The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049888	Weissella sp. HDW19 chromosome, complete genome	1618880	660	40039	1618880	capsid,holin,protease,integrase,tail,tRNA,plate,portal,terminase,head	Lactococcus_phage(48.15%)	60	2966:2980	40167:40181
WP_166008880.1|660_972_-|holin	phage holin	holin	NA	NA	NA	NA
WP_166008882.1|971_1250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008884.1|1242_1434_-	XkdX family protein	NA	NA	NA	NA	NA
WP_166008886.1|1417_1765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008888.1|1783_3412_-|plate	BppU family phage baseplate upper protein	plate	NA	NA	NA	NA
2966:2980	attL	ATCGATCATTTCTTG	NA	NA	NA	NA
WP_166008890.1|3414_3804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008892.1|3805_4624_-	lysozyme	NA	Q8LTJ6	Lactococcus_phage	49.5	2.0e-52
WP_166008894.1|4626_5703_-	hypothetical protein	NA	A0A0M7RDS2	Lactobacillus_phage	29.6	4.1e-34
WP_166008896.1|5702_6527_-|tail	phage tail family protein	tail	E9LUJ3	Lactobacillus_phage	32.5	7.3e-31
WP_166008897.1|6539_10544_-	tape measure protein	NA	Q9AZL5	Lactococcus_phage	53.7	3.0e-202
WP_166008899.1|10766_11114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008901.1|11190_11844_-|tail	phage tail protein	tail	Q9AZS2	Lactococcus_phage	51.1	1.2e-44
WP_166008903.1|11884_12280_-	DUF806 family protein	NA	NA	NA	NA	NA
WP_166008905.1|12279_12753_-	HK97 gp10 family phage protein	NA	Q9AZL9	Lactococcus_phage	54.9	1.4e-42
WP_166008907.1|12753_13083_-|head	phage head closure protein	head	Q9AZM0	Lactococcus_phage	49.5	1.6e-21
WP_166008909.1|13069_13387_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9AZM1	Lactococcus_phage	50.5	1.1e-16
WP_166008910.1|13395_14682_-|capsid	phage major capsid protein	capsid	Q9AZM2	Lactococcus_phage	70.7	2.7e-109
WP_166008911.1|14668_15259_-|head,protease	HK97 family phage prohead protease	head,protease	Q9AZE1	Lactococcus_phage	59.2	2.9e-58
WP_166008912.1|15255_16341_-|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	57.8	1.1e-108
WP_166008913.1|16327_16504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008914.1|16517_18344_-|terminase	terminase large subunit	terminase	Q9AZM6	Lactococcus_phage	74.3	9.8e-270
WP_166008915.1|18340_18826_-|terminase	phage terminase small subunit P27 family	terminase	A0A0M7REI3	Lactobacillus_phage	37.7	1.9e-18
WP_166011632.1|18934_19432_-	HNH endonuclease	NA	Q9AZM8	Lactococcus_phage	55.5	1.2e-52
WP_166008916.1|19418_19856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008917.1|20167_20584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008918.1|20968_21181_-	hypothetical protein	NA	A0A2H4J069	uncultured_Caudovirales_phage	58.0	1.6e-06
WP_166008919.1|21180_21402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008920.1|21699_22956_-	Fic family protein	NA	Q9AZ49	Lactococcus_phage	33.3	2.2e-50
WP_166008922.1|23071_23536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008924.1|23622_23907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008926.1|23903_24230_-	VRR-NUC domain-containing protein	NA	A0A0M7RDN7	Lactobacillus_phage	65.0	6.4e-31
WP_166008928.1|24248_24467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008930.1|24598_25039_-	hypothetical protein	NA	A0A1I9KKG9	Lactobacillus_phage	38.7	7.3e-22
WP_166008932.1|25040_25190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008934.1|25192_25696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008936.1|25688_25865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166011634.1|25895_26345_-	adenine methyltransferase	NA	A0A2P0ZL79	Lactobacillus_phage	61.9	1.6e-48
WP_166008938.1|26356_27112_-	site-specific DNA-methyltransferase	NA	R9TS71	Vibrio_phage	51.8	8.9e-68
WP_166008940.1|27290_27656_-	helix-turn-helix transcriptional regulator	NA	X2CXD8	Lactobacillus_phage	30.0	2.1e-06
WP_166008942.1|27655_27832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008944.1|28066_28204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008946.1|28233_28413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008948.1|28417_28624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008950.1|28633_29032_-	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_166008952.1|29291_30674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008954.1|30676_31576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008956.1|31582_32164_-	DUF669 domain-containing protein	NA	NA	NA	NA	NA
WP_166008958.1|32166_32841_-	AAA family ATPase	NA	O03911	Lactobacillus_phage	59.4	9.4e-69
WP_166008960.1|32848_33253_-	hypothetical protein	NA	Q0GXW8	Lactococcus_phage	39.4	5.3e-11
WP_166008962.1|33262_33466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008964.1|33546_33891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008966.1|33871_34264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008968.1|34390_34642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008970.1|34669_35023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166008972.1|35035_35239_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_166008974.1|35497_35869_+	helix-turn-helix transcriptional regulator	NA	E3W8B9	Leuconostoc_phage	34.5	2.0e-12
WP_166008976.1|35869_36262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166008978.1|36329_37064_+	hypothetical protein	NA	A0A097BY93	Leuconostoc_phage	87.5	4.7e-05
WP_166008980.1|37239_38379_+|integrase	site-specific integrase	integrase	P97010	Streptococcus_pyogenes_phage	37.5	2.5e-45
WP_166008982.1|38554_40039_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.4	6.2e-89
40167:40181	attR	ATCGATCATTTCTTG	NA	NA	NA	NA
>prophage 2
NZ_CP049888	Weissella sp. HDW19 chromosome, complete genome	1618880	127932	187261	1618880	tRNA,transposase	Bacillus_virus(27.27%)	43	NA	NA
WP_166009137.1|127932_129945_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	37.5	6.2e-92
WP_166009139.1|135752_136709_-	IpaB/EvcA family protein	NA	NA	NA	NA	NA
WP_166009141.1|136705_137965_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_166009143.1|137967_138438_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166011640.1|138694_140869_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.9	3.2e-158
WP_166009145.1|141218_143777_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.2	2.1e-105
WP_166011642.1|143813_145763_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	47.7	2.9e-147
WP_166009147.1|145823_146987_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_166009149.1|146986_147226_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_166009151.1|147433_148564_-	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	24.0	3.9e-19
WP_166009153.1|148767_150147_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_002828338.1|150772_150907_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_166009155.1|151076_151481_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_166009157.1|151461_152313_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_166009159.1|152370_152997_-	signal peptidase I	NA	NA	NA	NA	NA
WP_166009161.1|153137_154487_-	amino acid permease	NA	NA	NA	NA	NA
WP_166009163.1|154831_155503_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_166009165.1|155737_156376_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_166009167.1|156439_157264_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_166009169.1|157495_157663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166009171.1|158263_159085_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_166009173.1|161361_164976_+	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_166009175.1|166836_167496_-	magnesium transporter	NA	G3MA03	Bacillus_virus	44.0	4.8e-17
WP_166009177.1|167776_167986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009179.1|168573_169642_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	34.5	1.0e-24
WP_166009181.1|170340_170820_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_166009183.1|171515_172859_+	Trk family potassium uptake protein	NA	NA	NA	NA	NA
WP_166009185.1|173273_175532_+	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_166009179.1|175509_176578_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	34.5	1.0e-24
WP_166009187.1|176688_177420_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_166009189.1|177995_178694_+	ribonuclease HI	NA	C1KFJ1	Lactobacillus_virus	32.0	4.7e-23
WP_166009191.1|178737_179406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166009193.1|179500_180154_+	DedA family protein	NA	NA	NA	NA	NA
WP_166009195.1|180255_181257_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_166009197.1|182256_182772_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.3	1.2e-31
WP_166009199.1|182834_183155_+	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_166009201.1|183360_184137_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_166009203.1|184141_184585_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_166009205.1|184678_185884_+	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_166011644.1|185938_186055_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_166009207.1|186041_186239_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	48.4	4.7e-05
WP_166009209.1|186365_186530_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_166009211.1|186970_187261_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP049888	Weissella sp. HDW19 chromosome, complete genome	1618880	216169	288471	1618880	capsid,integrase,terminase,plate,portal,transposase	Lactobacillus_phage(23.53%)	85	241268:241297	288705:288734
WP_166009266.1|216169_217239_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	34.5	1.3e-24
WP_166009268.1|217661_217979_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_166011650.1|218080_218647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009270.1|218695_219220_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_166009272.1|220059_220521_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166009274.1|220527_221445_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_166009276.1|222110_222893_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_166009278.1|223076_224708_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	24.7	2.6e-40
WP_166009280.1|225174_226362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009282.1|226380_229503_+	Cna B-type domain-containing protein	NA	NA	NA	NA	NA
WP_166009284.1|229596_230640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009286.1|230825_232808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009288.1|233083_234139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009290.1|234156_234858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009292.1|234882_236265_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_166009294.1|236354_237086_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166009296.1|237150_238515_-	cytosine permease	NA	NA	NA	NA	NA
WP_166009298.1|238841_241295_+	phosphoketolase family protein	NA	NA	NA	NA	NA
241268:241297	attL	TGACTGGAAGTGGTCACCACTTGTTTAATT	NA	NA	NA	NA
WP_166009300.1|241426_242566_-|integrase	site-specific integrase	integrase	P97010	Streptococcus_pyogenes_phage	36.8	8.5e-46
WP_166009302.1|242732_243557_-	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	53.2	2.5e-71
WP_166009304.1|243791_244649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166009306.1|244720_245536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166009307.1|245596_246340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166009309.1|246347_247283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166009312.1|247366_247792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166009314.1|247808_249059_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_166009316.1|249039_249405_-	helix-turn-helix transcriptional regulator	NA	A0A1S7FZ25	Listeria_phage	31.4	1.5e-07
WP_166009318.1|249632_249854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009320.1|249867_250644_+	phage antirepressor	NA	A0A1Q1PVU2	Staphylococcus_phage	58.3	2.2e-82
WP_166009322.1|250703_250925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009324.1|250931_251162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009326.1|251257_251446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009328.1|251724_252249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009330.1|252276_252771_+	siphovirus Gp157 family protein	NA	A0A1J0MFN6	Staphylococcus_phage	48.5	3.0e-32
WP_166009332.1|252781_253507_+	hypothetical protein	NA	D7RWM8	Brochothrix_phage	40.7	2.7e-13
WP_166009334.1|253507_254221_+	hypothetical protein	NA	D7RWH3	Brochothrix_phage	35.5	2.2e-31
WP_166009336.1|254186_254681_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	53.9	5.5e-34
WP_166009338.1|254690_254870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009340.1|255102_255501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009342.1|255689_256718_+	DNA methyltransferase	NA	A0A1B0XVT8	Campylobacter_phage	32.1	8.2e-24
WP_166009344.1|256934_257384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009346.1|257376_257817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009348.1|257818_258070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009350.1|258072_258342_+	hypothetical protein	NA	A0A0C5K6K1	Enterococcus_phage	37.2	1.8e-10
WP_166009352.1|258343_258703_+	hypothetical protein	NA	D2IZL0	Enterococcus_phage	37.7	1.2e-09
WP_166009354.1|258703_258982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009356.1|258968_259151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009358.1|259151_259406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009360.1|259398_259722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009362.1|259827_260896_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	34.5	1.3e-24
WP_166011652.1|261098_261428_+	DUF722 domain-containing protein	NA	E3W8E2	Leuconostoc_phage	33.0	1.5e-08
WP_166009364.1|261773_262679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009366.1|262714_263218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009368.1|263264_263462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009370.1|263561_263807_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	62.1	2.4e-14
WP_166009362.1|263916_264986_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	34.5	1.3e-24
WP_166009372.1|265002_265746_+|terminase	terminase small subunit	terminase	V9QKX0	Oenococcus_phage	46.8	4.5e-32
WP_166011654.1|265732_266962_+|terminase	PBSX family phage terminase large subunit	terminase	A0A182BQ98	Lactococcus_phage	51.9	1.9e-120
WP_166009374.1|266962_268378_+|portal	phage portal protein	portal	A0A1P8BLJ1	Lactococcus_phage	36.7	2.1e-70
WP_166009376.1|268383_268986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009378.1|268986_269856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009380.1|269868_270078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009382.1|270189_270801_+	DUF4355 domain-containing protein	NA	A0A0P0IQJ5	Lactobacillus_phage	34.9	6.6e-05
WP_166009384.1|270814_271165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009386.1|271164_272178_+|capsid	major capsid protein	capsid	C9E2J5	Enterococcus_phage	43.2	3.1e-68
WP_166009387.1|272191_272650_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_166009389.1|272652_272991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009391.1|273001_273439_+	hypothetical protein	NA	L7TME2	Rhizobium_phage	38.2	4.9e-10
WP_166009393.1|273441_273825_+	hypothetical protein	NA	A8ATH0	Listeria_phage	36.0	2.8e-09
WP_166009395.1|274008_274275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009397.1|274329_275454_+	DUF3383 domain-containing protein	NA	A8ATH2	Listeria_phage	34.4	4.0e-40
WP_166009399.1|275469_275874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009401.1|276019_276385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166008872.1|276365_276623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009403.1|276579_280716_+	hypothetical protein	NA	D7RWK0	Brochothrix_phage	43.0	4.8e-14
WP_166009405.1|280731_281292_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4JD33	uncultured_Caudovirales_phage	37.0	5.5e-22
WP_166009407.1|281291_281633_+	hypothetical protein	NA	D6PSZ5	Lactobacillus_phage	49.5	2.5e-22
WP_166009409.1|281632_282502_+	hypothetical protein	NA	E5DV61	Deep-sea_thermophilic_phage	32.0	7.4e-34
WP_166009411.1|282502_282859_+	ABC transporter substrate-binding protein	NA	D6PSZ7	Lactobacillus_phage	35.1	1.2e-09
WP_166009413.1|282870_283236_+	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_166009415.1|283225_284383_+|plate	baseplate J/gp47 family protein	plate	A8ATI2	Listeria_phage	40.2	3.7e-73
WP_166009417.1|284372_285023_+	hypothetical protein	NA	D6PT00	Lactobacillus_phage	38.5	4.0e-16
WP_166009419.1|284977_287047_+	hypothetical protein	NA	A0A219MHL0	Dickeya_phage	37.0	3.0e-09
WP_166011656.1|287064_287562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009421.1|287574_288471_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0D3MK08	Leuconostoc_phage	41.5	1.5e-58
288705:288734	attR	TGACTGGAAGTGGTCACCACTTGTTTAATT	NA	NA	NA	NA
>prophage 4
NZ_CP049888	Weissella sp. HDW19 chromosome, complete genome	1618880	698159	711567	1618880	integrase,transposase	Lactobacillus_phage(28.57%)	13	700123:700136	711340:711353
WP_166010133.1|698159_699228_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	34.1	3.8e-24
WP_166010135.1|699669_699924_-	hypothetical protein	NA	NA	NA	NA	NA
700123:700136	attL	AAAATAAATTAAAT	NA	NA	NA	NA
WP_166011688.1|700484_701897_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_166010137.1|702254_702731_-|integrase	site-specific integrase	integrase	V9QKF1	Oenococcus_phage	37.4	7.0e-18
WP_166010139.1|702802_703033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166010141.1|703168_703552_+	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	39.7	2.7e-12
WP_166010143.1|703529_703946_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	51.9	1.9e-32
WP_166010145.1|705846_706176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166009362.1|706285_707355_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	34.5	1.3e-24
WP_166010147.1|707371_708892_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_166011690.1|709270_709465_-|integrase	tyrosine-type recombinase/integrase	integrase	V9QKF1	Oenococcus_phage	52.7	8.2e-10
WP_166010149.1|710433_710652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166010151.1|710823_711567_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.9	8.0e-29
711340:711353	attR	ATTTAATTTATTTT	NA	NA	NA	NA
>prophage 5
NZ_CP049888	Weissella sp. HDW19 chromosome, complete genome	1618880	725637	770053	1618880	protease,terminase,tRNA,portal,transposase	Lactobacillus_phage(40.0%)	46	NA	NA
WP_166010175.1|725637_726357_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_166010177.1|726394_726898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166010179.1|727313_727520_+	CsbD family protein	NA	NA	NA	NA	NA
WP_166010181.1|727543_727786_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_166011691.1|727858_728894_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	34.2	4.3e-28
WP_166010183.1|729004_730074_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	34.1	3.8e-24
WP_166010185.1|731199_731928_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	49.8	1.1e-67
WP_166011694.1|732223_732625_+	HNH endonuclease	NA	A0A2H4J2V8	uncultured_Caudovirales_phage	36.7	1.2e-07
WP_166010187.1|732907_734908_+	N-6 DNA methylase	NA	A0A2H4JBT5	uncultured_Caudovirales_phage	58.9	1.3e-214
WP_166010189.1|734909_736028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166010191.1|736065_736494_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_166010193.1|736490_738272_+|terminase	terminase large subunit	terminase	F8J1B1	Lactobacillus_phage	49.7	1.8e-159
WP_166010195.1|738287_739811_+|portal	phage portal protein	portal	A0A0K2CZB0	Paenibacillus_phage	38.4	1.6e-55
WP_166010197.1|739835_740219_+	hypothetical protein	NA	A0A0A1ELH9	Lactobacillus_phage	40.3	2.9e-14
WP_166010199.1|740211_740403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166010201.1|740405_740810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166011696.1|740805_741027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166010203.1|741043_741454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166010205.1|741458_742310_+	peptidoglycan hydrolase	NA	B3GW20	Streptococcus_phage	42.1	3.5e-52
WP_166010207.1|742399_743629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166010209.1|743585_744113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166010212.1|744116_744689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166010214.1|745082_745547_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_166010216.1|745829_746834_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_166010218.1|746887_747736_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_166010220.1|747821_748661_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_166010222.1|748660_749020_+	DUF1634 domain-containing protein	NA	NA	NA	NA	NA
WP_166010224.1|749373_750843_+	amino acid permease	NA	NA	NA	NA	NA
WP_166010227.1|751075_752032_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_166010229.1|752033_752783_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_166010231.1|752795_753182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166010233.1|753484_753925_+	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_166010235.1|753948_754893_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_166010237.1|754917_755283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166010239.1|755297_757427_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_166010241.1|757476_758466_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_166010243.1|758511_759864_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_166010245.1|759863_760958_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_166010247.1|760979_761822_+	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_166010249.1|761963_763316_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_166010251.1|763346_764594_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_166010253.1|764607_765099_+	cell division protein SepF	NA	NA	NA	NA	NA
WP_166010255.1|765111_765372_+	YggT family protein	NA	NA	NA	NA	NA
WP_166010257.1|765400_766192_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_166010259.1|766207_767002_+	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_166010261.1|767257_770053_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.5	1.3e-92
>prophage 6
NZ_CP049888	Weissella sp. HDW19 chromosome, complete genome	1618880	1560502	1569597	1618880	tRNA	Streptococcus_phage(50.0%)	11	NA	NA
WP_166011567.1|1560502_1561387_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.2	4.0e-75
WP_166011569.1|1561420_1562431_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	35.9	9.6e-25
WP_166011571.1|1562457_1562787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166011573.1|1562790_1563435_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	49.0	6.5e-51
WP_166011575.1|1563444_1563708_-	YaaL family protein	NA	NA	NA	NA	NA
WP_166011577.1|1563707_1564307_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_166011579.1|1564339_1566094_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.4	5.9e-54
WP_166011581.1|1566347_1567097_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_166011583.1|1567128_1567932_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_166011585.1|1567924_1568788_-	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.2	2.9e-14
WP_166011587.1|1568763_1569597_-	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	2.6e-20
