The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025982	Enterobacteriaceae bacterium A-F18 chromosome, complete genome	5676372	209924	259429	5676372	integrase,transposase	Shigella_phage(25.0%)	52	225515:225530	253790:253805
WP_085949497.1|209924_211072_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_107224790.1|211372_211648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107223494.1|212422_213382_+	cation transporter	NA	A0A1V0SED0	Indivirus	27.3	8.8e-20
WP_107223493.1|213613_213976_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_107223492.1|214063_214801_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	43.0	7.7e-16
WP_107223500.1|215025_217158_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.5	9.1e-126
WP_107223491.1|218208_218565_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_107223490.1|220011_220647_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_107223488.1|221898_222783_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_107223487.1|223256_223715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107223486.1|223806_224175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107223485.1|224187_224499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107223499.1|224611_224908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107223484.1|224993_225596_+	hypothetical protein	NA	NA	NA	NA	NA
225515:225530	attL	CGACCGGGAACATTTT	NA	NA	NA	NA
WP_107223483.1|225709_226162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107223481.1|227310_228240_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_107223480.1|228348_229029_+	SAM-dependent DNA methyltransferase	NA	A0A2K9V411	Faecalibacterium_phage	34.3	4.3e-29
WP_107223479.1|229130_229682_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_107223478.1|229823_230489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107223477.1|230485_231169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107223498.1|231173_231710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107223476.1|231774_232986_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_107223497.1|233069_233939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107223475.1|234248_234812_-	pili assembly chaperone	NA	NA	NA	NA	NA
WP_107223474.1|235012_236644_+	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_107223473.1|236683_237640_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_081309886.1|238044_238170_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_165157985.1|238216_238570_-	toxin	NA	NA	NA	NA	NA
WP_165157986.1|238615_238810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165157987.1|238821_239154_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_165157988.1|239197_239677_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_165157989.1|239687_240143_-	antirestriction protein	NA	NA	NA	NA	NA
WP_165157990.1|240230_241049_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	37.1	1.4e-42
WP_165157991.1|241132_241474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165157992.1|241494_241959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165157993.1|242356_243244_-	GTP-binding protein HSR1	NA	NA	NA	NA	NA
WP_103280762.1|243341_244268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103280761.1|245339_245924_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_165157994.1|246009_246216_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_165157995.1|246334_246736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165157996.1|246802_247198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071194599.1|248165_248384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108700727.1|248518_249757_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_165157997.1|250333_250504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165157998.1|250515_251721_+	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_165157999.1|251720_252626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165158000.1|252622_252994_+	radical SAM protein	NA	NA	NA	NA	NA
WP_165159628.1|253491_254850_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	47.7	2.4e-116
253790:253805	attR	AAAATGTTCCCGGTCG	NA	NA	NA	NA
WP_165158001.1|256312_256738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047736989.1|256791_257106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023339480.1|257125_257512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165158002.1|258260_259429_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	95.4	3.1e-176
>prophage 2
NZ_CP025982	Enterobacteriaceae bacterium A-F18 chromosome, complete genome	5676372	788581	822783	5676372	terminase,integrase,tail	Salmonella_phage(40.0%)	47	782020:782035	821430:821445
782020:782035	attL	AGATGATTTGGCAGCA	NA	NA	NA	NA
WP_039079791.1|788581_790048_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	1.3e-86
WP_039079792.1|790110_791688_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_165158123.1|791879_793130_+|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	79.2	4.6e-194
WP_165158124.1|793144_793702_-	hypothetical protein	NA	A0A173GC52	Salmonella_phage	42.3	1.4e-30
WP_165158125.1|793709_794018_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	59.8	9.0e-27
WP_165158126.1|794180_794777_-	adenine methylase	NA	G9L699	Escherichia_phage	85.9	6.5e-98
WP_165158127.1|794773_795061_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	67.4	1.1e-29
WP_165158128.1|795057_795219_-	DUF1317 family protein	NA	A0A193GYJ8	Enterobacter_phage	69.6	5.0e-13
WP_165158129.1|795211_795583_-	PerC family transcriptional regulator	NA	M1F166	Salmonella_phage	55.1	6.0e-33
WP_165158130.1|795608_795863_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	70.4	2.3e-28
WP_165158131.1|795908_796931_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	94.1	3.8e-178
WP_165158132.1|796940_797840_-	endonuclease	NA	Q858E0	Salmonella_phage	91.3	3.6e-156
WP_165158133.1|797836_798136_-	hypothetical protein	NA	Q858D9	Salmonella_phage	49.5	2.6e-15
WP_165158134.1|798132_798375_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	44.7	1.9e-08
WP_165158135.1|798382_799450_-	hypothetical protein	NA	A0A2H4JIB1	uncultured_Caudovirales_phage	80.4	1.1e-34
WP_165158136.1|799591_799753_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	68.3	1.5e-12
WP_165159645.1|799973_800561_-	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	54.4	1.4e-55
WP_165158137.1|800716_800950_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	75.3	7.3e-29
WP_125124487.1|801096_801291_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	54.7	1.8e-12
WP_165158138.1|801287_802349_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	63.2	9.1e-143
WP_165158139.1|802338_803166_+	Pyocin large subunit	NA	T1SA92	Salmonella_phage	81.1	9.3e-127
WP_165158140.1|803294_803759_+	hypothetical protein	NA	A0A193GYM2	Enterobacter_phage	87.0	2.8e-72
WP_165158141.1|803815_804280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165158142.1|804472_804814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165158143.1|804810_805191_+	ead/Ea22-like family protein	NA	G9L662	Escherichia_phage	48.8	1.3e-11
WP_165158144.1|805196_805460_+	hypothetical protein	NA	E5FJ18	Escherichia_phage	43.4	5.9e-11
WP_165157938.1|805456_806107_+	hypothetical protein	NA	C6ZR26	Salmonella_phage	68.9	5.6e-10
WP_165158145.1|806103_806565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165159646.1|806596_806830_+	eaa protein	NA	A0A077SLR0	Escherichia_phage	66.7	4.1e-24
WP_165158146.1|806869_807052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165158147.1|807123_807405_+	hypothetical protein	NA	A0A0K2FI61	Enterobacter_phage	50.6	7.2e-15
WP_165158148.1|807397_807742_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	61.4	1.8e-31
WP_165159648.1|807842_808433_+|terminase	terminase small subunit	terminase	Q858H4	Salmonella_phage	71.5	7.2e-73
WP_165159649.1|808425_809901_+|terminase	terminase	terminase	A0A193GYS2	Enterobacter_phage	89.8	1.9e-268
WP_165158149.1|809942_810374_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.1	3.3e-59
WP_165158150.1|811385_811592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165158151.1|811604_813284_+|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	81.9	1.2e-250
WP_165158152.1|813280_813577_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	73.5	1.7e-35
WP_165158153.1|813579_814311_+	peptidase	NA	G9L6C4	Escherichia_phage	73.5	6.2e-58
WP_165158154.1|814324_815344_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	48.6	7.8e-83
WP_165158155.1|815355_815811_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	47.3	1.1e-15
WP_165158156.1|815824_816001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165158157.1|816063_816669_+	hypothetical protein	NA	G9L6C9	Escherichia_phage	82.1	1.9e-92
WP_125124507.1|816668_819149_+	hypothetical protein	NA	Q858G3	Salmonella_phage	82.0	0.0e+00
WP_165158158.1|819148_819613_+	hypothetical protein	NA	T1SA73	Salmonella_phage	73.4	1.6e-64
WP_165158159.1|819612_820155_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	65.3	5.8e-53
WP_165158160.1|820164_822783_+	transglycosylase SLT domain-containing protein	NA	Q858G0	Salmonella_phage	28.7	1.1e-51
821430:821445	attR	AGATGATTTGGCAGCA	NA	NA	NA	NA
>prophage 3
NZ_CP025982	Enterobacteriaceae bacterium A-F18 chromosome, complete genome	5676372	1308976	1315321	5676372		Enterobacteria_phage(66.67%)	6	NA	NA
WP_165158300.1|1308976_1310386_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	30.9	6.4e-19
WP_041851958.1|1310564_1311458_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	39.9	2.8e-44
WP_165158301.1|1311873_1312962_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.9	1.3e-99
WP_165158302.1|1312980_1313853_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	68.1	2.2e-110
WP_165158303.1|1313877_1314768_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	34.3	5.8e-26
WP_165158304.1|1314772_1315321_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	59.2	3.0e-49
>prophage 4
NZ_CP025982	Enterobacteriaceae bacterium A-F18 chromosome, complete genome	5676372	1684860	1699243	5676372	tRNA	Tupanvirus(11.11%)	16	NA	NA
WP_165158431.1|1684860_1686789_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	2.0e-127
WP_071845866.1|1686792_1687335_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	2.2e-15
WP_001124225.1|1687431_1687629_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_013366084.1|1687727_1688084_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|1688330_1688375_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_041851604.1|1688500_1689484_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	43.2	3.8e-34
WP_165158432.1|1689498_1691886_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.0	4.7e-06
WP_006820203.1|1691890_1692190_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_165158433.1|1692289_1693270_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_041851601.1|1693489_1694041_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_103245554.1|1694037_1694787_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	31.9	1.6e-08
WP_071195364.1|1694863_1695325_+	endopeptidase	NA	A0A217EQL1	Bacillus_phage	35.3	2.9e-13
WP_165158434.1|1695650_1696361_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041851597.1|1696422_1697865_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	37.0	5.5e-58
WP_075203641.1|1697869_1698061_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_041851790.1|1698196_1699243_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	45.9	7.5e-81
>prophage 5
NZ_CP025982	Enterobacteriaceae bacterium A-F18 chromosome, complete genome	5676372	1929929	2045890	5676372	terminase,tail,transposase,integrase,protease,lysis,portal,head,capsid	Enterobacteria_phage(30.11%)	130	1963869:1963892	2039048:2039071
WP_071195522.1|1929929_1930751_-|protease	serine protease	protease	NA	NA	NA	NA
WP_165158514.1|1931027_1931429_-	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_165158515.1|1931728_1932199_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_165158516.1|1932267_1933755_-	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_039078843.1|1934081_1935332_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.3	1.9e-06
WP_079498191.1|1935440_1936337_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_165158517.1|1936467_1937688_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_039078846.1|1937813_1938509_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_039078847.1|1938615_1939764_-	osmoprotectant ABC transporter ATP-binding protein OsmV	NA	G9BWD6	Planktothrix_phage	32.1	2.0e-23
WP_039078848.1|1939763_1940411_-	osmoprotectant ABC transporter permease OsmW	NA	NA	NA	NA	NA
WP_165159673.1|1940950_1942243_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	71.4	5.6e-187
WP_107224296.1|1942298_1942532_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	87.0	8.9e-35
WP_107224325.1|1942539_1942686_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	79.2	1.0e-17
WP_165158518.1|1942685_1943027_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	71.4	5.5e-41
WP_165158519.1|1943026_1943779_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	84.8	4.6e-117
WP_165158520.1|1943790_1944372_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	69.4	3.0e-71
WP_165158521.1|1944371_1944788_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	68.8	5.8e-45
WP_165158522.1|1945005_1945362_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	58.4	2.5e-28
WP_165158523.1|1945538_1945739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165158524.1|1946110_1946338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165158525.1|1946334_1946526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107224305.1|1946522_1946786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165158526.1|1946952_1947372_-	helix-turn-helix domain-containing protein	NA	A0A2I6TCE4	Escherichia_phage	41.7	2.0e-05
WP_165158527.1|1947454_1947673_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	51.7	1.1e-07
WP_165158528.1|1947864_1948308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165157939.1|1948388_1948649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165158529.1|1948745_1949624_+	DNA-binding protein	NA	I6NW17	Burkholderia_virus	48.1	3.2e-61
WP_103278839.1|1949640_1950525_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	61.4	4.7e-76
WP_103278840.1|1950521_1951895_+	AAA family ATPase	NA	Q8W640	Enterobacteria_phage	65.1	1.9e-169
WP_165158530.1|1951891_1952704_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	68.0	1.2e-105
WP_165158531.1|1953560_1953866_+	hypothetical protein	NA	O64361	Escherichia_phage	65.3	7.8e-31
WP_166454498.1|1953871_1954351_+	lysozyme	NA	A0A2H4FND7	Salmonella_phage	54.3	1.8e-45
WP_165158533.1|1954347_1954809_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	59.6	6.3e-40
WP_071196285.1|1954823_1955021_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	86.2	1.0e-23
WP_165158534.1|1955180_1955414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107224314.1|1955590_1956349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075203689.1|1956348_1956696_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	77.2	2.1e-48
WP_165157940.1|1956625_1956865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165158535.1|1956880_1957354_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	61.1	1.2e-46
WP_165158536.1|1957353_1959111_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	88.9	2.9e-311
WP_165158537.1|1959107_1959269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165158538.1|1959258_1960485_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.8	6.5e-201
WP_165158539.1|1960477_1961077_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	80.5	1.2e-88
WP_107224318.1|1961089_1962316_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	68.4	1.6e-151
WP_165158540.1|1962390_1962708_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	54.8	2.8e-23
WP_165158541.1|1962718_1963057_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	62.4	8.4e-34
WP_165158542.1|1963053_1963500_+	HK97 gp10 family phage protein	NA	F1C579	Cronobacter_phage	77.9	2.4e-57
WP_165158543.1|1963496_1963844_+	DUF3168 domain-containing protein	NA	F1C578	Cronobacter_phage	63.5	9.5e-33
1963869:1963892	attL	AACCCGCTCCGGCGGGTTTTTTTA	NA	NA	NA	NA
WP_165158544.1|1963906_1964383_+|tail	phage tail protein	tail	A0A220NRQ0	Escherichia_phage	83.3	3.1e-66
WP_165158545.1|1964435_1964816_+|tail	phage tail protein	tail	A0A220NRP3	Escherichia_phage	64.8	8.2e-38
WP_165158546.1|1965138_1968504_+|tail	phage tail tape measure protein	tail	K7PH87	Enterobacterial_phage	51.6	1.4e-218
WP_165158547.1|1968535_1968877_+|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	52.7	6.3e-29
WP_165158548.1|1968918_1969656_+|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	80.4	1.4e-118
WP_165158549.1|1969657_1970374_+	peptidase P60	NA	M9NZD8	Enterobacteria_phage	66.2	7.1e-99
WP_165158550.1|1970367_1970994_+|tail	tail assembly protein	tail	M9NZA3	Enterobacteria_phage	70.2	2.9e-72
WP_165158551.1|1971046_1975198_+	DUF1983 domain-containing protein	NA	E4WL39	Enterobacteria_phage	68.4	0.0e+00
WP_165158552.1|1975240_1976605_+|tail	tail fiber domain-containing protein	tail	A0A220NRP2	Escherichia_phage	54.9	1.3e-40
WP_047369760.1|1976708_1976948_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	60.3	9.8e-21
WP_165158553.1|1976947_1977232_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	42.4	1.1e-13
WP_165158554.1|1977263_1978142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165158555.1|1978134_1978893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165158556.1|1979027_1979267_-	DinI family protein	NA	K7P6H1	Enterobacteria_phage	79.7	3.4e-29
WP_039078850.1|1980014_1980725_-	osmoprotectant ABC transporter permease OsmY	NA	NA	NA	NA	NA
WP_079498196.1|1980981_1981596_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	34.4	4.4e-25
WP_165158557.1|1981616_1982474_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.6	4.0e-24
WP_079498197.1|1982475_1983093_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.1	8.6e-77
WP_071194302.1|1985696_1986002_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_079498202.1|1986093_1987005_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_165158558.1|1987113_1987752_+	LysE family translocator	NA	NA	NA	NA	NA
WP_039078870.1|1987824_1988544_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_071194299.1|1988562_1989123_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_039078872.1|1989185_1989527_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_165158559.1|1990119_1991145_+	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071194297.1|1992946_1994161_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.3	2.4e-46
WP_165158560.1|1994219_1995554_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_165158561.1|1995761_1997225_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.8	4.9e-46
WP_039078879.1|1997257_1997461_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	56.7	1.9e-12
WP_165158562.1|1997633_1998320_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_165158563.1|1998410_1999160_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_165158564.1|1999332_2001378_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	24.2	2.1e-18
WP_165158565.1|2001528_2002668_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	47.6	3.5e-92
WP_090089222.1|2002642_2002906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165158566.1|2002938_2003214_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	57.1	1.0e-21
WP_165158567.1|2003213_2003432_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	57.4	2.8e-14
WP_165158568.1|2004160_2004400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165158569.1|2004402_2005236_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	75.0	2.2e-107
WP_165157941.1|2005225_2005888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165158570.1|2006019_2006844_-	YfdQ family protein	NA	U5P439	Shigella_phage	63.5	3.2e-95
WP_079497841.1|2006885_2007251_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	68.1	2.6e-41
WP_165158571.1|2007577_2008087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165158572.1|2008314_2008962_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	64.4	3.8e-75
WP_165158573.1|2009065_2009263_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	64.4	3.5e-16
WP_165158574.1|2009291_2009834_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	65.1	2.2e-60
WP_072039796.1|2010004_2010187_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	3.2e-16
WP_165158575.1|2010176_2011073_+	GntR family transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	57.4	4.5e-42
WP_165158576.1|2011511_2012327_+	DNA cytosine methyltransferase	NA	Q1MVI4	Enterobacteria_phage	67.5	9.9e-89
WP_166454499.1|2012461_2013067_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	74.1	1.3e-77
WP_085949497.1|2013063_2014211_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_165158578.1|2014474_2015011_+	lysozyme	NA	K7PM52	Enterobacteria_phage	76.6	1.0e-78
WP_165158579.1|2015007_2015460_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	46.8	1.5e-25
WP_108701573.1|2016517_2016745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079496527.1|2016831_2017005_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_165159674.1|2017313_2017820_+	DNA-packaging protein	NA	O64316	Escherichia_phage	53.7	1.7e-43
WP_041852400.1|2019715_2019922_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	92.6	2.1e-27
WP_132441208.1|2019918_2021508_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	87.9	1.9e-277
WP_165158580.1|2021488_2022841_+	S49 family peptidase	NA	O64320	Escherichia_phage	82.4	2.2e-178
WP_165158581.1|2022850_2023183_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	82.7	6.5e-47
WP_165158582.1|2023250_2024276_+|capsid	major capsid protein	capsid	K7P6G7	Enterobacteria_phage	91.8	1.3e-178
WP_165158583.1|2024317_2024719_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	44.6	1.1e-19
WP_165158584.1|2024731_2025118_+|tail	phage tail protein	tail	K7P6U9	Enterobacteria_phage	67.2	2.1e-41
WP_090089200.1|2025648_2026047_+|tail	phage tail protein	tail	K7P7G5	Enterobacteria_phage	68.9	8.3e-49
WP_165158585.1|2026054_2026786_+|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	69.4	1.6e-90
WP_165158586.1|2026798_2027209_+|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	42.8	1.3e-20
WP_165159675.1|2027205_2027535_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	46.3	7.4e-19
WP_165158587.1|2027515_2028418_+	hypothetical protein	NA	K7PKR0	Enterobacteria_phage	42.5	1.8e-51
WP_023279773.1|2028463_2029432_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	2.9e-180
WP_165158588.1|2029565_2031155_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	45.3	1.7e-92
WP_103279693.1|2031157_2031505_+|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	61.7	4.6e-35
WP_165158589.1|2031501_2032257_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	79.3	4.5e-120
WP_165158590.1|2032258_2032969_+	peptidase P60	NA	K7PGR2	Enterobacteria_phage	84.3	1.1e-123
WP_165158591.1|2033648_2034248_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	74.9	1.7e-77
WP_165158592.1|2034300_2038083_+	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	71.9	0.0e+00
WP_165158593.1|2038082_2039036_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	43.9	7.8e-53
WP_165158594.1|2039084_2040245_+|tail	tail fiber domain-containing protein	tail	A0A220NRP2	Escherichia_phage	54.9	6.4e-41
2039048:2039071	attR	AACCCGCTCCGGCGGGTTTTTTTA	NA	NA	NA	NA
WP_165159676.1|2040858_2042124_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	86.7	6.6e-217
WP_165158595.1|2042250_2042949_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	6.5e-89
WP_165158596.1|2043034_2043355_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.7	4.5e-21
WP_165158597.1|2043399_2044689_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.2	9.3e-166
WP_110296268.1|2044701_2045127_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.1	4.3e-51
WP_165158598.1|2045218_2045890_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	62.2	1.4e-80
>prophage 6
NZ_CP025982	Enterobacteriaceae bacterium A-F18 chromosome, complete genome	5676372	2972160	2988760	5676372	transposase,plate	Pectobacterium_phage(76.92%)	14	NA	NA
WP_165158879.1|2972160_2975277_-	hypothetical protein	NA	H9C1B5	Pectobacterium_phage	55.8	1.1e-07
WP_125124991.1|2975280_2976186_-	DUF2612 domain-containing protein	NA	H9C1B4	Pectobacterium_phage	61.3	1.9e-93
WP_125124992.1|2976172_2977390_-|plate	phage baseplate protein	plate	H9C1B3	Pectobacterium_phage	60.2	8.6e-129
WP_108701641.1|2977389_2977740_-	hypothetical protein	NA	H9C1B2	Pectobacterium_phage	60.3	2.3e-34
WP_165158880.1|2978476_2979364_-	hypothetical protein	NA	H9C1B0	Pectobacterium_phage	62.7	4.2e-109
WP_108701644.1|2979356_2979647_-	hypothetical protein	NA	H9C1A9	Pectobacterium_phage	59.4	6.5e-27
WP_165159733.1|2980289_2981882_-	glycoside hydrolase family 104 protein	NA	H9C1A7	Pectobacterium_phage	47.8	1.2e-135
WP_108701648.1|2982493_2982898_-	hypothetical protein	NA	H9C1A3	Pectobacterium_phage	70.1	4.5e-50
WP_108701649.1|2982915_2984073_-	DUF3383 family protein	NA	H9C1A2	Pectobacterium_phage	61.6	3.9e-139
WP_165158881.1|2984653_2985103_-	hypothetical protein	NA	H9C199	Pectobacterium_phage	42.6	5.9e-27
WP_165159735.1|2985645_2986080_-|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	40.0	8.0e-21
WP_108701652.1|2986268_2986847_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	50.0	3.5e-40
WP_108701653.1|2987512_2988199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165158882.1|2988358_2988760_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	56.4	5.6e-37
>prophage 7
NZ_CP025982	Enterobacteriaceae bacterium A-F18 chromosome, complete genome	5676372	3015971	3108229	5676372	terminase,tail,holin,integrase,protease,lysis,portal,head,capsid,tRNA	Enterobacteria_phage(34.15%)	95	3050130:3050145	3108443:3108458
WP_039078599.1|3015971_3016631_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	2.6e-47
WP_039078598.1|3016722_3017049_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_039078597.1|3017045_3017339_-	acylphosphatase	NA	NA	NA	NA	NA
WP_165158898.1|3017395_3018193_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_107224520.1|3018203_3018758_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_039078595.1|3018967_3020179_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_039078594.1|3020239_3020557_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_039078761.1|3020582_3020996_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_039078593.1|3021148_3021811_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_039078592.1|3021922_3022381_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_039078590.1|3024587_3025034_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_165158899.1|3025050_3027180_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_039078588.1|3027176_3027797_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_039078587.1|3028015_3028516_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_039078586.1|3028882_3029926_+	porin OmpA	NA	NA	NA	NA	NA
WP_039078585.1|3029998_3030451_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_165158900.1|3030634_3032395_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_039078583.1|3032464_3032983_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_039078582.1|3033074_3033242_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_071194678.1|3033495_3034062_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_039078580.1|3034058_3035699_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_039078579.1|3035703_3036957_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_165158901.1|3036971_3038879_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	27.9	1.1e-48
WP_039078577.1|3038891_3041000_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_165158902.1|3041099_3042209_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_039078575.1|3042205_3042748_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_039078574.1|3042916_3043927_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_039078573.1|3044174_3044756_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_039078572.1|3044824_3047437_-	aminopeptidase N	NA	NA	NA	NA	NA
WP_125125009.1|3047852_3048086_+	DinI family protein	NA	K7P6H1	Enterobacteria_phage	87.0	1.6e-31
WP_125125010.1|3048327_3048753_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	46.5	1.4e-25
WP_125125011.1|3048925_3049147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165158903.1|3049162_3050527_-|tail	tail fiber domain-containing protein	tail	A0A220NRP2	Escherichia_phage	55.5	2.6e-41
3050130:3050145	attL	TTTTTTGCCAGCGACT	NA	NA	NA	NA
WP_166454496.1|3050569_3054727_-	DUF1983 domain-containing protein	NA	Q9MCR7	Enterobacteria_phage	67.3	0.0e+00
WP_125125014.1|3054778_3055393_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	69.6	1.0e-69
WP_165158904.1|3055426_3055885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125125015.1|3055914_3056625_-	peptidase P60	NA	K7PGR2	Enterobacteria_phage	84.3	2.6e-125
WP_125125016.1|3056626_3057382_-|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	79.3	4.5e-120
WP_110296711.1|3057378_3057717_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	76.8	6.0e-48
WP_125125017.1|3057716_3061097_-|tail	phage tail tape measure protein	tail	K7PH87	Enterobacterial_phage	52.4	5.0e-227
WP_107224714.1|3061155_3061497_-	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	51.7	4.2e-17
WP_107224703.1|3061755_3062022_-	DUF4035 domain-containing protein	NA	K7P7L5	Enterobacteria_phage	69.3	6.0e-27
WP_125125018.1|3062045_3062426_-|tail	phage tail protein	tail	A0A220NRP3	Escherichia_phage	65.6	1.8e-37
WP_107224829.1|3062476_3062947_-|tail	phage tail protein	tail	A0A220NRQ0	Escherichia_phage	84.6	5.5e-68
WP_107224322.1|3063009_3063357_-	DUF3168 domain-containing protein	NA	F1C578	Cronobacter_phage	61.7	3.6e-32
WP_107224321.1|3063353_3063800_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	77.2	5.4e-57
WP_107224320.1|3063796_3064135_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	64.0	1.5e-35
WP_110296789.1|3064143_3064461_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	54.8	2.8e-23
WP_107224318.1|3064535_3065762_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	68.4	1.6e-151
WP_071196294.1|3065774_3066374_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	80.0	2.8e-88
WP_125125020.1|3066366_3067593_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	1.3e-201
WP_165158537.1|3067582_3067744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107224316.1|3067740_3069498_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	88.5	1.6e-309
WP_107224315.1|3069497_3069971_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	89.2	2.9e-77
WP_075203689.1|3070154_3070502_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	77.2	2.1e-48
WP_107224314.1|3070501_3071260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165158534.1|3071436_3071670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071196285.1|3071829_3072027_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	86.2	1.0e-23
WP_107224312.1|3072041_3072494_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	56.8	4.1e-28
WP_107224311.1|3072490_3073027_-	lysozyme	NA	K7PM52	Enterobacteria_phage	77.5	2.3e-78
WP_079498699.1|3073026_3073242_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	80.3	3.1e-26
WP_155033999.1|3073914_3074067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107224310.1|3074063_3074900_-	hypothetical protein	NA	A0A1B2IGT1	Erwinia_phage	74.8	8.5e-112
WP_103278841.1|3075281_3076094_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	68.0	5.7e-105
WP_107224309.1|3076090_3077062_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	78.0	1.1e-147
WP_125125706.1|3077058_3078645_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	81.3	2.2e-241
WP_125125022.1|3079323_3079518_-	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	53.3	1.7e-10
WP_125125023.1|3079622_3080324_+	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	77.6	9.7e-101
WP_125125024.1|3080464_3080818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125125025.1|3080888_3081317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125125026.1|3081423_3081645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125125027.1|3081637_3081991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165158905.1|3081980_3082214_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	48.6	1.1e-11
WP_125125028.1|3082444_3082951_+	hypothetical protein	NA	F1C5A2	Cronobacter_phage	61.3	5.2e-56
WP_125125029.1|3082966_3083239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125125030.1|3083235_3083601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125125031.1|3083593_3083917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107224296.1|3083924_3084158_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	87.0	8.9e-35
WP_125125032.1|3084213_3085503_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	79.4	3.7e-207
WP_071194680.1|3085702_3086905_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_079496807.1|3086977_3088141_-	amidohydrolase	NA	NA	NA	NA	NA
WP_165158906.1|3088160_3089399_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_165158907.1|3089426_3090716_-	septum formation initiator	NA	NA	NA	NA	NA
WP_165158908.1|3090833_3092048_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_165159737.1|3092377_3092839_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_039078567.1|3093031_3094432_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.0	7.6e-81
WP_146194805.1|3095018_3096116_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	51.2	4.6e-97
WP_071194681.1|3096301_3097492_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_039078564.1|3097538_3098186_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_039078563.1|3098213_3098762_-	YcbK family protein	NA	NA	NA	NA	NA
WP_039078562.1|3098948_3100808_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_039078561.1|3100986_3105435_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_039078560.1|3105434_3106139_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_039078559.1|3106119_3107442_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_039078558.1|3107434_3108229_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
3108443:3108458	attR	AGTCGCTGGCAAAAAA	NA	NA	NA	NA
>prophage 8
NZ_CP025982	Enterobacteriaceae bacterium A-F18 chromosome, complete genome	5676372	3892129	3955680	5676372	terminase,transposase,integrase,lysis,plate	Escherichia_phage(39.62%)	83	3902012:3902057	3949554:3949599
WP_165159119.1|3892129_3893240_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	2.9e-06
WP_165159120.1|3893263_3894432_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.8	9.0e-168
WP_165159121.1|3895491_3896214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165159122.1|3896305_3897778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165159123.1|3899376_3900523_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_165159124.1|3900650_3901847_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	1.7e-129
3902012:3902057	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_165159125.1|3902233_3903211_-	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	33.6	9.3e-09
WP_165159126.1|3903363_3903726_+	GtrA family protein	NA	U5P0S6	Shigella_phage	73.3	2.5e-44
WP_165159127.1|3903722_3904652_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.3	8.5e-145
WP_165159128.1|3904638_3905082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165159129.1|3905056_3906283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165159130.1|3906300_3908328_-	hypothetical protein	NA	I6XKW3	Burkholderia_virus	28.8	4.3e-08
WP_165159131.1|3908401_3909106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165159132.1|3909107_3910526_-|plate	baseplate J-like family protein	plate	NA	NA	NA	NA
WP_165159133.1|3910522_3910855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165159134.1|3910851_3911568_-	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	36.8	3.4e-24
WP_165159135.1|3911564_3912539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165159136.1|3912538_3912814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107224183.1|3912810_3913536_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	37.9	4.6e-29
WP_165159137.1|3913535_3915356_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	38.5	7.5e-20
WP_165159138.1|3915479_3916046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165159139.1|3916049_3916487_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	35.4	1.1e-22
WP_165159140.1|3916489_3917884_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	37.8	1.2e-73
WP_165159141.1|3917884_3918820_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	36.6	6.1e-50
WP_165159142.1|3918803_3919238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165159143.1|3919234_3919663_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	40.6	2.9e-23
WP_165159144.1|3919659_3920145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165159145.1|3920221_3921253_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	46.4	2.1e-75
WP_165159146.1|3921269_3922139_-	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	39.9	3.1e-24
WP_165159147.1|3922154_3923771_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_165159148.1|3923774_3924605_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	44.2	3.6e-54
WP_165159149.1|3924601_3926020_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	35.7	1.1e-87
WP_165159150.1|3926031_3927363_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	59.4	4.2e-153
WP_165159151.1|3927365_3928106_-	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	33.0	3.8e-15
WP_165159152.1|3928164_3928959_-	hypothetical protein	NA	A0A2H4ZJ80	Enterobacter_phage	76.6	2.9e-24
WP_165159153.1|3929107_3929368_-	DUF1378 family protein	NA	NA	NA	NA	NA
WP_165159154.1|3929364_3929895_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	57.4	3.4e-29
WP_165159155.1|3929891_3930428_-	lysozyme	NA	K7PM52	Enterobacteria_phage	88.0	2.2e-89
WP_165159156.1|3930430_3930682_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_165159157.1|3931028_3931718_-	antiterminator	NA	I6PDF8	Cronobacter_phage	46.8	2.5e-53
WP_165159158.1|3931836_3932193_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	60.7	1.4e-39
WP_165159159.1|3932189_3932480_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	90.6	2.4e-45
WP_165159765.1|3932472_3932643_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	69.1	5.7e-15
WP_165159160.1|3932642_3933098_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	73.5	5.7e-62
WP_165159161.1|3933329_3933584_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	72.0	5.3e-25
WP_165159162.1|3933616_3933856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165157943.1|3933858_3934257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165157944.1|3934253_3934904_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	71.1	1.9e-10
WP_165158144.1|3934900_3935164_-	hypothetical protein	NA	E5FJ18	Escherichia_phage	43.4	5.9e-11
WP_165159163.1|3935169_3935859_-	hypothetical protein	NA	Q8HAA6	Salmonella_phage	34.8	2.3e-14
WP_165159164.1|3935855_3936257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165159165.1|3936253_3936523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165159166.1|3936515_3937028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165159167.1|3937024_3937312_-	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_165159168.1|3937311_3938028_-	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	63.6	6.2e-79
WP_165159169.1|3938011_3938935_-	hypothetical protein	NA	K7P6V7	Enterobacteria_phage	68.1	1.6e-103
WP_165159170.1|3939021_3939342_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	66.0	2.7e-34
WP_165159171.1|3939375_3939600_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	92.0	8.0e-33
WP_165159767.1|3939743_3940412_+	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	66.2	1.2e-84
WP_165159172.1|3940487_3940883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165159173.1|3940899_3941415_+	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_165159174.1|3941425_3941794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165159175.1|3941817_3942009_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	46.0	5.2e-09
WP_110294696.1|3942411_3942576_+	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_165159176.1|3942572_3942770_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_165159177.1|3942852_3943248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165159178.1|3943241_3943400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165159179.1|3943383_3944043_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	35.0	1.9e-21
WP_165159180.1|3944046_3944715_+	ATP-binding protein	NA	A0A2D1GLT5	Escherichia_phage	45.0	5.5e-45
WP_165159769.1|3944730_3945435_+	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	34.6	6.4e-20
WP_165159181.1|3945418_3945601_+	hypothetical protein	NA	G8C7S7	Escherichia_phage	48.1	5.7e-05
WP_165159182.1|3945593_3946151_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	58.9	1.1e-59
WP_165159183.1|3946147_3947212_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	64.4	1.1e-140
WP_165159184.1|3947208_3947430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165159185.1|3947426_3947618_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	6.0e-13
WP_165159186.1|3947614_3947902_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	67.4	1.1e-29
WP_165159187.1|3947898_3948117_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	58.8	2.1e-14
WP_165159188.1|3948378_3949539_+|integrase	site-specific integrase	integrase	K7PKD7	Enterobacteria_phage	85.0	1.0e-200
WP_165159189.1|3949745_3950999_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	8.9e-97
3949554:3949599	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_047371693.1|3951010_3952114_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.5e-60
WP_041852619.1|3952410_3953490_+	porin	NA	Q1MVN1	Enterobacteria_phage	59.6	3.3e-116
WP_165159190.1|3953659_3954931_-	amino acid deaminase	NA	NA	NA	NA	NA
WP_079497616.1|3954942_3955680_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	9.4e-30
>prophage 9
NZ_CP025982	Enterobacteriaceae bacterium A-F18 chromosome, complete genome	5676372	5584770	5593853	5676372	integrase,protease	uncultured_Caudovirales_phage(33.33%)	11	5584580:5584597	5594970:5594987
5584580:5584597	attL	TATCAGTTCATGCCGTAT	NA	NA	NA	NA
WP_165159593.1|5584770_5585994_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	73.2	7.9e-183
WP_165159594.1|5585990_5586785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165159595.1|5586880_5587087_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	82.4	6.2e-24
WP_165159596.1|5587207_5587513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165159597.1|5587722_5587977_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_165159598.1|5587969_5588170_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	43.6	4.3e-06
WP_165159599.1|5588174_5588474_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_165159600.1|5588470_5590597_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.5	5.6e-200
WP_165159601.1|5591040_5591235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165159602.1|5591231_5593148_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	57.4	3.4e-212
WP_165159604.1|5593367_5593853_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	52.0	3.5e-33
5594970:5594987	attR	TATCAGTTCATGCCGTAT	NA	NA	NA	NA
>prophage 1
NZ_CP025983	Enterobacteriaceae bacterium A-F18 plasmid pAF18_1, complete sequence	140420	34534	86804	140420	transposase,integrase,bacteriocin	uncultured_Caudovirales_phage(30.77%)	47	32633:32646	71980:71993
32633:32646	attL	TGCGTTTCACTATC	NA	NA	NA	NA
WP_142518526.1|34534_35227_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	82.3	1.2e-47
WP_142518458.1|36367_37378_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	57.2	1.0e-87
WP_142518459.1|38213_39380_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.2	2.6e-223
WP_142518460.1|39379_40351_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	85.6	6.6e-148
WP_142518461.1|41406_41640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165159868.1|41673_41841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142518462.1|42552_42963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142518463.1|43093_43375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142518464.1|43497_43836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142518465.1|43946_44213_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_165159870.1|44269_44401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142518466.1|44517_45249_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_142518467.1|45254_45572_+	theronine dehydrogenase	NA	NA	NA	NA	NA
WP_165159890.1|45817_45970_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_142518528.1|46163_46421_-	DUF2767 family protein	NA	NA	NA	NA	NA
WP_142518468.1|46967_47186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165159872.1|49543_50179_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_103255461.1|50728_51031_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_103255462.1|51035_51302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158643684.1|52582_52729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142518469.1|52816_52996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103255463.1|53468_53627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103255464.1|53702_53975_+	plasmid replication protein	NA	NA	NA	NA	NA
WP_103255465.1|53971_54184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103255466.1|54180_54564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103255467.1|55034_55268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165159862.1|55701_56127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165159874.1|57214_58552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103255470.1|61714_62683_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.9	3.0e-15
WP_142518470.1|63957_65025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103255474.1|65027_65891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103255472.1|65907_66897_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	39.7	9.3e-49
WP_142518471.1|67282_69352_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_142518472.1|70120_70942_+	RepA	NA	NA	NA	NA	NA
WP_142518473.1|71806_72865_+	hypothetical protein	NA	NA	NA	NA	NA
71980:71993	attR	TGCGTTTCACTATC	NA	NA	NA	NA
WP_142518474.1|72858_73131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142518475.1|73456_73678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114073.1|74532_74886_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
WP_000783215.1|74933_75296_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_115465306.1|75313_77065_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_000922630.1|77113_78403_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.5e-171
WP_000065758.1|78415_78841_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
WP_004118313.1|78871_79276_-	arsenic transporter ATPase	NA	NA	NA	NA	NA
WP_001556711.1|79284_79857_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	89.0	2.0e-83
WP_001000602.1|83632_84784_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.7	6.7e-99
WP_001067855.1|84976_85681_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|86099_86804_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP025983	Enterobacteriaceae bacterium A-F18 plasmid pAF18_1, complete sequence	140420	99277	110545	140420	transposase	uncultured_Caudovirales_phage(55.56%)	13	NA	NA
WP_004213585.1|99277_101683_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
WP_032743892.1|101768_102209_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_016151343.1|102371_103070_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.4	4.5e-90
WP_047368857.1|103155_103476_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	6.5e-20
WP_047368891.1|103520_104810_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.6	1.2e-168
WP_047368856.1|104822_105248_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.1	1.9e-51
WP_165159876.1|105590_106454_-	conjugal transfer protein TraX	NA	A0A077JBM8	Xanthomonas_phage	38.0	1.9e-05
WP_103244856.1|106724_107162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103244857.1|107158_107842_-	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.1	8.0e-84
WP_158643685.1|108054_108252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103244858.1|108269_108641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165159878.1|108681_109209_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.5	1.6e-18
WP_165159880.1|109528_110545_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	3.5e-184
>prophage 1
NZ_CP025984	Enterobacteriaceae bacterium A-F18 plasmid pAF18_2, complete sequence	42923	21848	41118	42923	transposase,integrase	uncultured_Caudovirales_phage(30.77%)	18	36675:36688	41421:41434
WP_011091028.1|21848_22724_+	class A extended-spectrum beta-lactamase CTX-M-3	NA	A0A1B0VBP7	Salmonella_phage	82.1	5.4e-125
WP_001114073.1|23050_23404_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
WP_000783215.1|23451_23814_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_115465306.1|23831_25583_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_000922630.1|25631_26921_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.5e-171
WP_000065758.1|26933_27359_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
WP_004118313.1|27389_27794_-	arsenic transporter ATPase	NA	NA	NA	NA	NA
WP_001556711.1|27802_28375_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	89.0	2.0e-83
WP_012817690.1|28538_31547_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
WP_001000602.1|32151_33303_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.7	6.7e-99
WP_001067855.1|33495_34200_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001516695.1|35279_35936_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_014839983.1|36254_36869_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	47.4	8.1e-35
36675:36688	attL	CCATACGACCAGCG	NA	NA	NA	NA
WP_001389365.1|37119_37884_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|38026_38293_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|38513_38987_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|39142_40156_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001749988.1|40548_41118_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
41421:41434	attR	CCATACGACCAGCG	NA	NA	NA	NA
