1103293_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.7	6.8e-30
WP_001292569.1|1103386_1104025_+|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	42.3	1.1e-29
1116857:1116936	attR	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCA	NA	NA	NA	NA
>prophage 82
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1123591	1124608	4658723	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001407551.1|1123591_1124608_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
>prophage 83
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1132495	1133662	4658723		Stx2-converting_phage(100.0%)	1	NA	NA
WP_016247321.1|1132495_1133662_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	6.5e-227
>prophage 84
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1140863	1141763	4658723		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|1140863_1141763_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 85
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1149107	1165788	4658723		Paramecium_bursaria_Chlorella_virus(10.0%)	14	NA	NA
WP_000704860.1|1149107_1150274_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.7e-110
WP_000043472.1|1150522_1151929_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	8.0e-38
WP_063117690.1|1152105_1152933_-	glycosyltransferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	29.1	8.4e-11
WP_000472516.1|1153716_1154385_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_064670360.1|1154384_1155263_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	40.0	6.0e-15
WP_001048966.1|1156562_1157819_-	O5 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000564888.1|1157821_1158925_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.1	8.0e-41
WP_000971201.1|1158921_1159389_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001025599.1|1159385_1159781_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_000676086.1|1159784_1160648_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	68.1	2.0e-111
WP_000699411.1|1160647_1161733_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	8.8e-101
WP_000183034.1|1162104_1162998_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	2.3e-46
WP_000999466.1|1163240_1164236_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_064670358.1|1164393_1165788_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 86
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1171501	1178383	4658723		Bacillus_phage(25.0%)	6	NA	NA
WP_001360303.1|1171501_1172872_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.2	1.3e-32
WP_000079280.1|1173152_1174589_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_000699721.1|1174591_1175815_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_001298845.1|1175811_1176291_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043654.1|1176293_1177259_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	51.1	1.3e-87
WP_000048190.1|1177261_1178383_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 87
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1182626	1193037	4658723		uncultured_marine_virus(20.0%)	8	NA	NA
WP_064670355.1|1182626_1183466_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000137111.1|1183558_1185721_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|1185723_1186167_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_064670354.1|1186179_1187313_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_001296218.1|1187971_1189555_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252340.1|1189847_1191701_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|1191722_1192304_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|1192395_1193037_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 88
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1197762	1199115	4658723		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004016760.1|1197762_1199115_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	3.2e-07
>prophage 89
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1212563	1219436	4658723	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000675150.1|1212563_1213967_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137873.1|1213963_1214686_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000929408.1|1214876_1215209_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|1215417_1215714_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|1215715_1216012_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476014.1|1216114_1217476_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_000716757.1|1217805_1218123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|1218536_1219436_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 90
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1228654	1232211	4658723		Serratia_phage(50.0%)	4	NA	NA
WP_064670345.1|1228654_1229659_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	1.3e-13
WP_064670344.1|1229655_1230621_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|1230594_1231341_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064670343.1|1231392_1232211_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	3.3e-23
>prophage 91
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1241479	1243513	4658723	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001300883.1|1241479_1243513_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	2.3e-54
>prophage 92
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1256633	1266074	4658723		Enterobacteria_phage(85.71%)	10	NA	NA
WP_064670439.1|1256633_1257770_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	9.4e-162
WP_001402348.1|1257766_1259767_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_001295429.1|1259891_1260353_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|1260392_1260863_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|1260909_1261629_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1261625_1263311_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|1263532_1264264_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|1264323_1264431_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1264411_1265143_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569357.1|1265147_1266074_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 93
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1286305	1287826	4658723		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_164538456.1|1286305_1287826_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 94
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1291520	1295306	4658723		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|1291520_1292189_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425438.1|1292446_1293283_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489247.1|1293314_1295306_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 95
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1299376	1300234	4658723		Catovirus(100.0%)	1	NA	NA
WP_000873894.1|1299376_1300234_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	4.0e-24
>prophage 96
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1314781	1319082	4658723		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001491191.1|1314781_1316248_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	8.7e-43
WP_000198822.1|1316365_1317352_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001300998.1|1317390_1318104_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|1318515_1319082_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 97
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1324836	1332484	4658723		Vibrio_phage(50.0%)	7	NA	NA
WP_000194927.1|1324836_1326426_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|1326429_1326774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213361.1|1327106_1328297_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|1328324_1329020_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578061.1|1329168_1330929_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	2.4e-100
WP_000494183.1|1331053_1331338_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050793.1|1331476_1332484_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	4.1e-84
>prophage 98
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1344358	1344976	4658723		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|1344358_1344976_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 99
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1354085	1359890	4658723		Bacillus_phage(33.33%)	5	NA	NA
WP_000422188.1|1354085_1355729_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_164538458.1|1355804_1356455_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_000710372.1|1356454_1357519_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	2.4e-18
WP_000406085.1|1357592_1358648_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865600.1|1358759_1359890_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.2	1.1e-117
>prophage 100
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1364167	1367017	4658723		Hokovirus(100.0%)	1	NA	NA
WP_000876011.1|1364167_1367017_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 101
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1383937	1386565	4658723		Bacillus_virus(100.0%)	1	NA	NA
WP_001281242.1|1383937_1386565_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 102
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1392009	1398156	4658723		Pseudomonas_phage(50.0%)	5	NA	NA
WP_001075164.1|1392009_1394295_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
WP_000332037.1|1394528_1395659_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_000135040.1|1395658_1395913_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|1395966_1396617_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779105.1|1397079_1398156_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.0e-08
>prophage 103
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1404048	1408559	4658723	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_000140569.1|1404048_1404948_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
WP_000150333.1|1404960_1405146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992954.1|1405186_1405990_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_016242281.1|1406007_1407297_-	MFS transporter	NA	NA	NA	NA	NA
WP_164538461.1|1407353_1408559_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
>prophage 104
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1412162	1417165	4658723		Tupanvirus(50.0%)	4	NA	NA
WP_000879112.1|1412162_1412765_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
WP_001295286.1|1413071_1414211_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.5e-29
WP_000461657.1|1414214_1415183_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_000860273.1|1415182_1417165_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 105
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1452354	1455582	4658723		Salmonella_phage(50.0%)	3	NA	NA
WP_021570895.1|1452354_1452954_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|1453012_1454845_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203392.1|1454931_1455582_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
>prophage 106
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1466141	1468002	4658723		Sodalis_phage(50.0%)	2	NA	NA
WP_000156149.1|1466141_1467032_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	43.9	8.9e-67
WP_001293613.1|1467228_1468002_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 107
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1472213	1473731	4658723		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|1472213_1473731_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 108
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1480207	1481344	4658723		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699145.1|1480207_1481344_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.9e-23
>prophage 109
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1489880	1490966	4658723		Pandoravirus(100.0%)	1	NA	NA
WP_001333535.1|1489880_1490966_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
>prophage 110
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1509618	1559384	4658723	integrase,protease,transposase	Enterobacteria_phage(44.44%)	46	1499008:1499067	1513723:1514491
1499008:1499067	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_000368140.1|1509618_1510551_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_164538583.1|1510862_1512020_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	6.9e-221
WP_096997721.1|1512301_1513645_+	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_000638547.1|1514595_1514727_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
1513723:1514491	attR	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACTGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTCGGATGCCGGGCAACCGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTCCGCCATTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGCTACGTCGGTGCTAAATCACGTCAGCGCTGGCTGTTTTACGCGTATGACAGGATACGGAGGACAGTTGTGGCGCACGTTTTCGGTGAACGCACTCTGGCCACACTGGAGCGTCTTCTGAGCCTGCTGTCGGCCTTTGAGGTCGTGGTATGGATGACGGATGGCTGGCCGCTGTATGAATCACGCCTGAAGGGAAAGCTGCACGTTATCAGCAAGCGTTACACTCAGCGCATTGAGCGACATAATCTGAATCTGAGACAACATCTGGCAAGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAGGTCATCGGGCATTATCTGAACATAAAACACTATCAGTAAGTTGGAGTCACTACCG	NA	NA	NA	NA
WP_001243355.1|1514711_1514864_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000031367.1|1515120_1515726_+	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_164538466.1|1515725_1515875_+	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	98.0	6.1e-21
WP_000878219.1|1515902_1516769_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169496.1|1516765_1517065_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_005119049.1|1517193_1517370_+	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	98.3	4.8e-25
WP_164538467.1|1517393_1517690_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	96.9	9.5e-50
WP_001214453.1|1517700_1517868_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	100.0	1.7e-24
WP_164538468.1|1517864_1518164_+	hypothetical protein	NA	Q716F3	Shigella_phage	98.0	7.3e-58
WP_001277767.1|1518896_1519076_+	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
WP_001163428.1|1519207_1519408_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000556048.1|1520451_1521789_+	D-serine transporter DsdX	NA	NA	NA	NA	NA
WP_000426426.1|1521806_1523135_+	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001018731.1|1523242_1524781_-	multidrug efflux MFS transporter permease subunit EmrY	NA	NA	NA	NA	NA
WP_000435167.1|1524780_1525944_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrK	NA	NA	NA	NA	NA
WP_000991370.1|1526359_1526974_+	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_001355656.1|1526978_1530572_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
WP_164538469.1|1530627_1531773_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_164538470.1|1531846_1532791_-	transporter YfdV	NA	NA	NA	NA	NA
WP_164538471.1|1532860_1534555_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
WP_000106759.1|1534608_1535859_-	formyl-CoA transferase	NA	NA	NA	NA	NA
WP_088895425.1|1536428_1537656_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000825600.1|1537707_1538343_-	YfdX family protein	NA	NA	NA	NA	NA
WP_000867631.1|1538638_1538914_+	colanic acid biosynthesis lipoprotein YpdI	NA	NA	NA	NA	NA
WP_000609275.1|1538990_1539233_-	YfdY family protein	NA	NA	NA	NA	NA
WP_000484404.1|1539585_1540506_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
WP_010723117.1|1540861_1540933_+	membrane protein YpdK	NA	NA	NA	NA	NA
WP_000785931.1|1540997_1542236_-	alanine transaminase	NA	NA	NA	NA	NA
WP_000544359.1|1542611_1544309_+	two-component system sensor histidine kinase YpdA	NA	NA	NA	NA	NA
WP_001295458.1|1544323_1545058_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
WP_000646835.1|1545070_1545928_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000955906.1|1545930_1548426_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000366028.1|1548450_1549488_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000173291.1|1549487_1550573_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000985359.1|1550587_1551835_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000038456.1|1551856_1552183_-	fructose-like phosphotransferase enzyme IIB component 1	NA	NA	NA	NA	NA
WP_000170346.1|1552401_1553367_-	glucokinase	NA	NA	NA	NA	NA
WP_000903148.1|1553570_1554827_+	ion channel protein	NA	NA	NA	NA	NA
WP_000490072.1|1554941_1555268_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000186369.1|1555408_1556647_-	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_000376337.1|1556982_1558185_+	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_001300563.1|1558271_1559384_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
>prophage 111
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1572101	1584755	4658723		Streptococcus_phage(40.0%)	12	NA	NA
WP_000443661.1|1572101_1574117_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.7e-150
WP_001300494.1|1574187_1575174_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|1575403_1576165_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|1576349_1577321_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|1577704_1577962_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623140.1|1578006_1579734_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	1.3e-16
WP_000522247.1|1579774_1580284_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096674.1|1580326_1581178_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719962.1|1581282_1581657_+	YfeK family protein	NA	NA	NA	NA	NA
WP_000745534.1|1581689_1582424_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001336044.1|1582612_1583524_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.3	3.8e-57
WP_000021036.1|1583657_1584755_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
>prophage 112
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1587772	1588564	4658723		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000517431.1|1587772_1588564_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 113
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1592042	1597162	4658723		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001327042.1|1592042_1593347_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|1593586_1594486_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838944.1|1594581_1595157_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000842944.1|1595217_1595667_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000405996.1|1595653_1596079_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102886.1|1596292_1597162_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 114
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1617265	1618216	4658723		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|1617265_1618216_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 115
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1635504	1636218	4658723		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1635504_1636218_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 116
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1657469	1661471	4658723		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|1657469_1658759_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|1658844_1659471_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001336050.1|1659795_1660833_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.4e-71
WP_001028612.1|1660832_1661471_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	1.8e-29
>prophage 117
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1668494	1674977	4658723		Escherichia_phage(66.67%)	7	NA	NA
WP_000017552.1|1668494_1668647_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|1668664_1668856_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001295476.1|1669166_1669685_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000755173.1|1669700_1670240_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_000138270.1|1670332_1671910_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|1671978_1673445_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937912.1|1673606_1674977_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.4e-42
>prophage 118
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1683807	1684239	4658723		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|1683807_1684239_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 119
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1694449	1700906	4658723		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133592.1|1694449_1695733_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
WP_000523616.1|1695910_1696111_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|1696122_1696458_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|1696459_1698310_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|1698326_1698842_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|1698937_1699261_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|1699277_1699664_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|1699691_1700906_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 120
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1716042	1717554	4658723		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001556163.1|1716042_1717554_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	1.5e-13
>prophage 121
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1723446	1734736	4658723		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|1723446_1724700_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883122.1|1725027_1726218_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717691.1|1726262_1726601_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001295369.1|1726661_1727996_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_164538481.1|1727985_1728699_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_024187693.1|1728863_1730291_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
WP_021570910.1|1730848_1734736_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	5.9e-131
>prophage 122
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1738855	1739116	4658723		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|1738855_1739116_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 123
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1742575	1746317	4658723		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|1742575_1743256_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002541.1|1743527_1744502_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|1744517_1746317_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 124
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1752088	1758347	4658723	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|1752088_1753423_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_053286107.1|1753631_1754513_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063080541.1|1754615_1755203_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|1755258_1755642_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|1755946_1756636_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|1756683_1757721_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1757927_1758347_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 125
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1763640	1764939	4658723		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|1763640_1764939_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 126
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1770793	1773367	4658723		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|1770793_1773367_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 127
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1779273	1780344	4658723		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168037.1|1779273_1780344_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 128
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1794089	1800978	4658723	transposase	Staphylococcus_phage(25.0%)	7	NA	NA
WP_000162574.1|1794089_1794572_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000878219.1|1795737_1796604_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169496.1|1796600_1796900_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_001572958.1|1797953_1798229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000151178.1|1798477_1798777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000795662.1|1798797_1799004_-	AlpA family transcriptional regulator	NA	A0A0R6PGY4	Moraxella_phage	41.1	6.5e-05
WP_088895425.1|1799750_1800978_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 129
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1806839	1807058	4658723		Salmonella_phage(100.0%)	1	NA	NA
WP_071524906.1|1806839_1807058_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	70.0	4.1e-10
>prophage 130
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1813432	1817484	4658723		Klosneuvirus(50.0%)	4	NA	NA
WP_001087611.1|1813432_1814713_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
WP_001295173.1|1814950_1816351_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|1816371_1817034_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|1817034_1817484_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 131
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1821420	1826715	4658723		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|1821420_1821666_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|1821662_1822073_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246527.1|1822045_1824190_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
WP_000777969.1|1824199_1825159_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000985494.1|1825512_1826715_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 132
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1839526	1844912	4658723	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|1839526_1839712_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047184.1|1839946_1842577_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140508.1|1842704_1843205_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|1843273_1844335_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|1844414_1844912_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 133
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1850378	1851344	4658723		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287420.1|1850378_1851344_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 134
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1858819	1859830	4658723		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001394680.1|1858819_1859830_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.4	7.1e-28
>prophage 135
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1877658	1890841	4658723		Escherichia_phage(54.55%)	13	NA	NA
WP_085438572.1|1877658_1880220_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	7.8e-31
WP_001141322.1|1880325_1880982_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|1881032_1881800_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847985.1|1881995_1882904_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_164538485.1|1882900_1883677_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	63.3	7.0e-84
WP_094190907.1|1883683_1884163_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	58.2	2.6e-41
WP_001278994.1|1884159_1884798_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|1884802_1885579_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|1885667_1887032_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|1887125_1888118_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|1888180_1889320_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|1889459_1890086_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|1890079_1890841_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 136
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1893953	1895986	4658723		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|1893953_1894559_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090361.1|1894558_1895986_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 137
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1915018	1915804	4658723		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|1915018_1915804_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 138
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1920277	1925197	4658723		Vibrio_phage(33.33%)	5	NA	NA
WP_001199973.1|1920277_1920949_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001288228.1|1921087_1921228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001268460.1|1921241_1922114_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|1922173_1923472_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|1923559_1925197_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 139
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1929229	1933344	4658723		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_001556187.1|1929229_1930531_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.4	3.3e-38
WP_000186450.1|1930587_1933344_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 140
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1940879	1941728	4658723		Vibrio_phage(100.0%)	1	NA	NA
WP_000100417.1|1940879_1941728_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.7e-41
>prophage 141
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1946496	1947342	4658723		Bacillus_phage(100.0%)	1	NA	NA
WP_001214598.1|1946496_1947342_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.6e-10
>prophage 142
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1958867	1974305	4658723	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_001300698.1|1958867_1960073_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.0e-73
WP_000184261.1|1960072_1960516_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|1960566_1961373_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|1961611_1962709_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_047643759.1|1963177_1964431_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|1964662_1965994_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775955.1|1966055_1967882_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
WP_164538488.1|1967881_1971424_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	1.5e-08
WP_061351893.1|1971416_1974305_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
>prophage 143
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1979781	1986554	4658723		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|1979781_1980576_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|1980582_1981458_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957910.1|1981608_1983855_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|1983867_1984398_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082201.1|1985082_1985772_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|1985840_1986554_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 144
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	1996184	1999456	4658723		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|1996184_1997603_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|1998694_1999456_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 145
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2011708	2012464	4658723		Clostridium_phage(100.0%)	1	NA	NA
WP_001301085.1|2011708_2012464_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 146
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2036743	2052135	4658723	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|2036743_2038144_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001299798.1|2038161_2039478_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|2039513_2040881_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838422.1|2040916_2041405_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001300605.1|2041404_2043324_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|2043759_2045208_+	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001050745.1|2045209_2045335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|2045331_2045403_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192790.1|2045457_2046006_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_001618837.1|2046048_2047566_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	7.7e-87
WP_001701073.1|2047575_2048674_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813201.1|2048764_2050498_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	2.4e-60
WP_000715214.1|2050503_2051214_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|2051238_2052135_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 147
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2056059	2060532	4658723		Pandoravirus(50.0%)	2	NA	NA
WP_001514525.1|2056059_2057493_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.4	3.0e-32
WP_004017789.1|2057658_2060532_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.8e-263
>prophage 148
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2068667	2069900	4658723		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|2068667_2069900_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 149
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2094179	2155430	4658723	integrase,protease,transposase,tRNA	Escherichia_phage(28.57%)	48	2083791:2083806	2124914:2124929
2083791:2083806	attL	CAACCAGTTCACCTTC	NA	NA	NA	NA
WP_001326497.1|2094179_2094938_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105566.1|2095143_2096064_-	agmatinase	NA	NA	NA	NA	NA
WP_001300904.1|2096201_2098178_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|2098186_2098318_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|2098453_2098669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|2098972_2100127_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|2100550_2101945_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001300769.1|2102021_2102519_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|2102613_2103321_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|2103400_2104132_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|2104144_2105095_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000126441.1|2105131_2105767_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|2105766_2106183_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001295381.1|2106366_2107347_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|2107364_2108069_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|2108086_2108653_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|2108649_2108940_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174735.1|2108947_2109541_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239928.1|2109533_2110670_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745217.1|2110824_2111832_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394131.1|2111948_2112995_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|2113170_2113890_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|2114073_2114400_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|2114399_2115119_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001321419.1|2115279_2116332_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|2116359_2116635_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|2116699_2117779_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001299430.1|2117980_2119237_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839760.1|2119286_2121422_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234514.1|2121819_2122527_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_137565924.1|2122885_2124103_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	57.3	5.0e-129
WP_008913927.1|2124222_2124507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164538491.1|2125782_2126313_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
2124914:2124929	attR	GAAGGTGAACTGGTTG	NA	NA	NA	NA
WP_000081909.1|2126322_2128716_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
WP_001407551.1|2128793_2129810_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_152931452.1|2131233_2135277_-	DUF2357 domain-containing protein	NA	NA	NA	NA	NA
WP_152931451.1|2135280_2137986_-	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
WP_161997713.1|2137985_2140157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152931450.1|2140153_2143591_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_152931449.1|2143587_2145081_-	lipopolysaccharide kinase	NA	NA	NA	NA	NA
WP_152931448.1|2145077_2145806_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_152931447.1|2145798_2146380_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_152931446.1|2146381_2148112_-	DUF1887 family protein	NA	NA	NA	NA	NA
WP_152931445.1|2148108_2150256_-	AAA family ATPase	NA	U5XGM6	Phormidium_phage	31.6	5.3e-57
WP_152931444.1|2150258_2151830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|2151879_2153108_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_152931510.1|2153196_2153883_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_164538492.1|2154413_2155430_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	2.2e-186
>prophage 150
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2172894	2173134	4658723		Vibrio_phage(100.0%)	1	NA	NA
WP_152931422.1|2172894_2173134_-	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	42.6	2.0e-05
>prophage 151
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2183938	2184130	4658723		Escherichia_phage(100.0%)	1	NA	NA
WP_024241676.1|2183938_2184130_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	1.9e-06
>prophage 152
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2203525	2204698	4658723		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524970.1|2203525_2204698_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	5.5e-40
>prophage 153
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2226469	2227354	4658723		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|2226469_2227354_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 154
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2233430	2242781	4658723		Staphylococcus_phage(33.33%)	7	NA	NA
WP_000013149.1|2233430_2234258_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691619.1|2234457_2235384_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|2235434_2235692_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_164538495.1|2235734_2237954_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.0	1.1e-102
WP_000059388.1|2238064_2239477_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965722.1|2239551_2240289_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|2240522_2242781_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
>prophage 155
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2246060	2246453	4658723		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|2246060_2246453_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 156
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2250280	2261243	4658723		Bacillus_virus(20.0%)	12	NA	NA
WP_000195296.1|2250280_2252173_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|2252201_2252783_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|2252782_2253610_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|2253634_2254057_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_164538496.1|2254057_2254687_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.1	1.6e-17
WP_000735278.1|2254891_2256373_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|2256520_2257192_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|2257197_2258358_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000188362.1|2258395_2259211_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|2259326_2260100_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|2260157_2260328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|2260589_2261243_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 157
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2265462	2266896	4658723		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|2265462_2266896_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 158
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2272033	2273272	4658723	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708487.1|2272033_2273272_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 159
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2279673	2295869	4658723	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264352.1|2279673_2280687_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|2280924_2281140_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|2281250_2282996_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437375.1|2283190_2285032_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|2285110_2285617_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001066494.1|2285870_2286635_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018003.1|2286922_2287546_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094721.1|2287699_2289220_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_164538497.1|2289526_2291017_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.4	4.8e-33
WP_000450594.1|2291058_2291391_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212475.1|2291609_2292593_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082856.1|2292776_2295869_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	2.5e-156
>prophage 160
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2308623	2309589	4658723		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|2308623_2309589_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 161
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2330167	2332462	4658723		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|2330167_2332462_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 162
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2340668	2341814	4658723		Streptococcus_phage(100.0%)	1	NA	NA
WP_001300387.1|2340668_2341814_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 163
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2364823	2372617	4658723		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809262.1|2364823_2365684_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
WP_164538499.1|2365748_2367785_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246830.1|2367742_2368138_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|2368157_2368748_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|2368757_2369333_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147574.1|2369446_2370487_-	permease	NA	NA	NA	NA	NA
WP_001300423.1|2370559_2371195_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|2371322_2371841_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449030.1|2371820_2372264_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189333.1|2372314_2372617_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	53.8	7.8e-15
>prophage 164
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2378319	2380209	4658723		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|2378319_2380209_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 165
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2385690	2392329	4658723		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|2385690_2388363_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|2388387_2389875_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|2389902_2390355_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|2390985_2392329_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 166
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2396411	2399284	4658723	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|2396411_2397260_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|2397349_2399284_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 167
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2406058	2407537	4658723		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|2406058_2407030_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445404.1|2407258_2407537_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	5.8e-17
>prophage 168
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2411605	2426400	4658723		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|2411605_2412415_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922901.1|2412624_2413602_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|2413615_2414602_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030005.1|2414622_2415189_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|2415185_2415761_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|2415729_2416287_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|2416293_2417019_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809057.1|2417066_2418500_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|2418522_2418810_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|2418927_2419419_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|2419464_2420319_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|2420315_2420588_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|2420801_2421434_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|2421430_2422159_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001300411.1|2422155_2422809_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|2423038_2425375_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299745.1|2425470_2426400_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 169
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2438977	2443725	4658723		Salmonella_phage(50.0%)	5	NA	NA
WP_000445116.1|2438977_2440105_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
WP_000979882.1|2440164_2440629_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209011.1|2440625_2441501_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|2441497_2442187_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108459.1|2442234_2443725_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 170
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2447428	2447926	4658723	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|2447428_2447926_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 171
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2451892	2454417	4658723	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|2451892_2453260_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|2453349_2454417_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 172
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2471193	2472237	4658723		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2471193_2472237_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 173
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2482802	2483687	4658723		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258895.1|2482802_2483687_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.9e-24
>prophage 174
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2490191	2494345	4658723		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738568.1|2490191_2491217_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
WP_000019655.1|2491284_2492466_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001300681.1|2492475_2493579_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078349.1|2493586_2494345_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
>prophage 175
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2504840	2506312	4658723	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|2504840_2505350_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004473.1|2505364_2506312_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 176
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2527527	2529480	4658723		Vibrio_phage(100.0%)	1	NA	NA
WP_001326512.1|2527527_2529480_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	9.2e-32
>prophage 177
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2538310	2546869	4658723		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_000773156.1|2538310_2541004_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	8.7e-41
WP_000031783.1|2541295_2542480_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|2542550_2544665_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|2544761_2545232_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|2545328_2545703_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903373.1|2545828_2546116_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820714.1|2546123_2546483_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209680.1|2546482_2546869_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
>prophage 178
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2552439	2561980	4658723		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|2552439_2554353_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000057356.1|2554352_2555375_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|2555368_2555587_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|2555640_2556510_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|2556564_2556969_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|2557270_2557903_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_152924783.1|2557953_2560044_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963792.1|2560110_2561331_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601847.1|2561416_2561980_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 179
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2586227	2587064	4658723		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|2586227_2587064_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 180
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2603968	2607735	4658723		Bacillus_phage(66.67%)	3	NA	NA
WP_001265681.1|2603968_2605591_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_164538503.1|2605666_2607019_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|2607015_2607735_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 181
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2614317	2615196	4658723		Sodalis_phage(100.0%)	1	NA	NA
WP_000039062.1|2614317_2615196_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 182
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2621230	2623624	4658723		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|2621230_2623624_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 183
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2628003	2629230	4658723		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105504.1|2628003_2629230_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	4.0e-134
>prophage 184
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2635285	2637733	4658723		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|2635285_2637733_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 185
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2656638	2658449	4658723		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073613.1|2656638_2657382_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	5.8e-11
WP_000907792.1|2657378_2658449_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 186
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2661992	2663475	4658723		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416891.1|2661992_2662706_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	7.0e-14
WP_000082101.1|2662707_2663475_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 187
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2669208	2672027	4658723		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|2669208_2670063_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|2670307_2671366_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|2671358_2672027_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 188
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2675033	2679165	4658723		Dickeya_phage(50.0%)	4	NA	NA
WP_053898938.1|2675033_2675660_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.1	1.8e-29
WP_000106551.1|2675733_2677932_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.4	8.5e-119
WP_000130621.1|2678033_2678279_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100469.1|2678499_2679165_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
>prophage 189
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2687058	2692710	4658723		Bacillus_virus(50.0%)	3	NA	NA
WP_000173631.1|2687058_2687865_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
WP_001190062.1|2687870_2688272_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_164538506.1|2688474_2692710_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	9.6e-26
>prophage 190
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2696085	2698821	4658723		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149156.1|2696085_2698821_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
>prophage 191
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2707264	2709342	4658723		Bacillus_phage(100.0%)	2	NA	NA
WP_001211180.1|2707264_2708665_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_001188930.1|2708661_2709342_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
>prophage 192
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2714436	2717923	4658723		Listeria_phage(50.0%)	3	NA	NA
WP_000287501.1|2714436_2715174_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
WP_000843494.1|2715207_2715405_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_001398208.1|2715445_2717923_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.4	2.9e-83
>prophage 193
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2725066	2728395	4658723		Bacillus_phage(66.67%)	4	NA	NA
WP_000697969.1|2725066_2725747_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
WP_000555736.1|2725739_2727221_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
WP_000790485.1|2727465_2727897_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000647571.1|2728044_2728395_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
>prophage 194
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2745615	2747658	4658723		Indivirus(100.0%)	1	NA	NA
WP_001298719.1|2745615_2747658_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 195
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2751003	2758377	4658723	transposase	uncultured_Caudovirales_phage(60.0%)	7	NA	NA
WP_000008957.1|2751003_2751357_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_000922639.1|2751410_2752700_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000065769.1|2752712_2753138_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
WP_001407551.1|2753995_2755012_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001057453.1|2756435_2757002_+	outer membrane lipoprotein Slp	NA	NA	NA	NA	NA
WP_000478619.1|2757157_2757688_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001296814.1|2757729_2758377_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 196
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2789978	2791963	4658723		Bacillus_virus(50.0%)	2	NA	NA
WP_000107012.1|2789978_2790983_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196486.1|2790979_2791963_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 197
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2802175	2804509	4658723		Escherichia_phage(100.0%)	1	NA	NA
WP_000013950.1|2802175_2804509_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	2.7e-70
>prophage 198
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2808163	2810163	4658723	transposase	Morganella_phage(50.0%)	3	NA	NA
WP_000014594.1|2808163_2808376_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_001135732.1|2808562_2808715_-	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_085947770.1|2808794_2810163_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
>prophage 199
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2814001	2814997	4658723		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182650.1|2814001_2814997_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 200
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2820315	2821857	4658723		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146479.1|2820315_2821857_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 201
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2841188	2851337	4658723	tRNA	uncultured_Caudovirales_phage(66.67%)	6	NA	NA
WP_000582468.1|2841188_2843033_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.7	5.6e-15
WP_000206275.1|2843029_2844421_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|2844518_2845127_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_164538515.1|2845354_2849488_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.1e-25
WP_000072850.1|2849508_2850351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063121680.1|2850503_2851337_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	8.7e-24
>prophage 202
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2868140	2878869	4658723		Rhizobium_phage(16.67%)	10	NA	NA
WP_000024392.1|2868140_2868392_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|2868533_2868965_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|2869209_2870754_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|2870763_2872047_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483847.1|2872050_2873010_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982091.1|2872996_2874031_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646007.1|2874269_2875295_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|2875304_2876501_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000842823.1|2876775_2877633_-	protein YibB	NA	NA	NA	NA	NA
WP_000587764.1|2877936_2878869_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
>prophage 203
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2890800	2895363	4658723		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_032231556.1|2890800_2891280_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	6.3e-27
WP_001114533.1|2891318_2892128_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|2892225_2892393_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|2892413_2892650_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|2892866_2893535_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050139.1|2893706_2894927_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_000976070.1|2894904_2895363_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
>prophage 204
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2898736	2905485	4658723		Morganella_phage(25.0%)	6	NA	NA
WP_001300958.1|2898736_2899561_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.6	2.4e-90
WP_000924289.1|2899850_2900468_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_164538517.1|2900464_2902147_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.1	1.9e-22
WP_001295237.1|2902404_2903028_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|2903082_2903358_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|2903376_2905485_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 205
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2909921	2911313	4658723		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|2909921_2911313_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 206
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2923431	2924766	4658723		Moraxella_phage(100.0%)	1	NA	NA
WP_001403836.1|2923431_2924766_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	1.1e-65
>prophage 207
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2932072	2941093	4658723		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_000168475.1|2932072_2933761_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
WP_001300753.1|2933866_2933965_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_001054909.1|2934529_2934619_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|2934898_2936083_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148061.1|2936090_2936588_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|2936584_2936947_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|2936936_2937284_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511289.1|2937391_2937841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828527.1|2937887_2939381_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.6	2.3e-30
WP_001087145.1|2939377_2941093_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 208
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2947445	2948399	4658723		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|2947445_2947874_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|2947985_2948399_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 209
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2952826	2953975	4658723		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|2952826_2953975_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 210
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2958681	2966050	4658723		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|2958681_2961096_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|2961124_2962198_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|2962197_2963298_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|2963302_2964706_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|2965002_2965083_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|2965312_2965453_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|2965469_2965829_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|2965792_2966050_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 211
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2976248	2977586	4658723		Moraxella_phage(100.0%)	1	NA	NA
WP_001299598.1|2976248_2977586_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 212
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	2988575	2996183	4658723		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|2988575_2989349_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251978.1|2989531_2990422_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|2990421_2991381_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|2991467_2992508_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_164538526.1|2992821_2994651_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	3.3e-132
WP_000933736.1|2994812_2996183_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 213
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3008137	3009130	4658723		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845104.1|3008137_3009130_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 214
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3012298	3018151	4658723		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|3012298_3014167_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001301979.1|3014333_3014753_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387770.1|3014760_3016266_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|3016270_3017236_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|3017260_3018151_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 215
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3031542	3033189	4658723		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012607.1|3031542_3033189_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	1.6e-66
>prophage 216
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3041661	3047075	4658723		Bacillus_phage(33.33%)	4	NA	NA
WP_001238886.1|3041661_3043683_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
WP_001295254.1|3043729_3045214_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|3045349_3046615_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|3046745_3047075_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 217
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3051117	3057261	4658723		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866670.1|3051117_3052248_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
WP_000006621.1|3052244_3053507_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226602.1|3053506_3054574_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	3.0e-101
WP_164538527.1|3054592_3055474_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	1.5e-106
WP_001145183.1|3055451_3056126_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612043.1|3056130_3057261_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 218
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3065345	3067001	4658723		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000406041.1|3065345_3067001_-	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.5	1.4e-44
>prophage 219
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3077304	3081163	4658723		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|3077304_3078201_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|3078200_3078917_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383406.1|3079000_3081163_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 220
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3086881	3088711	4658723		Catovirus(100.0%)	1	NA	NA
WP_164538585.1|3086881_3088711_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	4.3e-84
>prophage 221
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3101243	3104530	4658723		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187535.1|3101243_3102884_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|3102962_3103232_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_001724133.1|3103235_3103751_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|3103753_3104530_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 222
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3113411	3114026	4658723		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295262.1|3113411_3114026_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 223
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3127884	3130671	4658723		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|3127884_3130671_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 224
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3134782	3137253	4658723		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|3134782_3136192_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|3136203_3137253_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 225
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3148728	3151508	4658723		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718901.1|3148728_3149625_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_164538530.1|3149792_3150689_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|3150722_3151508_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 226
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3158825	3161876	4658723		Escherichia_phage(100.0%)	1	NA	NA
WP_010723259.1|3158825_3161876_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 227
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3178472	3183333	4658723		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001297064.1|3178472_3179093_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_023281577.1|3179352_3180336_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|3180484_3181159_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|3181264_3182638_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|3182634_3183333_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 228
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3194944	3199447	4658723		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|3194944_3195790_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3196214_3196460_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|3196544_3197030_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|3197122_3198049_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|3198115_3199447_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 229
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3216745	3223992	4658723		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424841.1|3216745_3217408_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	4.2e-29
WP_023281599.1|3217419_3219921_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004446.1|3220229_3221309_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|3221323_3221644_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184811.1|3221694_3223992_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 230
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3241338	3243222	4658723		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591385.1|3241338_3243222_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	26.8	2.0e-07
>prophage 231
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3251728	3254781	4658723		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|3251728_3252679_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|3253596_3254781_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 232
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3258897	3267226	4658723		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|3258897_3262926_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|3263002_3267226_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 233
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3276443	3278207	4658723		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|3276443_3277115_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|3277157_3277748_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|3277934_3278207_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 234
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3283569	3285159	4658723		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187559.1|3283569_3285159_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 235
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3301719	3305403	4658723		Dickeya_phage(100.0%)	1	NA	NA
WP_000096011.1|3301719_3305403_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 236
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3324689	3325805	4658723		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|3324689_3325805_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 237
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3335020	3335629	4658723		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3335020_3335629_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 238
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3342219	3344767	4658723		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|3342219_3343635_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_023281607.1|3343687_3344767_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	1.8e-29
>prophage 239
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3348954	3352567	4658723		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|3348954_3351777_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|3352030_3352567_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 240
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3356384	3357734	4658723		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|3356384_3357734_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 241
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3363317	3365276	4658723		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078209.1|3363317_3365276_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 242
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3374898	3377046	4658723		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|3374898_3377046_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 243
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3382291	3388660	4658723		Tetraselmis_virus(50.0%)	5	NA	NA
WP_001066021.1|3382291_3384277_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	1.2e-148
WP_001171687.1|3384549_3385479_-	allose kinase	NA	NA	NA	NA	NA
WP_001311314.1|3385462_3386158_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000507106.1|3386168_3387149_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_000235246.1|3387127_3388660_-	D-allose ABC transporter ATP-binding protein AlsA	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	6.3e-20
>prophage 244
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3394790	3396340	4658723		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611405.1|3394790_3395471_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
WP_001075514.1|3395581_3396340_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
>prophage 245
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3401928	3402717	4658723		Pithovirus(100.0%)	1	NA	NA
WP_001565372.1|3401928_3402717_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	1.5e-12
>prophage 246
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3408153	3409656	4658723		Burkholderia_virus(100.0%)	1	NA	NA
WP_001401452.1|3408153_3409656_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	30.8	1.6e-55
>prophage 247
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3430852	3434064	4658723	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295074.1|3430852_3432370_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_164538535.1|3432606_3434064_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	4.0e-48
>prophage 248
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3442597	3444777	4658723		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692350.1|3442597_3442819_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_063091579.1|3442905_3443382_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860074.1|3443397_3443877_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
WP_001234688.1|3443958_3444777_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	2.3e-45
>prophage 249
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3449192	3451564	4658723	integrase	Escherichia_phage(66.67%)	3	3444475:3444487	3452479:3452491
3444475:3444487	attL	AATAATTTCAGGG	NA	NA	NA	NA
WP_001603498.1|3449192_3449414_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	94.5	8.1e-30
WP_053270478.1|3449413_3449791_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	92.0	2.7e-57
WP_063078140.1|3450301_3451564_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	2.6e-80
3452479:3452491	attR	AATAATTTCAGGG	NA	NA	NA	NA
>prophage 250
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3459898	3461882	4658723		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|3459898_3460192_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3460235_3461882_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 251
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3466386	3466923	4658723		Morganella_phage(100.0%)	1	NA	NA
WP_001238379.1|3466386_3466923_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	3.6e-47
>prophage 252
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3471843	3472821	4658723		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|3471843_3472821_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 253
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3481024	3481570	4658723		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|3481024_3481570_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 254
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3485485	3498516	4658723	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
WP_000990333.1|3485485_3486823_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122513.1|3486832_3488680_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	2.6e-60
WP_001280345.1|3488672_3489623_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3489708_3490017_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|3490092_3491373_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|3491458_3492718_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3492720_3493725_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089296.1|3493806_3494004_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3494107_3495406_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177644.1|3495610_3496036_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|3496074_3498516_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
>prophage 255
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3502448	3503612	4658723		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943964.1|3502448_3503612_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
>prophage 256
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3543663	3550151	4658723		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055072.1|3543663_3544194_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|3544503_3545460_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000210557.1|3545599_3547102_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001297255.1|3547115_3548138_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|3548124_3549120_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|3549152_3550151_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 257
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3554339	3557101	4658723		Cronobacter_phage(50.0%)	2	NA	NA
WP_001106239.1|3554339_3554804_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
WP_000187776.1|3554962_3557101_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 258
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3560739	3566836	4658723		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_023281621.1|3560739_3561687_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|3561871_3561925_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|3562065_3564762_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_023281622.1|3564967_3565354_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3565426_3565888_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|3565900_3566836_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 259
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3575192	3584468	4658723	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_000416391.1|3575192_3578048_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_000786399.1|3578047_3578491_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3578844_3580356_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|3580622_3581723_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|3581722_3582805_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_053272848.1|3582965_3584468_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
>prophage 260
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3589597	3592365	4658723	integrase	Acanthamoeba_polyphaga_mimivirus(50.0%)	2	3579804:3579816	3596450:3596462
3579804:3579816	attL	TAATCCCGGCGGC	NA	NA	NA	NA
WP_000061766.1|3589597_3590617_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.4e-44
WP_001219052.1|3591096_3592365_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.0	4.8e-82
3596450:3596462	attR	TAATCCCGGCGGC	NA	NA	NA	NA
>prophage 261
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3599155	3600616	4658723		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|3599155_3600616_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 262
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3607184	3607739	4658723		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151855.1|3607184_3607739_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 263
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3620318	3625685	4658723		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919544.1|3620318_3621983_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410144.1|3622031_3623393_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091573.1|3623609_3624524_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106021.1|3624662_3625685_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.7	2.7e-11
>prophage 264
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3628912	3630192	4658723		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|3628912_3629650_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098830.1|3629652_3630192_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 265
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3638130	3641006	4658723		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|3638130_3639720_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|3640112_3640718_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3640844_3641006_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 266
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3646944	3648267	4658723		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|3646944_3648267_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 267
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3655010	3660365	4658723		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093813.1|3655010_3656243_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_000046749.1|3656549_3658217_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_095157621.1|3658427_3660365_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 268
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3663648	3665762	4658723		Bacillus_phage(50.0%)	2	NA	NA
WP_001188664.1|3663648_3664338_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
WP_001219615.1|3664337_3665762_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.0	1.4e-08
>prophage 269
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3677530	3687948	4658723	transposase	Cyanophage(20.0%)	10	NA	NA
WP_000130189.1|3677530_3678484_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
WP_001094682.1|3678598_3679186_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|3679220_3679787_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102383.1|3679935_3680649_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843568.1|3680674_3681079_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|3681455_3683372_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118473.1|3683460_3684591_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	3.6e-28
WP_001300563.1|3684737_3685850_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000935262.1|3686043_3686253_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_000681368.1|3686781_3687948_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
>prophage 270
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3694986	3697803	4658723	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286865.1|3694986_3697803_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 271
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3702246	3703395	4658723		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|3702246_3703395_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 272
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3708989	3714650	4658723		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000351353.1|3708989_3710543_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	1.6e-34
WP_001565450.1|3710616_3711834_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|3711962_3713105_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787118.1|3713135_3714650_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	1.6e-07
>prophage 273
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3722547	3725301	4658723		Bacillus_phage(50.0%)	4	NA	NA
WP_000624375.1|3722547_3723027_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_089642142.1|3723325_3723793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094322565.1|3723828_3724428_-	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_164538539.1|3724452_3725301_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	8.1e-09
>prophage 274
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3733060	3738482	4658723		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001116994.1|3733060_3735967_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035666.1|3736130_3738482_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.6	1.0e-37
>prophage 275
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3744930	3745629	4658723		Planktothrix_phage(100.0%)	1	NA	NA
WP_001565455.1|3744930_3745629_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	3.6e-23
>prophage 276
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3758331	3760056	4658723		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001295534.1|3758331_3760056_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 277
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3786145	3787189	4658723		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|3786145_3787189_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 278
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3791434	3791986	4658723		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|3791434_3791986_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 279
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3800613	3802038	4658723		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|3800613_3802038_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 280
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3809687	3816310	4658723		Mamastrovirus(33.33%)	5	NA	NA
WP_001189600.1|3809687_3811238_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001306211.1|3811439_3813830_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|3814035_3814572_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|3814612_3815275_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|3815383_3816310_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 281
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3819572	3820475	4658723		Sodalis_phage(100.0%)	1	NA	NA
WP_000339954.1|3819572_3820475_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	7.4e-61
>prophage 282
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3823865	3830671	4658723	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174632.1|3823865_3825284_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937398.1|3825322_3826249_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|3826285_3826741_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_032256326.1|3826918_3827623_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294674.1|3827637_3828168_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001300640.1|3828241_3830671_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.9	7.9e-41
>prophage 283
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3835866	3836664	4658723		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|3835866_3836664_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 284
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3842575	3842920	4658723		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|3842575_3842920_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 285
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3846849	3848274	4658723	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|3846849_3848274_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 286
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3860871	3861630	4658723		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|3860871_3861630_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 287
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3870458	3874574	4658723		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569430.1|3870458_3871055_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|3871091_3874574_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
>prophage 288
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3887577	3888609	4658723		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|3887577_3888609_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 289
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3895119	3902751	4658723		Indivirus(25.0%)	9	NA	NA
WP_000997050.1|3895119_3895923_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	1.4e-39
WP_000648577.1|3895919_3896834_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3897074_3897875_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000016012.1|3897878_3898502_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000644685.1|3898549_3899908_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052717.1|3899979_3900735_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|3900768_3901491_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3901487_3901955_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001300756.1|3902019_3902751_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.1	1.3e-39
>prophage 290
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3918267	3922186	4658723		Caulobacter_phage(50.0%)	6	NA	NA
WP_000284050.1|3918267_3918846_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|3919051_3919819_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|3919789_3920530_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615983.1|3920685_3920964_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729703.1|3920966_3921227_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_024192679.1|3921436_3922186_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
>prophage 291
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3936152	3939110	4658723		Hokovirus(50.0%)	2	NA	NA
WP_000859525.1|3936152_3936548_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.7	6.6e-30
WP_001143108.1|3936665_3939110_-	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	43.2	7.2e-34
>prophage 292
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3968230	3979578	4658723	integrase	Enterobacteria_phage(37.5%)	13	3969716:3969730	3977069:3977083
WP_000749863.1|3968230_3969286_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|3969573_3970677_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
3969716:3969730	attL	TGACGTCGGGCGCGA	NA	NA	NA	NA
WP_000893278.1|3970688_3971942_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_089592180.1|3972297_3973512_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	1.4e-134
WP_077580828.1|3973655_3974375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048241341.1|3974590_3974788_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	45.3	3.0e-07
WP_023063312.1|3974787_3975222_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	55.7	3.8e-31
WP_096159113.1|3975300_3976005_+	ash family protein	NA	NA	NA	NA	NA
WP_164538549.1|3975997_3976177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096171345.1|3976173_3976488_+	ubiquinol-cytochrome C reductase	NA	NA	NA	NA	NA
WP_063100848.1|3976484_3976748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106719819.1|3976802_3977144_+	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	47.2	1.4e-23
3977069:3977083	attR	TGACGTCGGGCGCGA	NA	NA	NA	NA
WP_164538550.1|3977136_3979578_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	38.6	1.6e-137
>prophage 293
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	3983616	3985815	4658723		Acinetobacter_phage(100.0%)	1	NA	NA
WP_053286015.1|3983616_3985815_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	26.1	1.9e-38
>prophage 294
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4004640	4005966	4658723		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001046307.1|4004640_4005966_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
>prophage 295
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4011541	4017461	4658723	holin	Catovirus(50.0%)	4	NA	NA
WP_001159094.1|4011541_4013212_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089110.1|4013225_4014698_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001335745.1|4014711_4015299_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|4015427_4017461_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 296
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4028848	4029898	4658723		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_000692754.1|4028848_4029898_+	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
>prophage 297
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4038670	4040557	4658723		Staphylococcus_phage(100.0%)	1	NA	NA
WP_164538553.1|4038670_4040557_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.2	1.6e-52
>prophage 298
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4043755	4044655	4658723		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952503.1|4043755_4044655_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 299
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4049967	4054247	4658723		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_164538554.1|4049967_4053042_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	99.8	0.0e+00
WP_000805902.1|4053164_4054247_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
>prophage 300
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4059657	4061618	4658723		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044314.1|4059657_4060608_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013499.1|4060604_4061618_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 301
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4065197	4066307	4658723		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|4065197_4066307_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 302
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4071605	4072373	4658723		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939399.1|4071605_4072373_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-25
>prophage 303
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4076095	4076962	4658723	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_164538400.1|4076095_4076962_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	4.3e-50
>prophage 304
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4081920	4083078	4658723		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830738.1|4081920_4083078_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 305
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4090493	4091609	4658723		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|4090493_4091609_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 306
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4095898	4105974	4658723		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|4095898_4096810_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219309.1|4096934_4097843_+	fructokinase	NA	NA	NA	NA	NA
WP_001306939.1|4098089_4099274_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001556449.1|4099399_4102543_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001564482.1|4102539_4103742_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113939.1|4103931_4104621_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	5.7e-37
WP_001556452.1|4104678_4105974_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	3.8e-26
>prophage 307
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4112926	4121907	4658723	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|4112926_4114054_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|4114076_4114409_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|4114436_4116284_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|4116294_4117266_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_021570705.1|4117394_4117742_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|4117918_4118803_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001326929.1|4119101_4119641_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|4119791_4120241_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150457.1|4120244_4121348_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	2.8e-54
WP_001021161.1|4121436_4121907_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 308
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4143467	4148514	4658723	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|4143467_4144091_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_164538557.1|4144216_4145491_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.6	8.7e-132
WP_001295325.1|4145678_4148033_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|4148241_4148514_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 309
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4151642	4152338	4658723		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817220.1|4151642_4152338_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	5.5e-88
>prophage 310
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4155661	4159208	4658723		Bacillus_phage(100.0%)	2	NA	NA
WP_001235649.1|4155661_4157434_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-49
WP_001256201.1|4157426_4159208_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	2.3e-42
>prophage 311
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4168044	4171194	4658723		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|4168044_4171194_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 312
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4178202	4186764	4658723		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|4178202_4178754_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122013.1|4178882_4180814_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|4180866_4181196_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|4181195_4181801_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_053286022.1|4181910_4183785_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.1	4.7e-118
WP_001220233.1|4183965_4184610_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250103.1|4184845_4185808_+	ferrochelatase	NA	NA	NA	NA	NA
WP_164538558.1|4185804_4186764_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	3.8e-15
>prophage 313
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4195008	4198170	4658723		Escherichia_phage(50.0%)	2	NA	NA
WP_000806442.1|4195008_4195350_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000083955.1|4195665_4198170_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
>prophage 314
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4202709	4203387	4658723		Bacillus_virus(100.0%)	1	NA	NA
WP_001157540.1|4202709_4203387_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
>prophage 315
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4206523	4207210	4658723		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|4206523_4207210_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 316
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4215113	4216342	4658723	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_088895425.1|4215113_4216342_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 317
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4222819	4224601	4658723		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_164538560.1|4222819_4224601_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	2.7e-38
>prophage 318
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4231568	4232714	4658723		Streptococcus_phage(100.0%)	1	NA	NA
WP_001333621.1|4231568_4232714_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
>prophage 319
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4244291	4247422	4658723	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_000912345.1|4244291_4245677_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143558.1|4245712_4246234_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4246341_4246554_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|4246555_4247422_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
>prophage 320
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4254420	4255437	4658723	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001407551.1|4254420_4255437_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
>prophage 321
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4261505	4262189	4658723		Bacillus_phage(100.0%)	1	NA	NA
WP_000770953.1|4261505_4262189_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 322
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4265459	4268603	4658723		Leptospira_phage(100.0%)	1	NA	NA
WP_000573945.1|4265459_4268603_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
>prophage 323
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4274547	4275916	4658723	transposase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_085947770.1|4274547_4275916_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
>prophage 324
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4282335	4288378	4658723		Tupanvirus(50.0%)	3	NA	NA
WP_000077805.1|4282335_4286217_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
WP_000096692.1|4286432_4287566_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|4287562_4288378_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 325
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4302925	4304748	4658723		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502936.1|4302925_4303555_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	3.8e-56
WP_000029825.1|4303527_4304748_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	2.1e-58
>prophage 326
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4307931	4310046	4658723		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|4307931_4309497_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278509.1|4309617_4310046_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 327
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4325471	4326118	4658723		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|4325471_4325681_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939747.1|4325734_4326118_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 328
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4331708	4334147	4658723		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|4331708_4332920_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231430.1|4333058_4334147_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 329
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4341157	4343740	4658723	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001297565.1|4341157_4343740_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 330
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4350679	4354212	4658723		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367875.1|4350679_4352350_-	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.6	4.0e-76
WP_001207520.1|4352433_4353369_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|4353486_4354212_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 331
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4360095	4361175	4658723		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|4360095_4361175_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 332
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4365270	4366935	4658723		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|4365270_4366935_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 333
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4371701	4375580	4658723	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023104.1|4371701_4373648_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|4373915_4375580_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 334
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4379860	4380625	4658723		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773301.1|4379860_4380625_-	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 335
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4388878	4401599	4658723		Bacillus_phage(25.0%)	8	NA	NA
WP_000186076.1|4388878_4389556_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
WP_001310640.1|4389552_4392237_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_001300431.1|4392229_4392802_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087939.1|4392810_4394859_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
WP_000741131.1|4394881_4396555_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|4396554_4396644_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424924.1|4396956_4397163_+	YbfA family protein	NA	NA	NA	NA	NA
WP_164538563.1|4397405_4401599_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	5.5e-26
>prophage 336
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4408106	4411156	4658723		Hokovirus(50.0%)	2	NA	NA
WP_000207142.1|4408106_4409525_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	3.1e-61
WP_001032689.1|4409674_4411156_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 337
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4414534	4415326	4658723		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114026.1|4414534_4415326_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	31.5	2.2e-08
>prophage 338
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4451503	4455023	4658723		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|4451503_4452223_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951292.1|4452219_4453161_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|4453274_4453655_-	periplasmic protein	NA	NA	NA	NA	NA
WP_001109196.1|4453970_4455023_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 339
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4459376	4465950	4658723		Tupanvirus(33.33%)	7	NA	NA
WP_001265438.1|4459376_4460393_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
WP_000096869.1|4460653_4462126_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001147439.1|4462193_4462982_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|4463110_4463260_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000101984.1|4463426_4464200_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|4464199_4464889_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891692.1|4464891_4465950_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
>prophage 340
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4476306	4477596	4658723		Klosneuvirus(100.0%)	1	NA	NA
WP_164538564.1|4476306_4477596_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	4.1e-20
>prophage 341
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4484077	4484986	4658723		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|4484077_4484986_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 342
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4495583	4507546	4658723		Anomala_cuprea_entomopoxvirus(16.67%)	11	NA	NA
WP_000996107.1|4495583_4497320_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000976400.1|4497312_4498311_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|4498310_4498982_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007101.1|4499210_4500575_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145126.1|4500806_4501289_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
WP_001340191.1|4501408_4503559_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_000386551.1|4503586_4504549_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_164538565.1|4504689_4505775_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|4506003_4506264_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146343.1|4506528_4506795_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000990177.1|4506868_4507546_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
>prophage 343
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4510911	4511172	4658723		Erwinia_phage(100.0%)	1	NA	NA
WP_000710619.1|4510911_4511172_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 344
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4514855	4520080	4658723		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569083.1|4514855_4515578_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
WP_001159065.1|4515574_4516234_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|4516372_4517119_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|4517522_4518026_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|4518324_4519212_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|4519446_4519512_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|4519564_4520080_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 345
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4525077	4533419	4658723		Tupanvirus(33.33%)	6	NA	NA
WP_000961458.1|4525077_4526670_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000168797.1|4526910_4528176_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114272.1|4528327_4529143_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209342.1|4529288_4531721_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
WP_001295295.1|4531726_4532626_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001336208.1|4532756_4533419_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.5	2.8e-25
>prophage 346
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4536634	4538506	4658723		Planktothrix_phage(100.0%)	1	NA	NA
WP_001301279.1|4536634_4538506_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 347
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4550618	4551821	4658723		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001300708.1|4550618_4551821_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
>prophage 348
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4558329	4647971	4658723	integrase,capsid,portal,tail,terminase,lysis,protease,head,plate,tRNA	Salmonella_phage(58.06%)	92	4555370:4555385	4651683:4651698
4555370:4555385	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_001471277.1|4558329_4559361_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.1	2.5e-105
WP_001321204.1|4559547_4559739_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
WP_016245839.1|4559754_4560324_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	1.9e-38
WP_001247707.1|4560449_4560671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164538567.1|4560703_4561213_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	2.2e-86
WP_000956182.1|4561220_4561421_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000963473.1|4561384_4561726_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_001244167.1|4561793_4562027_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	93.5	5.0e-30
WP_000752613.1|4562026_4562254_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104155.1|4562250_4563105_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	91.9	3.6e-150
WP_001420002.1|4563110_4563932_+	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	75.7	1.1e-122
WP_164538568.1|4563931_4566304_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.1	0.0e+00
WP_001154431.1|4566457_4566646_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|4566656_4566890_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_039516388.1|4567215_4568418_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	36.2	2.9e-60
WP_039516390.1|4568380_4569298_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_039516393.1|4569345_4570374_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.7	4.0e-172
WP_001098411.1|4570373_4572140_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_001459608.1|4572282_4573116_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	3.1e-122
WP_000742510.1|4573132_4574191_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_164538569.1|4574194_4574845_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	94.9	4.7e-110
WP_000673523.1|4574940_4575405_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868175.1|4575404_4575608_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|4575611_4575827_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069905.1|4575807_4576320_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000727851.1|4576321_4576699_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
WP_023135316.1|4576695_4577124_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	1.9e-46
WP_001595569.1|4577219_4577651_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	9.9e-72
WP_023135313.1|4577643_4578090_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.5e-62
WP_039516405.1|4578158_4578737_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	3.6e-93
WP_001583421.1|4578733_4579093_+	lysozyme family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	1.5e-52
WP_164538570.1|4579079_4579988_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	4.6e-143
WP_001086820.1|4579980_4580586_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
WP_001752131.1|4582441_4582876_+|tail	caudovirales tail fiber assembly family protein	tail	A0A0F7LDZ0	Escherichia_phage	43.4	6.5e-23
WP_164538393.1|4582847_4583441_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	62.4	2.5e-57
WP_164538571.1|4583440_4583953_-|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	62.3	2.5e-45
WP_103488341.1|4583983_4584550_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.8	8.4e-87
WP_103488340.1|4584692_4585865_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	1.0e-203
WP_001504081.1|4585874_4586390_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_001281016.1|4586444_4586747_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_001513105.1|4586761_4586881_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	84.6	8.2e-13
WP_164538572.1|4586873_4589951_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	61.4	0.0e+00
WP_000980384.1|4589947_4590433_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	1.8e-66
WP_164538573.1|4590429_4591530_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.8	1.2e-177
WP_000972391.1|4591620_4591839_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|4592074_4593760_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|4594029_4594407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195240.1|4594436_4594694_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|4594853_4595141_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000684321.1|4595906_4596809_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|4596896_4597373_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126073.1|4597723_4598836_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|4598930_4600064_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001093854.1|4600073_4601027_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061665.1|4601023_4601869_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|4601928_4602417_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149756.1|4602457_4603585_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_001295339.1|4603783_4604515_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|4604805_4605474_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|4605473_4606190_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|4606196_4606928_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|4606945_4607674_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270734.1|4607891_4608407_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|4608532_4608856_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001252135.1|4608852_4609683_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_164538589.1|4609679_4610693_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136577.1|4610791_4612222_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566372.1|4612232_4613234_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815337.1|4613270_4614989_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
WP_000178677.1|4615121_4616090_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458809.1|4616101_4617754_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|4617897_4618797_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|4619291_4619987_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599802.1|4620412_4622071_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001340333.1|4622067_4623018_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746443.1|4623174_4624290_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188144.1|4624286_4626233_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|4626305_4626530_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4626852_4627173_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|4627203_4629480_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|4630164_4630383_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|4630667_4631372_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202175.1|4631413_4633135_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001043598.1|4633135_4634902_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_000537418.1|4635024_4635990_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|4636534_4637029_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_164538574.1|4637163_4641153_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|4641311_4641923_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|4641933_4643277_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|4643367_4644660_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850303.1|4644898_4647343_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|4647353_4647971_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
4651683:4651698	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 349
NZ_CP047455	Escherichia coli strain ZF31 chromosome, complete genome	4658723	4654279	4658462	4658723	integrase	Escherichia_phage(33.33%)	9	4648479:4648490	4656229:4656240
4648479:4648490	attL	GTTGTTGAGTCT	NA	NA	NA	NA
WP_000067977.1|4654279_4655077_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023391.1|4655108_4656104_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000072552.1|4656197_4656509_-	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
4656229:4656240	attR	GTTGTTGAGTCT	NA	NA	NA	NA
WP_000022051.1|4656613_4656970_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_001005162.1|4656980_4657151_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217682.1|4657147_4657648_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	99.4	1.7e-91
WP_000557703.1|4657711_4657936_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277958.1|4657935_4658238_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_001113264.1|4658237_4658462_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
>prophage 1
NZ_CP047460	Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence	118248	8739	75765	118248	integrase,transposase	Escherichia_phage(14.29%)	55	27277:27336	67188:68009
WP_001120888.1|8739_10233_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_094315248.1|10830_12453_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.1	9.9e-32
WP_094315247.1|13021_13750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094315246.1|13694_14024_+	GrpB family protein	NA	NA	NA	NA	NA
WP_052259183.1|15791_16697_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(42)	NA	NA	NA	NA	NA
WP_052259184.1|17089_17827_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|17823_18048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001447541.1|19783_20668_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_058657119.1|20884_22099_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001255015.1|22126_22432_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001445143.1|24069_24321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|24214_24517_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|24603_25419_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_085940648.1|25508_26598_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_072202717.1|26795_27275_-	phenol hydroxylase	NA	NA	NA	NA	NA
27277:27336	attL	TGGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACAT	NA	NA	NA	NA
WP_001067855.1|27330_28035_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_052935596.1|29591_30338_-	LysO family transporter	NA	NA	NA	NA	NA
WP_015060468.1|30494_30983_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_053884015.1|31149_32358_-	MFS transporter	NA	NA	NA	NA	NA
WP_000200069.1|34437_35448_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.9	6.7e-87
WP_000523812.1|36188_37355_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
WP_000817037.1|37354_38326_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	89.7	1.7e-156
WP_000534920.1|39273_39579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000181753.1|39632_39884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000457544.1|39962_41234_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
WP_001776124.1|41233_41659_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
WP_023281075.1|42110_43076_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.3e-58
WP_013438824.1|43247_43424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001776120.1|43555_43987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232861.1|44018_44546_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
WP_000909125.1|44538_45285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033546593.1|45299_47207_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_052935737.1|49086_50076_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	34.9	1.1e-06
WP_001067855.1|50819_51524_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000843494.1|53062_53260_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_001398208.1|53300_55778_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.4	2.9e-83
WP_000758229.1|55875_56316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020219104.1|56402_59549_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.4	2.1e-62
WP_001381488.1|59559_60852_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246155.1|60965_61319_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_164538592.1|61346_62732_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_000697969.1|62921_63602_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
WP_000555737.1|63594_65070_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000790483.1|65320_65752_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_025670887.1|65895_66204_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	50.6	8.8e-14
WP_077881175.1|66197_66512_-	hypothetical protein	NA	U5P0U6	Shigella_phage	100.0	5.4e-35
WP_001067855.1|66488_67193_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001814923.1|67958_68075_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
67188:68009	attR	ATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCCAGTGTAGACCAACTCATTACAGAGGGGGAAAATACAAAGACCGTCCACTCTGCTTATATAGTGAGTGTCTATGTAGACAGTACTGGAAATATGGTCCTCATTAAGAATCCGACCATTACTAGCATACCAAAGAAATCAGACTATAAACCAAAAGCTATTGAAAGTGAGGGTACGGTTGATTCCATTACAACCAATGAAATCAATGAGTTTTTAACGACGTTCTTCAAGCTCTATCCTACAGCGACAGCCAGTGAACTTTCCTACTATGTGAATGACGGGATATTAAAACCAATCGGAAAAGAGTACATCTTTCAAGAACTGGTAAATCCTATTTACAATCGTAAGGATAATCAAGTCACGGTATCGCTGACAGTGGAGTATATCGACCAGCAGACCAAAGCAACGCAGGTATCTCAATTTGATTTGGTACTTGAAAAGAACGGGAGTAATTGGAAGATTATAGAATAACAAATATTGGTACATTATTACAGCTATTTTGTAATCACGTACTCTCTTTGATAAAAAATTGGAGATTCCTTTACAAATATGCTCTTACGTGCTATTATTTAAGTATCTATTTAAAAGGAGTTAATAAATATGCGGCAAGGTATTCTTAAATAAACTGTCAATTTGATAGTGGGAACAAATAATTGGATGTCCTTTTTTAGGAGGGCTTAGTTTTTTGTACCCAGTTTAAGAATACCTTTATCATGTGATTCTAAAGTATCCGGAGAATATCTGTATGCTTTGTATGCCTATGGTT	NA	NA	NA	NA
WP_025989258.1|68090_70010_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A2K5B2A5	Erysipelothrix_phage	96.4	0.0e+00
WP_164538594.1|70062_70329_-	MerR family DNA-binding protein	NA	NA	NA	NA	NA
WP_001351729.1|72089_72482_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|72619_73504_+	EamA family transporter	NA	NA	NA	NA	NA
WP_094304126.1|73535_74735_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001493764.1|74840_75491_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|75522_75765_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP047460	Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence	118248	92712	98473	118248	transposase	Burkholderia_phage(16.67%)	8	NA	NA
WP_000516402.1|92712_93375_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
WP_000203396.1|93755_94400_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	28.3	3.4e-07
WP_000565612.1|94554_94638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|94904_95609_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011264039.1|95681_95921_+	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_000612791.1|96066_96930_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|96967_97213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|97681_98473_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
