The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP034997	Lactobacillus plantarum strain LS/07 chromosome, complete genome	3182330	554054	562666	3182330		Streptococcus_phage(66.67%)	11	NA	NA
WP_003644909.1|554054_555752_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
WP_003640956.1|555773_556082_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003637790.1|556097_556697_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640957.1|556711_556963_+	YaaL family protein	NA	NA	NA	NA	NA
WP_016510978.1|557348_558014_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_063845542.1|558010_558340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003640966.1|558356_559376_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640967.1|559400_559748_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_003643942.1|559846_560743_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	9.9e-82
WP_003640969.1|560746_561532_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_015825197.1|561670_562666_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.2	2.6e-51
>prophage 2
NZ_CP034997	Lactobacillus plantarum strain LS/07 chromosome, complete genome	3182330	1201796	1211643	3182330		Lactobacillus_phage(87.5%)	9	NA	NA
WP_045351821.1|1201796_1203035_+	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	96.7	7.9e-215
WP_015825455.1|1203125_1204097_-	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	99.4	1.8e-182
WP_003643099.1|1204282_1205230_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_003643097.1|1205573_1206188_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_063845806.1|1206190_1208629_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.5	0.0e+00
WP_003643095.1|1208716_1209277_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
WP_045351826.1|1209347_1209788_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	98.6	3.0e-76
WP_015380221.1|1209883_1210021_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_061468264.1|1210647_1211643_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.5	1.2e-51
>prophage 3
NZ_CP034997	Lactobacillus plantarum strain LS/07 chromosome, complete genome	3182330	1725486	1813377	3182330	portal,protease,capsid,tail,terminase,integrase,holin,head,tRNA,transposase	Lactobacillus_phage(68.75%)	94	1751067:1751084	1820305:1820322
WP_003640716.1|1725486_1726410_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_015825649.1|1726894_1727416_-	shikimate kinase	NA	NA	NA	NA	NA
WP_045351386.1|1727418_1728516_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_013355606.1|1728518_1729817_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003645964.1|1729830_1730358_-	amino acid biosynthesis protein	NA	NA	NA	NA	NA
WP_045351387.1|1730366_1731536_-	chorismate synthase	NA	NA	NA	NA	NA
WP_045351388.1|1731528_1732983_-	MFS transporter	NA	NA	NA	NA	NA
WP_003640723.1|1733630_1733984_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_045351389.1|1734006_1736583_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.3	9.6e-21
WP_003640725.1|1736597_1736903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640726.1|1736892_1737192_-	YlxR family protein	NA	NA	NA	NA	NA
WP_003640727.1|1737236_1738454_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003640728.1|1738474_1738951_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003640729.1|1739246_1743560_-	DNA polymerase III subunit alpha	NA	A0A1X9SH08	Bradyrhizobium_phage	34.0	1.0e-14
WP_045351392.1|1744053_1745763_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_045351393.1|1745802_1747080_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003640734.1|1747117_1747903_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_063845842.1|1747918_1748698_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	1.1e-23
WP_003640736.1|1748817_1749381_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003640737.1|1749382_1750105_-	UMP kinase	NA	NA	NA	NA	NA
WP_003644498.1|1750304_1751183_-	elongation factor Ts	NA	NA	NA	NA	NA
1751067:1751084	attL	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
WP_003640739.1|1751285_1752089_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003640740.1|1752313_1753036_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003640741.1|1753325_1754324_-	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
WP_003645628.1|1754408_1754714_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003645629.1|1754697_1755456_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_025015626.1|1755567_1756203_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_013355613.1|1756259_1756490_-	YneF family protein	NA	NA	NA	NA	NA
WP_003644501.1|1756593_1756833_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003640747.1|1756984_1757617_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.2	2.3e-16
WP_157262971.1|1757705_1757798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045351395.1|1758170_1758800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045351396.1|1758849_1760019_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003640750.1|1760054_1760447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644503.1|1760610_1761003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003645635.1|1761448_1762390_+	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	48.7	3.1e-78
WP_031275254.1|1763089_1763662_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_076632723.1|1763813_1764998_-	LCP family protein	NA	NA	NA	NA	NA
WP_003645638.1|1764978_1765770_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	4.5e-30
WP_003644507.1|1765788_1767531_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003644508.1|1768009_1769221_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_003644510.1|1771004_1771268_-|holin	holin	holin	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
WP_063845843.1|1771267_1772440_-	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	88.7	5.8e-199
WP_063845844.1|1772451_1772889_-	hypothetical protein	NA	A0A2P0ZLH0	Lactobacillus_phage	35.0	1.2e-11
WP_003641410.1|1773387_1773549_-	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	96.2	4.7e-19
WP_063845845.1|1773552_1773804_-	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	97.2	1.2e-29
WP_063845846.1|1773796_1776565_-	hypothetical protein	NA	E9LUR4	Lactobacillus_phage	92.4	0.0e+00
WP_063845847.1|1776581_1778951_-	hypothetical protein	NA	E9LUR3	Lactobacillus_phage	95.9	0.0e+00
WP_063845848.1|1779020_1780790_-|tail	phage tail protein	tail	E9LUR2	Lactobacillus_phage	93.7	0.0e+00
WP_063845849.1|1780866_1785747_-	peptidase M23	NA	A0A2P0ZLG0	Lactobacillus_phage	67.0	0.0e+00
WP_015640500.1|1785778_1785964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063845850.1|1786008_1786383_-	hypothetical protein	NA	A0A2P0ZLH4	Lactobacillus_phage	93.5	1.7e-56
WP_063845851.1|1786458_1787112_-|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	90.3	6.9e-109
WP_063485211.1|1787126_1787507_-	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	90.5	1.4e-58
WP_165634967.1|1787506_1787914_-	HK97 gp10 family phage protein	NA	A0A2P0ZLE6	Lactobacillus_phage	91.7	4.6e-63
WP_041161664.1|1787916_1788264_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	92.2	1.4e-55
WP_015825348.1|1788264_1788543_-	hypothetical protein	NA	A0A2P0ZLF2	Lactobacillus_phage	73.6	2.2e-32
WP_063845942.1|1788633_1790016_-|capsid	phage major capsid protein	capsid	A0A0M7RF71	Lactobacillus_phage	61.5	1.1e-95
WP_015825346.1|1790022_1790628_-|head,protease	HK97 family phage prohead protease	head,protease	B8R651	Lactobacillus_phage	49.1	8.2e-40
WP_063845945.1|1790599_1791718_-|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	39.8	9.5e-66
WP_015473476.1|1793212_1794142_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	8.5e-20
WP_063845501.1|1794449_1796366_-|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	42.0	5.7e-135
WP_049821959.1|1796352_1796787_-|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	37.7	8.3e-18
WP_063845502.1|1796977_1797646_-	HNH endonuclease	NA	U5U440	Lactobacillus_phage	36.8	1.3e-09
WP_121018932.1|1797799_1798574_+|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_063845793.1|1798693_1799242_-	hypothetical protein	NA	D2IYV7	Enterococcus_phage	27.6	1.8e-17
WP_063845792.1|1799730_1800162_-	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	97.9	8.6e-76
WP_080469002.1|1800343_1800511_-	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	82.2	2.2e-11
WP_063845791.1|1800625_1801072_-	hypothetical protein	NA	A0A2P0ZLB8	Lactobacillus_phage	40.0	2.0e-22
WP_063845790.1|1801068_1801449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080469001.1|1801451_1801847_-	hypothetical protein	NA	O03921	Lactobacillus_phage	65.6	8.6e-38
WP_154566812.1|1801875_1802043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100255588.1|1802045_1802204_-	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	90.4	3.9e-18
WP_053267117.1|1802207_1802519_-	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	91.3	3.2e-48
WP_063845789.1|1802521_1802824_-	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	89.0	4.2e-45
WP_063845788.1|1802959_1803745_-	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	91.2	3.1e-132
WP_063845787.1|1803744_1804488_-	hypothetical protein	NA	E9LUM6	Lactobacillus_phage	55.6	5.5e-38
WP_003641373.1|1805250_1805556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165634968.1|1805556_1805727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063845786.1|1805905_1806106_-	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	89.4	4.9e-26
WP_063845785.1|1806117_1806357_-	hypothetical protein	NA	E9LUT6	Lactobacillus_phage	83.5	4.5e-34
WP_063845784.1|1806369_1806573_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003641368.1|1806738_1807029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071540939.1|1807114_1807378_+	SinR family protein	NA	A0A0M3LS55	Mannheimia_phage	42.4	2.7e-11
WP_063845783.1|1807622_1807883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165634969.1|1808097_1808262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063845782.1|1808275_1808983_-	antirepressor	NA	D2IYT0	Enterococcus_phage	59.2	1.6e-63
WP_154814603.1|1808998_1809205_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_063845780.1|1809458_1809878_+	helix-turn-helix transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	47.9	5.3e-30
WP_063845779.1|1809889_1810327_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	36.2	7.8e-08
WP_063845778.1|1810384_1811134_+	potassium channel family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	53.1	1.3e-39
WP_063485651.1|1811136_1811355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641356.1|1811731_1812046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063845777.1|1812213_1813377_+|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	37.1	1.3e-62
1820305:1820322	attR	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
>prophage 4
NZ_CP034997	Lactobacillus plantarum strain LS/07 chromosome, complete genome	3182330	2100070	2157296	3182330	portal,capsid,tail,terminase,holin,head,integrase	Lactobacillus_phage(65.85%)	77	2152261:2152320	2157394:2157520
WP_165634974.1|2100070_2100451_-|holin	holin	holin	A0A2P0ZLG6	Lactobacillus_phage	85.4	1.7e-14
WP_165634975.1|2100462_2100726_-|holin	holin	holin	E9LUR9	Lactobacillus_phage	95.4	1.2e-35
WP_165635023.1|2100725_2101838_-	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	65.0	7.5e-31
WP_165634976.1|2101900_2102176_-	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	86.0	4.0e-18
WP_165634977.1|2102172_2103258_-	collagen-like protein	NA	A0A1I9KKB6	Lactobacillus_phage	56.8	2.0e-36
WP_101494313.1|2103275_2103425_-	XkdX family protein	NA	U5U4L4	Lactobacillus_phage	56.8	4.7e-05
WP_063491252.1|2103424_2103736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015380604.1|2105907_2106198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015380605.1|2106194_2106416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063845632.1|2106408_2107536_-	hypothetical protein	NA	O03938	Lactobacillus_phage	41.5	1.3e-70
WP_046947885.1|2107547_2108366_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_165634978.1|2108366_2114033_-|tail	phage tail tape measure protein	tail	U5U708	Lactobacillus_phage	58.8	3.1e-112
WP_165634979.1|2114048_2114690_-	hypothetical protein	NA	U3PFU8	Lactobacillus_phage	28.9	2.6e-07
WP_056952673.1|2114686_2115205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063486493.1|2115323_2115941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165634980.1|2115958_2116384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165634981.1|2116383_2116785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165634982.1|2116781_2117171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063845639.1|2117171_2117576_-	hypothetical protein	NA	A5GYM1	Lactococcus_phage	27.5	3.4e-05
WP_165634983.1|2117935_2118883_-|capsid	N4-gp56 family major capsid protein	capsid	A8ASJ6	Listeria_phage	59.9	1.4e-89
WP_105919829.1|2118896_2119508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165634984.1|2119571_2120657_-	hypothetical protein	NA	A0A059T7W2	Listeria_phage	30.7	6.2e-38
WP_165634985.1|2120649_2122245_-|portal	phage portal protein	portal	B5LPR1	Bacillus_virus	37.1	9.3e-83
WP_063845645.1|2122247_2123573_-|terminase	PBSX family phage terminase large subunit	terminase	A0A1S5SA45	Streptococcus_phage	56.0	4.5e-139
WP_165634986.1|2123547_2124114_-|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	86.3	6.7e-60
WP_063845647.1|2124280_2124478_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	56.0	2.5e-06
WP_063845648.1|2124846_2125116_+	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_154814590.1|2125128_2125275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165634987.1|2125647_2126109_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	5.3e-39
WP_165634988.1|2126236_2126404_-	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	91.5	2.8e-14
WP_165634989.1|2126539_2126851_-	hypothetical protein	NA	A0A2K9VC43	Lactobacillus_phage	44.1	9.1e-19
WP_165634990.1|2126847_2127288_-	DUF1642 domain-containing protein	NA	A0A2K9VC51	Lactobacillus_phage	35.3	7.1e-17
WP_165635024.1|2127284_2127686_-	hypothetical protein	NA	A0A2P0ZKS9	Lactobacillus_phage	43.3	1.1e-13
WP_121018930.1|2127862_2128021_-	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	94.2	6.0e-19
WP_165634991.1|2128013_2128394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165634992.1|2128390_2128909_-	hypothetical protein	NA	O03915	Lactobacillus_phage	77.1	4.8e-65
WP_033611991.1|2128905_2129193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165634993.1|2129189_2130098_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_165635025.1|2130176_2130929_-	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	51.4	9.2e-73
WP_165634994.1|2130960_2131848_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	47.3	1.9e-61
WP_165634995.1|2131844_2132282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165634996.1|2132601_2133114_-	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	43.5	1.0e-27
WP_046039919.1|2133181_2133487_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_165634997.1|2133498_2133669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165634998.1|2133746_2133950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060417487.1|2133979_2134228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050482353.1|2134286_2134568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063486468.1|2134754_2134952_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2Q9	Lactobacillus_phage	53.3	1.1e-09
WP_074030102.1|2135095_2135437_+	helix-turn-helix transcriptional regulator	NA	A0A059T669	Listeria_phage	55.3	4.5e-19
WP_063486466.1|2135443_2135842_+	hypothetical protein	NA	A0A0A7RTX7	Clostridium_phage	35.0	4.5e-10
WP_063486465.1|2135939_2136866_+	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
WP_165634999.1|2137029_2137749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165635026.1|2138234_2139032_+	hypothetical protein	NA	A0A173G9H4	Propionibacterium_phage	59.2	2.1e-06
WP_076640401.1|2139305_2139482_+	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	51.7	3.3e-10
WP_080468984.1|2139637_2140582_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	43.4	1.1e-35
WP_063845658.1|2140565_2140949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063845659.1|2140948_2141656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063845660.1|2141819_2142941_+|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	32.1	6.4e-46
WP_003642774.1|2143292_2143499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016511207.1|2143917_2144223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063845661.1|2144305_2144677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063845662.1|2144843_2145113_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_063845663.1|2145308_2146856_-|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.1	4.1e-43
WP_063845664.1|2146852_2147953_-|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	34.3	9.4e-50
WP_080468986.1|2147953_2148154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063845665.1|2148107_2149811_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	41.1	1.7e-122
WP_063845666.1|2149807_2150281_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_061468355.1|2150896_2151286_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	45.2	3.0e-19
WP_063845667.1|2151278_2151617_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	35.6	6.0e-08
WP_024971524.1|2151626_2151809_-	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_003645297.1|2151833_2152253_-	hypothetical protein	NA	NA	NA	NA	NA
2152261:2152320	attL	TTTCCTCCTGTACTGGAAATGTTTGTTTTAACGTGGAACACGTGGAACACGTGGACAATC	NA	NA	NA	NA
WP_061468357.1|2152396_2153791_-	virulence protein	NA	Q4ZD27	Staphylococcus_phage	35.8	2.7e-70
WP_061468358.1|2153790_2154591_-	DNA replication protein	NA	NA	NA	NA	NA
WP_061468359.1|2154587_2154806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643619.1|2155088_2155268_-	helix-turn-helix domain-containing protein	NA	E9LUT5	Lactobacillus_phage	89.7	2.5e-21
WP_003643618.1|2155415_2156060_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063845668.1|2156138_2157296_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	34.8	1.1e-53
2157394:2157520	attR	GATTGTCCACGTGTTCCACGTGTTCCACGTTAAAACAAACATTTCCAGTACAGGAGGAAACAGGGTTAATTTAATGGTAGTCAGCCAAAAGGACAGCCAACTCAATTTCTTAATGGCCTGAACGCCT	NA	NA	NA	NA
>prophage 5
NZ_CP034997	Lactobacillus plantarum strain LS/07 chromosome, complete genome	3182330	2173661	2209699	3182330	portal,lysis,capsid,tail,terminase,head,plate,integrase	Lactobacillus_phage(62.16%)	46	2177376:2177391	2213524:2213539
WP_058906833.1|2173661_2174732_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2P0ZLG2	Lactobacillus_phage	77.1	3.1e-98
WP_058906832.1|2174731_2175016_-|lysis	lysis protein	lysis	A0A2P0ZLE8	Lactobacillus_phage	94.7	6.6e-40
WP_058906831.1|2175015_2175210_-	hypothetical protein	NA	A0A2P0ZLG4	Lactobacillus_phage	92.2	4.2e-22
WP_058906830.1|2175212_2175596_-	hypothetical protein	NA	A0A2P0ZLF7	Lactobacillus_phage	92.9	2.3e-64
WP_058906829.1|2175608_2177618_-|plate	BppU family phage baseplate upper protein	plate	A0A2P0ZKZ2	Lactobacillus_phage	73.4	2.5e-72
2177376:2177391	attL	GAACTTGCCATTAACG	NA	NA	NA	NA
WP_063845669.1|2177607_2179821_-	hypothetical protein	NA	Q597U4	Lactobacillus_virus	79.6	0.0e+00
WP_063845670.1|2179835_2181221_-	hypothetical protein	NA	A0A2P0ZL23	Lactobacillus_phage	52.0	1.2e-123
WP_063845671.1|2181233_2184674_-|tail	phage tail tape measure protein	tail	A0A2P0ZL32	Lactobacillus_phage	53.6	8.6e-17
WP_154814592.1|2184686_2184923_-	hypothetical protein	NA	A0A2K9VC05	Lactobacillus_phage	53.4	1.3e-12
WP_063845673.1|2184994_2185408_-	hypothetical protein	NA	A0A2K9VBY8	Lactobacillus_phage	59.9	2.1e-39
WP_063845674.1|2185431_2186310_-|tail	phage major tail protein, TP901-1 family	tail	A0A2K9VC22	Lactobacillus_phage	81.8	3.9e-91
WP_063845675.1|2186328_2186682_-	hypothetical protein	NA	K4I072	Lactobacillus_virus	70.9	1.9e-41
WP_063845676.1|2186681_2187056_-	hypothetical protein	NA	G8FUY4	Pediococcus_virus	62.1	1.2e-36
WP_063845677.1|2187048_2187327_-	hypothetical protein	NA	G8FUY5	Pediococcus_virus	75.0	8.4e-32
WP_058906820.1|2187323_2187662_-|head,tail	phage head-tail connector protein	head,tail	K4I470	Lactobacillus_virus	78.6	3.3e-46
WP_063845679.1|2188875_2189466_-	DUF4355 domain-containing protein	NA	Q597V6	Lactobacillus_virus	45.3	3.2e-20
WP_063845680.1|2189624_2190431_-|capsid	minor capsid protein	capsid	G8FUZ0	Pediococcus_virus	66.4	3.2e-100
WP_063845707.1|2190348_2191887_-|portal	phage portal protein	portal	G8FUZ1	Pediococcus_virus	66.0	9.9e-191
WP_063845708.1|2191913_2193197_-|terminase	PBSX family phage terminase large subunit	terminase	G8FUZ2	Pediococcus_virus	79.9	1.8e-206
WP_063845681.1|2193189_2193702_-|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	81.0	2.0e-55
WP_063845682.1|2193764_2194022_-	hypothetical protein	NA	A0A0N9SKC5	Staphylococcus_phage	46.4	2.3e-15
WP_063845683.1|2194032_2194239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063845684.1|2194240_2194441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063845685.1|2194501_2195218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642805.1|2195725_2196187_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	1.1e-39
WP_063845686.1|2196768_2197080_-	hypothetical protein	NA	A0A2K9VC43	Lactobacillus_phage	46.1	3.5e-18
WP_063845687.1|2197076_2197505_-	DUF1642 domain-containing protein	NA	Q5ULV5	Lactobacillus_virus	46.2	1.3e-15
WP_063845688.1|2197562_2197784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063845689.1|2197780_2198851_-	DNA cytosine methyltransferase	NA	A0A1I9KKE7	Lactobacillus_phage	59.7	2.5e-124
WP_063845690.1|2198851_2199328_-	methyltransferase domain-containing protein	NA	O03918	Lactobacillus_phage	85.2	1.5e-76
WP_063845691.1|2199461_2199692_-	hypothetical protein	NA	O03916	Lactobacillus_phage	60.5	3.8e-22
WP_063845692.1|2199688_2200108_-	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	40.9	1.1e-22
WP_063845693.1|2200100_2200616_-	hypothetical protein	NA	O03915	Lactobacillus_phage	82.3	3.7e-73
WP_063845709.1|2200744_2201530_-	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	62.1	1.6e-88
WP_063845694.1|2201547_2202279_-	hypothetical protein	NA	A0A1W6JNI1	Staphylococcus_phage	54.5	3.6e-58
WP_165635027.1|2202283_2203036_-	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	50.8	7.8e-72
WP_063845695.1|2203118_2203967_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	55.3	3.0e-64
WP_165635000.1|2203969_2204494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063845696.1|2204694_2204940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063845697.1|2204952_2205468_-	hypothetical protein	NA	D6PST4	Lactobacillus_phage	38.0	2.2e-25
WP_011101083.1|2205714_2205945_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063845698.1|2206117_2206480_+	helix-turn-helix domain-containing protein	NA	A0A0U4KKM4	Exiguobacterium_phage	32.0	4.5e-09
WP_063845699.1|2206491_2206905_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	31.3	3.4e-05
WP_063845700.1|2206927_2207719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063845701.1|2207728_2207983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063845702.1|2208430_2209699_+|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	42.2	4.1e-89
2213524:2213539	attR	GAACTTGCCATTAACG	NA	NA	NA	NA
>prophage 6
NZ_CP034997	Lactobacillus plantarum strain LS/07 chromosome, complete genome	3182330	2389391	2397905	3182330		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645867.1|2389391_2389970_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
WP_015380733.1|2389962_2390988_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	1.2e-59
WP_003642591.1|2390984_2392439_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_165635005.1|2392423_2394643_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.1	5.9e-144
WP_016511634.1|2394635_2395313_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642588.1|2395315_2395570_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_045351673.1|2395571_2396303_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.2e-37
WP_045351670.1|2396305_2397436_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003642585.1|2397419_2397905_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
