The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049885	Acidovorax sp. HDW3 chromosome, complete genome	3152246	723594	730416	3152246		Planktothrix_phage(16.67%)	7	NA	NA
WP_166157246.1|723594_724368_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.0	7.3e-25
WP_166157249.1|724436_724721_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_166157252.1|724739_726026_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	65.2	1.6e-157
WP_166157255.1|726127_726985_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.4	9.5e-42
WP_166157258.1|726988_728638_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	47.8	1.9e-139
WP_166157261.1|728746_729973_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.1	9.5e-35
WP_166157265.1|729969_730416_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	66.0	1.3e-45
>prophage 2
NZ_CP049885	Acidovorax sp. HDW3 chromosome, complete genome	3152246	1534443	1541970	3152246	transposase	Lake_Baikal_phage(33.33%)	8	NA	NA
WP_166160381.1|1534443_1535988_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.4	4.0e-38
WP_166158953.1|1536232_1537225_+|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	28.0	1.5e-06
WP_166158954.1|1537465_1538185_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.7	3.8e-36
WP_166158955.1|1538273_1538612_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_166158956.1|1538620_1540483_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	38.1	1.8e-93
WP_166158957.1|1540515_1541043_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_166158958.1|1541233_1541557_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	55.1	2.1e-26
WP_166158959.1|1541562_1541970_-	Fe-S cluster assembly scaffold IscU	NA	A0A2H4N7M4	Lake_Baikal_phage	76.5	7.0e-51
>prophage 3
NZ_CP049885	Acidovorax sp. HDW3 chromosome, complete genome	3152246	1820839	1883564	3152246	integrase,transposase	Vibrio_phage(18.18%)	58	1871910:1871926	1883940:1883956
WP_166159200.1|1820839_1821991_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_166159201.1|1822090_1822660_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_166160402.1|1822674_1823178_+	RES domain-containing protein	NA	NA	NA	NA	NA
WP_166159202.1|1823217_1824390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166156689.1|1825414_1826236_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.8	7.3e-31
WP_166156690.1|1826225_1827770_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_166159203.1|1828651_1829791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166159204.1|1829796_1830609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166159205.1|1830732_1831881_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_166159206.1|1831877_1832999_-	glucuronyl hydrolase	NA	NA	NA	NA	NA
WP_166159207.1|1832985_1834182_-	MFS transporter	NA	NA	NA	NA	NA
WP_166159208.1|1834178_1835828_-	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.6	5.4e-17
WP_166159209.1|1835824_1837699_-	carnitine dehydratase	NA	NA	NA	NA	NA
WP_166159210.1|1837706_1837979_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_166159211.1|1838005_1838479_-	M67 family metallopeptidase	NA	NA	NA	NA	NA
WP_166159212.1|1838512_1839682_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_166159213.1|1839855_1842381_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	A0A1V0SKB7	Klosneuvirus	27.9	4.8e-25
WP_166159214.1|1842401_1844801_-	decarboxylase	NA	NA	NA	NA	NA
WP_166160403.1|1844907_1846179_-	MFS transporter	NA	NA	NA	NA	NA
WP_166159215.1|1846211_1847246_-	methyltransferase	NA	NA	NA	NA	NA
WP_166159216.1|1847254_1849246_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_166159217.1|1849469_1850414_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_166160404.1|1850952_1851165_-	AlpA family phage regulatory protein	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	44.2	4.9e-08
WP_166159218.1|1851528_1851840_-	HU family DNA-binding protein	NA	A0A249Y2G7	Serratia_phage	44.8	1.3e-09
WP_166159219.1|1853766_1854054_-	DUF2274 domain-containing protein	NA	NA	NA	NA	NA
WP_166159220.1|1854050_1855337_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_166159221.1|1855339_1856347_-	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_166159222.1|1856343_1857051_-	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_166159223.1|1857062_1858439_-	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_166159224.1|1858435_1858711_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_166159225.1|1858722_1859466_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_166159226.1|1859478_1861911_-	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_166159227.1|1861928_1862201_-	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_055403009.1|1862197_1862530_-	TrbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_166159228.1|1862526_1863567_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_166159229.1|1863563_1864028_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_166159230.1|1864024_1866079_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_166159231.1|1866361_1867036_-	LysR family substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_166159232.1|1867119_1868103_+|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	26.8	1.7e-05
WP_166160405.1|1868062_1868335_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166159233.1|1868708_1870685_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_166159234.1|1871048_1871585_-	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_166159235.1|1871581_1872112_-	DUF2840 domain-containing protein	NA	NA	NA	NA	NA
1871910:1871926	attL	ACGGTGCCAGGCACGAA	NA	NA	NA	NA
WP_166159236.1|1872108_1872372_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_166160406.1|1872368_1872995_-	AAA family ATPase	NA	K7R2R7	Vibrio_phage	38.5	9.8e-28
WP_166159237.1|1873150_1874155_-	replication initiator protein A	NA	NA	NA	NA	NA
WP_166160407.1|1874181_1874424_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_166159238.1|1875484_1875826_-	DUF2958 domain-containing protein	NA	A0A1W6DX76	Sphingobium_phage	43.4	1.8e-15
WP_166159239.1|1875982_1876273_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_166159240.1|1876318_1876666_-	DUF2958 domain-containing protein	NA	A0A1W6DX76	Sphingobium_phage	58.9	9.2e-28
WP_166159241.1|1877330_1877639_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_166159242.1|1878134_1878605_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_166159243.1|1878797_1879448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166159244.1|1879888_1880098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166160408.1|1880982_1881162_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	46.3	1.0e-06
WP_166159245.1|1881214_1881424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166159246.1|1881422_1882358_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	30.3	2.1e-26
WP_166159247.1|1882370_1883564_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
1883940:1883956	attR	ACGGTGCCAGGCACGAA	NA	NA	NA	NA
>prophage 4
NZ_CP049885	Acidovorax sp. HDW3 chromosome, complete genome	3152246	2229574	2326186	3152246	capsid,integrase,protease,tRNA,portal,transposase,plate,tail,terminase,head	Burkholderia_phage(16.67%)	107	2238782:2238801	2264313:2264332
WP_166159527.1|2229574_2230342_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_166159528.1|2230352_2230922_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_166159529.1|2231001_2231253_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_166159530.1|2231380_2232055_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.7	1.4e-32
WP_166159531.1|2232047_2233301_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_166159532.1|2233369_2234296_+	phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_166159533.1|2234292_2236008_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A0R6PDC6	Moraxella_phage	31.5	3.6e-24
WP_166159534.1|2236011_2237118_-	acyltransferase	NA	W6MVL2	Pseudomonas_phage	31.1	1.2e-25
WP_166159535.1|2237223_2238987_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
2238782:2238801	attL	TGGCGCTCTACGGCCAGGGC	NA	NA	NA	NA
WP_166159536.1|2239211_2240966_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_166159537.1|2241150_2242788_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_166159538.1|2242932_2243790_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_166159539.1|2243797_2244433_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_166159540.1|2244442_2245111_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_166159541.1|2245140_2246433_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_166159542.1|2246524_2247211_+	DUF3334 family protein	NA	NA	NA	NA	NA
WP_166159543.1|2247526_2248753_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A077KET4	Ralstonia_phage	45.1	2.1e-82
WP_166160429.1|2248815_2249370_-	KilA-N domain-containing protein	NA	A0A2H4IZE1	uncultured_Caudovirales_phage	42.7	4.2e-14
WP_166160430.1|2249710_2250028_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_166159544.1|2250017_2250305_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_166159545.1|2250312_2250504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166159546.1|2250500_2250962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166159547.1|2250961_2251282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166159548.1|2251278_2251521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166159549.1|2251569_2251791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166159550.1|2251787_2252159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166159551.1|2252155_2254132_-	replication endonuclease	NA	R4JJS4	Burkholderia_phage	33.9	3.1e-59
WP_166159552.1|2254135_2254474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166159553.1|2254470_2254623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166159554.1|2254634_2254772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166159555.1|2254762_2255050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166159556.1|2255046_2255637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166160431.1|2255756_2256170_-	ogr/Delta-like zinc finger family protein	NA	E5E3T8	Burkholderia_phage	57.1	4.3e-16
WP_166159557.1|2256233_2256506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166159558.1|2256502_2256706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166159559.1|2256726_2256936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166159560.1|2257047_2257719_+	helix-turn-helix transcriptional regulator	NA	A4JWR8	Burkholderia_virus	54.3	2.7e-15
WP_166159561.1|2257797_2258340_+	zinc chelation protein SecC	NA	NA	NA	NA	NA
WP_166159562.1|2258450_2259008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166159563.1|2259086_2259386_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	51.2	2.9e-14
WP_166159564.1|2259408_2259690_-	excinuclease ABC subunit A	NA	NA	NA	NA	NA
WP_166159565.1|2259731_2260835_-	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	50.6	1.3e-86
WP_166159566.1|2260834_2261287_-|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	54.5	2.3e-34
WP_166159567.1|2261308_2263936_-|tail	phage tail protein	tail	A4PE52	Ralstonia_virus	43.6	2.8e-116
WP_166159568.1|2263963_2264212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166159569.1|2264284_2264413_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
2264313:2264332	attR	TGGCGCTCTACGGCCAGGGC	NA	NA	NA	NA
WP_166160432.1|2264421_2264727_-|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	46.4	9.6e-13
WP_166159570.1|2264819_2265329_-|tail	phage major tail tube protein	tail	E5E3Q2	Burkholderia_phage	59.2	4.2e-53
WP_166159571.1|2265353_2266547_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	58.7	3.1e-131
WP_166159572.1|2266583_2266826_-	pseudouridine synthase	NA	A0A0M5M702	Caulobacter_phage	45.9	3.4e-05
WP_166159573.1|2266822_2267329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166159574.1|2267338_2268049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166155512.1|2268045_2269068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166159575.1|2269082_2272340_-	DUF4815 domain-containing protein	NA	A0A219VHA1	Ochrobactrum_phage	32.0	6.6e-144
WP_166159576.1|2272366_2272852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166159577.1|2272857_2273727_-|tail	phage tail protein	tail	K4I1F8	Acidithiobacillus_phage	32.3	2.5e-13
WP_166159578.1|2273783_2274635_-|plate	baseplate J protein	plate	K4HZB7	Acidithiobacillus_phage	36.9	4.7e-33
WP_166159579.1|2274631_2274985_-	hypothetical protein	NA	A0A2H4JE52	uncultured_Caudovirales_phage	55.2	1.7e-24
WP_166159580.1|2274981_2275581_-|plate	phage baseplate assembly protein V	plate	A0A077K9S0	Ralstonia_phage	34.5	1.7e-16
WP_166159581.1|2275663_2276311_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	27.4	1.0e-11
WP_166159582.1|2276307_2276799_-|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	43.8	1.2e-25
WP_166159583.1|2276782_2277322_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_166159584.1|2277318_2277846_-	lysozyme	NA	I6NW41	Burkholderia_virus	52.2	8.2e-36
WP_166159585.1|2277842_2278085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166159586.1|2278086_2278293_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_166159587.1|2278293_2278782_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	41.7	4.5e-20
WP_166159588.1|2278912_2279617_-|terminase	terminase	terminase	A0A077K804	Ralstonia_phage	43.4	2.1e-34
WP_166159589.1|2279685_2280696_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	56.4	3.5e-104
WP_166159590.1|2280747_2281584_-|capsid	GPO family capsid scaffolding protein	capsid	E5FFI7	Burkholderia_phage	54.0	1.1e-50
WP_166159591.1|2281724_2283527_+|terminase	terminase	terminase	E5FFI8	Burkholderia_phage	61.1	4.3e-209
WP_166159592.1|2283523_2284582_+|portal	phage portal protein	portal	A4JWV0	Burkholderia_virus	60.3	2.4e-111
WP_166159593.1|2284670_2284868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166159594.1|2284897_2285179_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_166159011.1|2285578_2286676_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_166160433.1|2287463_2289170_+	DUF1800 domain-containing protein	NA	NA	NA	NA	NA
WP_166160434.1|2289319_2290594_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_166159595.1|2290583_2291900_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.8	3.9e-95
WP_166159596.1|2291953_2292652_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_166159597.1|2292743_2293691_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_166159598.1|2293690_2294152_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_166159599.1|2294207_2294897_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_166159600.1|2294893_2296075_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_166159601.1|2296071_2296734_+	DNA mismatch repair protein MutS	NA	NA	NA	NA	NA
WP_166159602.1|2297007_2297364_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_166159603.1|2297353_2298736_+	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_166159604.1|2298725_2299157_-	EamA family transporter	NA	NA	NA	NA	NA
WP_166159605.1|2299244_2299460_-	hypothetical protein	NA	K4NZ80	Pseudomonas_phage	44.1	7.0e-10
WP_166159606.1|2299462_2301985_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_166160435.1|2302046_2302892_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_166159607.1|2303139_2306202_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_166159608.1|2306217_2307138_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_166159609.1|2307134_2307761_+	formate dehydrogenase subunit gamma	NA	NA	NA	NA	NA
WP_166159610.1|2307842_2308799_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_166159611.1|2308795_2310220_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_166160436.1|2310245_2311802_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_166159612.1|2311863_2313771_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	28.9	6.2e-17
WP_166159613.1|2313952_2314729_+	metallophosphoesterase	NA	K4K650	Caulobacter_phage	39.8	1.2e-40
WP_166159614.1|2314797_2315514_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_166159615.1|2315529_2316261_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_166159616.1|2316249_2318076_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	26.2	2.8e-06
WP_166159617.1|2318231_2318564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166160437.1|2318586_2319297_+	GTP cyclohydrolase I	NA	A0A1C3NFQ1	Phage_NCTB	52.5	4.6e-58
WP_166159618.1|2319280_2320342_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_166159619.1|2320338_2321430_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_166159620.1|2321500_2322658_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_166159621.1|2322820_2324062_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_166159622.1|2324119_2326186_+|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
