The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040038	Klebsiella pneumoniae strain KPC160125 chromosome, complete genome	5405706	57257	68911	5405706	integrase	Enterobacteria_phage(70.0%)	15	45391:45405	68448:68462
45391:45405	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|57257_59591_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|59602_59923_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|59919_60147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072028197.1|60143_60695_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|60697_60964_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_004903606.1|61068_61206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889917.1|61505_62243_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889919.1|62239_62485_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889930.1|62502_63069_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_020802988.1|63141_63291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152979.1|63637_64063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|64062_65013_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|65000_66191_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|66543_67797_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|67807_68911_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
68448:68462	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 2
NZ_CP040038	Klebsiella pneumoniae strain KPC160125 chromosome, complete genome	5405706	647738	677873	5405706	capsid,tail,lysis,head,plate,portal,integrase,terminase	Salmonella_phage(81.25%)	38	647646:647664	677945:677963
647646:647664	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_014342959.1|647738_648719_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
WP_004178082.1|649206_650694_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001154434.1|650794_650983_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|650993_651227_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|651341_652019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|652294_654037_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|654098_655124_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|655123_656890_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|657032_657866_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|657882_658941_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|658944_659595_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|659690_660155_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|660154_660358_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|660361_660577_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|660557_661067_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|661071_661455_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|661451_661880_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896170.1|661866_662013_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896172.1|661975_662407_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|662399_662846_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004199112.1|662842_663352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004226282.1|663350_663515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|663629_664202_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_002896179.1|664198_664561_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896182.1|664547_665456_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|665448_666048_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_004152882.1|666049_669001_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_002896186.1|669004_669736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004232615.1|669774_669936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|669965_671042_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|671180_672353_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|672362_672878_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|672930_673230_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|673244_673364_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_014342962.1|673590_675984_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
WP_002896224.1|675980_676466_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|676462_677563_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|677654_677873_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
677945:677963	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 3
NZ_CP040038	Klebsiella pneumoniae strain KPC160125 chromosome, complete genome	5405706	712289	721753	5405706	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|712289_713405_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|713401_715342_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|715418_715640_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|715965_716283_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|716313_718593_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|718713_718932_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004141853.1|719285_720005_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|720031_721753_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 4
NZ_CP040038	Klebsiella pneumoniae strain KPC160125 chromosome, complete genome	5405706	818257	844211	5405706	protease,head,integrase,tail	Pectobacterium_phage(22.22%)	39	818182:818197	832947:832962
818182:818197	attL	ACCGCCTGAAACTGGC	NA	NA	NA	NA
WP_002898458.1|818257_818917_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
WP_004150834.1|819186_820839_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016197576.1|821114_822143_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.1	4.4e-94
WP_004199480.1|822146_822371_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	68.1	4.5e-20
WP_004141609.1|822580_822766_-	hypothetical protein	NA	H9C155	Pectobacterium_phage	44.3	8.1e-07
WP_009308318.1|822767_823334_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	61.5	2.5e-51
WP_159225338.1|823333_825463_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.6	8.9e-97
WP_159225339.1|825507_825741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159225337.1|826681_827083_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	60.2	2.7e-39
WP_024623103.1|827162_827357_+	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	45.9	1.7e-07
WP_022644597.1|827417_827864_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.1	5.7e-30
WP_046387639.1|827947_828106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060617680.1|828108_829101_+	hypothetical protein	NA	A0A067ZIA1	Vibrio_phage	55.5	2.6e-30
WP_159225336.1|829097_830486_+	replicative DNA helicase	NA	Q8HA30	Enterobacteria_phage	46.6	1.3e-104
WP_009308333.1|830524_831175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009308334.1|831178_831412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009308335.1|831451_832237_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	2.4e-63
WP_159225335.1|832364_832919_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	46.4	2.1e-05
WP_159225334.1|832915_833122_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	94.1	1.2e-30
832947:832962	attR	ACCGCCTGAAACTGGC	NA	NA	NA	NA
WP_159225333.1|833118_833481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159225332.1|833480_833774_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	85.6	7.7e-44
WP_159225353.1|833857_834223_+	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	62.2	2.5e-31
WP_159225351.1|834215_834455_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	2.9e-09
WP_159225350.1|834454_834793_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	82.0	9.5e-46
WP_029499143.1|834974_835166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048256710.1|835234_835828_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	71.6	2.7e-80
WP_071838911.1|835817_836141_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	55.8	1.8e-25
WP_004199527.1|836128_836476_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159225349.1|836481_836922_+	hypothetical protein	NA	R9TRJ4	Aeromonas_phage	43.8	3.6e-13
WP_159225348.1|836962_837487_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	54.1	6.2e-44
WP_004199520.1|837548_837782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199477.1|837765_838026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071035057.1|838032_838485_+	DNA-packaging protein	NA	A3EYX3	Salmonella_phage	67.2	1.5e-49
WP_009308353.1|838569_839964_+	hypothetical protein	NA	A0A0E3JIA1	Rhodoferax_phage	36.9	3.1e-58
WP_064185222.1|839963_841628_+|head,tail	phage head-tail adapter protein	head,tail	A0A221SAN2	Ralstonia_phage	39.4	3.1e-105
WP_159225352.1|841630_841954_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_159225347.1|841940_842693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159225346.1|842703_843699_+	hypothetical protein	NA	W6MW28	Pseudomonas_phage	60.6	7.0e-105
WP_004191050.1|843737_844211_+	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	46.3	1.8e-26
>prophage 5
NZ_CP040038	Klebsiella pneumoniae strain KPC160125 chromosome, complete genome	5405706	1189956	1231698	5405706	integrase,terminase	Klebsiella_phage(34.04%)	62	1188037:1188051	1196977:1196991
1188037:1188051	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152144.1|1189956_1190718_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|1190934_1192467_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|1192665_1193214_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|1193410_1194592_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|1194572_1194815_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004198245.1|1194774_1194921_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_014343018.1|1194993_1195227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218013.1|1195469_1195583_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	4.6e-13
WP_004152151.1|1195678_1195903_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|1195892_1196603_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|1196608_1197127_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
1196977:1196991	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|1197231_1198059_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|1198055_1198250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|1198246_1198672_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004146412.1|1198668_1198791_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_004152157.1|1198858_1199113_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004218017.1|1199105_1199267_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
WP_004152159.1|1199640_1199829_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|1199821_1200136_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|1200306_1200975_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|1201072_1201294_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|1201870_1203529_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|1203530_1204493_+	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|1204489_1204966_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|1204962_1205745_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004152168.1|1205811_1205967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218026.1|1206004_1206133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004146526.1|1206150_1206399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152169.1|1206401_1206932_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|1206928_1207318_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|1207552_1207873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218030.1|1208238_1208727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152172.1|1208677_1210078_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|1210315_1211767_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|1211822_1212371_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|1212422_1213625_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|1213628_1214123_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|1214134_1215076_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|1215115_1215397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|1215365_1215785_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|1215781_1216288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|1216287_1216674_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|1216768_1217209_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|1217212_1218358_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004199809.1|1218368_1218809_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152564.1|1218812_1219238_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|1219273_1219426_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|1219415_1221419_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004225238.1|1221604_1222018_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.9	8.1e-31
WP_004217362.1|1222093_1222321_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152569.1|1222323_1223346_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|1223345_1223687_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004173705.1|1223739_1223925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004225248.1|1224177_1224528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|1224581_1225235_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|1225236_1225590_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|1225589_1226786_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_108714555.1|1226782_1227556_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	8.2e-77
WP_004231600.1|1228030_1228195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004231602.1|1228315_1228447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152577.1|1228421_1228619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343022.1|1228674_1231698_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	44.7	1.6e-22
>prophage 6
NZ_CP040038	Klebsiella pneumoniae strain KPC160125 chromosome, complete genome	5405706	1456628	1467515	5405706		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|1456628_1457249_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|1457241_1458507_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|1458518_1459421_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|1459681_1460443_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|1460463_1461324_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|1461621_1461882_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|1461968_1463057_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|1463087_1464353_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151613.1|1464407_1467515_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 7
NZ_CP040038	Klebsiella pneumoniae strain KPC160125 chromosome, complete genome	5405706	2519113	2532430	5405706	transposase	Escherichia_phage(22.22%)	12	NA	NA
WP_039819511.1|2519113_2520118_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
WP_045327201.1|2520186_2520381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004144151.1|2520517_2520640_+	small membrane protein	NA	NA	NA	NA	NA
WP_077255456.1|2521331_2521436_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_039819510.1|2523050_2524217_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_039819508.1|2524396_2524951_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
WP_004175259.1|2524965_2525856_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_039819507.1|2525887_2526757_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.3e-110
WP_039819536.1|2526770_2527835_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
WP_039819506.1|2527989_2529360_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
WP_004180506.1|2529381_2530797_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_000043543.1|2531023_2532430_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 8
NZ_CP040038	Klebsiella pneumoniae strain KPC160125 chromosome, complete genome	5405706	2575774	2582679	5405706	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|2575774_2577253_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|2577249_2577972_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_039819857.1|2578290_2579652_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	1.1e-206
WP_004151134.1|2579894_2580791_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_039819854.1|2581031_2581805_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	6.6e-26
WP_004180551.1|2581815_2582679_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 9
NZ_CP040038	Klebsiella pneumoniae strain KPC160125 chromosome, complete genome	5405706	2882574	2944778	5405706	capsid,tail,transposase,protease,tRNA,terminase,holin	Salmonella_phage(41.18%)	60	NA	NA
WP_004152006.1|2882574_2884578_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_002913800.1|2884587_2885463_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_002913801.1|2885582_2886296_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
WP_002913802.1|2886511_2887546_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_002913803.1|2887562_2888441_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_002913804.1|2888594_2889161_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_002913805.1|2889164_2889635_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_002913806.1|2889696_2890758_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_004221267.1|2890812_2890929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002913807.1|2890980_2892444_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_002913810.1|2892453_2892813_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_002913812.1|2892940_2893852_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_020947395.1|2893848_2894550_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913824.1|2894648_2895935_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_002913827.1|2896030_2896657_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913829.1|2896874_2898308_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913833.1|2898317_2899211_-	ROK family protein	NA	NA	NA	NA	NA
WP_002913836.1|2899474_2900512_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_004152007.1|2900508_2901150_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
WP_002913838.1|2901330_2903391_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_002913839.1|2903394_2904927_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913841.1|2904980_2907209_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_004174861.1|2907579_2907753_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	78.8	1.4e-16
WP_004221278.1|2907849_2908761_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002913847.1|2908834_2910067_+	MFS transporter	NA	NA	NA	NA	NA
WP_004162150.1|2910360_2911539_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_004152009.1|2911522_2913391_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_071182156.1|2913577_2914078_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	86.9	1.0e-67
WP_165562104.1|2914074_2914704_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	78.4	2.5e-92
WP_023339240.1|2914693_2914999_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_004146394.1|2914985_2915390_-	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_165562105.1|2915583_2915778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009485391.1|2918665_2918962_+	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	8.1e-25
WP_004152453.1|2919052_2919310_+	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	54.1	2.3e-12
WP_004152454.1|2919313_2919511_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	69.8	2.0e-19
WP_157833602.1|2919619_2919808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165562106.1|2919891_2920587_+	anti-repressor protein	NA	A0A193GYJ9	Enterobacter_phage	52.9	1.5e-61
WP_009307977.1|2920781_2921414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152458.1|2921696_2922311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165562107.1|2922320_2925710_-	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	3.7e-121
WP_004152460.1|2925709_2928454_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.2	9.1e-94
WP_048293158.1|2928466_2928964_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	43.6	4.0e-24
WP_165562108.1|2928956_2929427_-	hypothetical protein	NA	Q858G2	Salmonella_phage	54.6	1.1e-44
WP_165562109.1|2929428_2931906_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	58.3	8.6e-277
WP_024622836.1|2931905_2932517_-	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.5	5.4e-47
WP_025367999.1|2932565_2932844_-	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	1.1e-20
WP_004152466.1|2932836_2933229_-	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_110220407.1|2933238_2934246_-|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	4.7e-181
WP_040120462.1|2934258_2934657_-	peptidase	NA	T1SAP9	Salmonella_phage	59.5	1.6e-36
WP_004152470.1|2934965_2935271_-	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_087826981.1|2935267_2936947_-|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	59.1	1.4e-193
WP_004152472.1|2936950_2937154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165562110.1|2937859_2938192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165562111.1|2938350_2939826_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	90.6	2.5e-271
WP_032457429.1|2939822_2940407_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	89.1	5.8e-91
WP_165562112.1|2940464_2940794_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	56.1	6.7e-28
WP_004178082.1|2940872_2942360_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004187425.1|2942758_2943193_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.3	1.2e-29
WP_019725070.1|2943180_2944446_+	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	50.4	2.6e-112
WP_004187413.1|2944568_2944778_-	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	42.0	7.0e-07
>prophage 10
NZ_CP040038	Klebsiella pneumoniae strain KPC160125 chromosome, complete genome	5405706	2961587	2982027	5405706	integrase,transposase	Salmonella_phage(32.0%)	32	2957529:2957543	2988635:2988649
2957529:2957543	attL	TGCCGCCGCCGTGGT	NA	NA	NA	NA
WP_011790968.1|2961587_2962838_+|transposase	IS4-like element IS10A family transposase	transposase	Q9E8P4	Bluetongue_virus	71.4	4.2e-171
WP_004187429.1|2963169_2963427_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_020277900.1|2963395_2963761_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_004178082.1|2963877_2965365_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_110224090.1|2965785_2966124_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.9	1.4e-44
WP_071182193.1|2966116_2966422_-	hypothetical protein	NA	Q7Y3Y0	Yersinia_phage	43.4	1.7e-14
WP_071182194.1|2966506_2967445_-	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	61.8	6.1e-42
WP_040227357.1|2967441_2967867_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	81.5	5.5e-59
WP_165562113.1|2967866_2968256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165562114.1|2968248_2968644_-	hypothetical protein	NA	G8C7U4	Escherichia_phage	79.0	2.6e-58
WP_032441402.1|2968640_2968832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071182197.1|2968815_2969226_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	55.6	7.3e-16
WP_071182195.1|2969418_2969763_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	85.1	6.3e-53
WP_032418532.1|2969882_2970668_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_023285446.1|2970664_2971432_-	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152537.1|2971431_2971641_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_023285447.1|2971787_2972021_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	1.2e-23
WP_004144290.1|2972175_2972757_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004164037.1|2972977_2973127_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004164029.1|2973123_2973423_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_165539442.1|2973419_2973626_+	MarR family transcriptional regulator	NA	A0A173GC36	Salmonella_phage	76.0	6.2e-16
WP_165539440.1|2973622_2974444_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
WP_165539438.1|2974440_2975322_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	83.3	1.9e-133
WP_004144294.1|2975370_2975619_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_009485475.1|2975728_2976022_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_004152545.1|2976014_2976173_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_023285452.1|2976169_2976676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059065281.1|2976672_2977269_+	adenine methylase	NA	T1SA14	Salmonella_phage	92.3	5.3e-108
WP_004243823.1|2977265_2977457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087831089.1|2977473_2978724_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	8.0e-207
WP_004151979.1|2978915_2980493_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004151980.1|2980560_2982027_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
2988635:2988649	attR	TGCCGCCGCCGTGGT	NA	NA	NA	NA
>prophage 11
NZ_CP040038	Klebsiella pneumoniae strain KPC160125 chromosome, complete genome	5405706	3053377	3132978	5405706	lysis,tail,capsid,head,portal,tRNA,integrase,coat,plate,terminase	Salmonella_phage(72.0%)	89	3098072:3098118	3134639:3134685
WP_002914079.1|3053377_3054115_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|3054246_3055578_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|3055623_3056007_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|3056320_3057010_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|3057067_3058153_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|3058356_3058782_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|3058851_3059550_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_004188841.1|3059584_3062236_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|3062356_3063712_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|3063753_3064077_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_108714608.1|3064080_3065379_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.3	6.9e-44
WP_004150973.1|3071344_3073918_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|3074047_3074779_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|3074775_3075756_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|3075887_3076625_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|3076895_3077231_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|3077337_3077385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150975.1|3077485_3078646_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|3078642_3079515_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|3079577_3080699_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|3080708_3081779_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|3082121_3082631_+	YfiR family protein	NA	NA	NA	NA	NA
WP_165539436.1|3082623_3083847_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_002914117.1|3083860_3084343_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|3084351_3085722_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|3085778_3086237_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004220183.1|3086226_3086364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002914145.1|3086356_3086704_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|3086743_3087511_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|3087542_3088091_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|3088109_3088358_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|3088617_3089982_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|3090145_3090937_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|3090956_3092243_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|3092362_3092953_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|3093077_3093956_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914159.1|3094042_3095704_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_004145681.1|3095729_3095870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002914160.1|3095851_3096193_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914161.1|3096259_3096550_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004188817.1|3096539_3097016_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|3097126_3097609_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
3098072:3098118	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_004150980.1|3098212_3098590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150981.1|3098617_3098836_-	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150982.1|3098902_3099997_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150983.1|3099993_3100479_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_072093161.1|3100475_3102872_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_002896220.1|3103098_3103218_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150985.1|3103232_3103532_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_004150986.1|3103584_3104100_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150987.1|3104109_3105282_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150988.1|3105430_3106504_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004200602.1|3106555_3107674_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150990.1|3107683_3109633_-|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004152935.1|3109634_3110306_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150992.1|3110298_3111207_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004150993.1|3111193_3111556_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150994.1|3111552_3112125_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150995.1|3112219_3113086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150996.1|3113108_3113555_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150997.1|3113547_3113970_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_072093160.1|3113932_3114091_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150998.1|3114065_3114494_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150999.1|3114490_3114874_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004151000.1|3114878_3115388_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004134639.1|3115368_3115584_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151001.1|3115587_3115791_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004151002.1|3115790_3116255_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004134644.1|3116350_3117004_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151003.1|3117007_3118060_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004151004.1|3118076_3118910_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_019405037.1|3119050_3120814_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151006.1|3120813_3121857_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_024940854.1|3121913_3122183_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151007.1|3122704_3123706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|3123705_3124785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151009.1|3124771_3125455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151010.1|3125550_3125784_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151011.1|3125795_3125984_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151012.1|3126146_3128531_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151013.1|3128527_3129379_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151014.1|3129375_3129603_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151016.1|3129602_3129836_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004144796.1|3129903_3130242_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151017.1|3130205_3130406_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004151018.1|3130413_3130923_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_001397669.1|3130955_3131198_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151019.1|3131320_3131950_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_004151020.1|3131952_3132978_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
3134639:3134685	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 12
NZ_CP040038	Klebsiella pneumoniae strain KPC160125 chromosome, complete genome	5405706	3852137	3900980	5405706	capsid,tail,protease,head,portal,tRNA,terminase	uncultured_Caudovirales_phage(68.75%)	56	NA	NA
WP_002918465.1|3852137_3852632_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|3852635_3853274_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_135801240.1|3853243_3853528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829818.1|3853585_3853978_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|3853993_3854422_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|3854687_3855815_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|3856005_3856404_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|3856577_3857945_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|3858032_3859091_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|3859227_3860166_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|3860580_3861051_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|3861426_3861690_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|3861788_3862055_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|3862105_3862381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918632.1|3862460_3864428_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|3864433_3865366_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|3865373_3865577_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|3865708_3866638_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|3866673_3868119_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|3868207_3872005_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918644.1|3872042_3873512_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|3873514_3874096_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|3874103_3874592_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|3874591_3875584_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|3875654_3876698_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|3877003_3878944_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|3879023_3879215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|3879443_3880445_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|3880444_3881053_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|3881276_3881729_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|3881751_3882219_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|3882229_3883579_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|3883689_3883932_+	YhdT family protein	NA	NA	NA	NA	NA
WP_002918742.1|3883921_3885373_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|3885384_3886266_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|3886623_3887589_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|3887613_3887910_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004150954.1|3888063_3888255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|3888257_3889919_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|3889902_3890259_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150957.1|3890389_3890542_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_004150959.1|3890534_3890978_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|3890977_3891277_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|3891273_3891609_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|3891605_3892847_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|3892848_3893409_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|3893460_3894627_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|3894890_3895403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|3895451_3895787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|3896129_3898265_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|3898264_3898630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|3898626_3898995_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004218267.1|3899093_3899222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|3899298_3899487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157263200.1|3899479_3899698_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	1.4e-34
WP_004150969.1|3900200_3900980_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
>prophage 13
NZ_CP040038	Klebsiella pneumoniae strain KPC160125 chromosome, complete genome	5405706	4989047	4994872	5405706		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152202.1|4989047_4989614_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|4989631_4989877_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152204.1|4989873_4990611_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_000556592.1|4991171_4991438_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_072093163.1|4991440_4991983_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152205.1|4991979_4992207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152206.1|4992203_4992524_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152207.1|4992538_4994872_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
