The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049941	Proteus mirabilis strain XH1568 chromosome, complete genome	4012915	508848	557044	4012915	plate,protease,tRNA	Staphylococcus_virus(25.0%)	40	NA	NA
WP_074561679.1|508848_510198_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_141191988.1|510194_510848_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_074561681.1|510897_513255_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_074561682.1|513267_513726_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_074561683.1|513722_516695_+	hypothetical protein	NA	Q4ZC50	Staphylococcus_virus	44.7	3.1e-39
WP_074561684.1|516708_517494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161737058.1|517882_518386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124724935.1|518566_518830_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	50.0	9.8e-06
WP_074561687.1|518831_520052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074561688.1|520044_523428_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_074561689.1|523499_525269_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_074561690.1|525232_526315_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_074561706.1|526387_526882_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_161737059.1|526886_529220_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.0	2.8e-11
WP_141191983.1|529222_530032_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_141191982.1|530048_530579_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_141191981.1|530629_531139_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_074561694.1|531162_533121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074561695.1|533171_533876_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_004245342.1|534227_534524_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004245341.1|534544_535516_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_036894164.1|535837_536719_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004245338.1|536743_538189_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_004252713.1|538178_538427_-	YhdT family protein	NA	NA	NA	NA	NA
WP_004245336.1|538656_540006_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_004245333.1|540018_540489_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_004245332.1|540521_540965_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_012368829.1|541398_542373_-	oxidoreductase	NA	NA	NA	NA	NA
WP_004245330.1|543059_544103_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.8	5.1e-05
WP_004245329.1|544204_545251_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_026164602.1|545256_545745_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004248907.1|545796_546384_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_004245326.1|546380_547850_+	ribonuclease G	NA	NA	NA	NA	NA
WP_141191980.1|547894_551698_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_004245324.1|551694_552555_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_161737061.1|552551_553997_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_012368831.1|554090_554597_+	ribonuclease	NA	NA	NA	NA	NA
WP_012368832.1|554596_554878_+	ribonuclease inhibitor	NA	NA	NA	NA	NA
WP_004248913.1|554968_555529_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_004248914.1|555715_557044_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 2
NZ_CP049941	Proteus mirabilis strain XH1568 chromosome, complete genome	4012915	955228	1000992	4012915	protease,transposase	Synechococcus_phage(33.33%)	34	NA	NA
WP_004244908.1|955228_956704_-|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_161737184.1|957208_959272_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_087740893.1|959502_961467_-|protease	metalloprotease	protease	NA	NA	NA	NA
WP_165715130.1|961773_963723_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_004244894.1|964188_965073_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049208244.1|965066_966323_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_049208242.1|966691_968077_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_049201682.1|968131_968776_-	beta-phosphoglucomutase	NA	A0A1D8KNV9	Synechococcus_phage	23.2	3.7e-06
WP_049208241.1|968768_971486_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_004244889.1|971511_972933_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_004244888.1|973051_974020_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_004244887.1|974182_974635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244885.1|974631_975456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247348.1|976096_976381_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004247349.1|976525_977086_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_036919880.1|977274_977847_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_110144404.1|977907_980430_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_004247352.1|980465_981197_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_004247353.1|981228_981657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004252417.1|981649_982183_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004247355.1|982182_982719_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_165715131.1|982731_983883_+	adhesin	NA	NA	NA	NA	NA
WP_074561801.1|984001_984694_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004247370.1|984823_986152_-	putrescine-ornithine antiporter	NA	NA	NA	NA	NA
WP_017827582.1|986215_988378_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_107034653.1|988751_988859_-	DUF2618 domain-containing protein	NA	NA	NA	NA	NA
WP_049211887.1|991056_991608_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	73.1	3.2e-67
WP_049211882.1|992986_995065_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_161737210.1|995054_997079_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_141191994.1|998156_998861_+	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_004244842.1|999173_999752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244841.1|999755_1000025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628332.1|1000251_1000524_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004247373.1|1000743_1000992_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.5	2.9e-07
>prophage 3
NZ_CP049941	Proteus mirabilis strain XH1568 chromosome, complete genome	4012915	1104996	1116356	4012915		Mycobacterium_phage(25.0%)	12	NA	NA
WP_004246075.1|1104996_1106196_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_141192027.1|1106804_1107773_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	70.7	1.0e-132
WP_004252248.1|1107798_1109925_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_004247429.1|1109953_1110358_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	2.8e-12
WP_004246071.1|1110369_1110594_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246069.1|1110875_1111349_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|1111546_1111756_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246058.1|1112213_1112588_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246057.1|1112603_1113569_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246056.1|1113670_1114315_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026090527.1|1114682_1114946_-	YbeD family protein	NA	NA	NA	NA	NA
WP_004246054.1|1115144_1116356_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
>prophage 4
NZ_CP049941	Proteus mirabilis strain XH1568 chromosome, complete genome	4012915	1152217	1199959	4012915	tail,integrase,lysis	Cronobacter_phage(16.67%)	74	1152131:1152149	1206878:1206896
1152131:1152149	attL	CTGCTTATTGGATTATAGT	NA	NA	NA	NA
WP_036932466.1|1152217_1153219_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.0	5.7e-70
WP_012367595.1|1153175_1153421_-	excisionase	NA	NA	NA	NA	NA
WP_036907939.1|1153417_1153738_-	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	51.9	1.3e-15
WP_162837621.1|1153730_1153907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036907940.1|1154064_1154340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036907941.1|1154332_1154560_-	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	71.2	5.3e-24
WP_036907942.1|1154612_1155197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726682.1|1155312_1155996_-	hypothetical protein	NA	A0A2I7QT96	Vibrio_phage	48.1	1.2e-23
WP_110144533.1|1156932_1157472_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	59.7	1.7e-57
WP_087726680.1|1157461_1158346_-	ATP-binding protein	NA	A0A1B1P9H8	Acinetobacter_phage	52.2	1.2e-60
WP_017628824.1|1158347_1158668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628823.1|1158664_1158817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161737234.1|1158813_1159068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162837622.1|1159075_1159231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247466.1|1159319_1159547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247467.1|1159669_1159945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247469.1|1160109_1160295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247470.1|1160291_1160444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247471.1|1160629_1160842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247473.1|1160948_1161269_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	5.0e-20
WP_159037577.1|1161655_1161832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107033972.1|1161824_1162736_-	serine dehydrogenasease	NA	NA	NA	NA	NA
WP_004247476.1|1162784_1163429_-	LexA family transcriptional regulator	NA	A0A077KGZ5	Edwardsiella_phage	64.5	9.6e-79
WP_004247477.1|1163534_1163744_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	83.3	1.2e-25
WP_004247478.1|1163889_1164237_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.9	8.3e-37
WP_004251793.1|1164332_1164506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049213519.1|1164502_1165270_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	52.8	1.0e-23
WP_012367618.1|1165269_1166655_+	helicase	NA	Q716D2	Shigella_phage	47.7	1.0e-114
WP_012367619.1|1166680_1167130_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	3.7e-13
WP_004245984.1|1167208_1167499_+	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_004245983.1|1167495_1167852_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
WP_004247487.1|1167851_1168484_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	7.3e-23
WP_004247148.1|1168794_1169316_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004247488.1|1169474_1169897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026164644.1|1169950_1170220_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	3.5e-19
WP_017628809.1|1170219_1170690_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	4.4e-49
WP_012367623.1|1170671_1170830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367624.1|1170832_1171294_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	45.8	6.3e-24
WP_004247494.1|1171641_1172226_+	Bro-N domain-containing protein	NA	Q3LZN7	Bacteriophage	48.2	2.0e-22
WP_004245979.1|1172222_1172429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245978.1|1172425_1172584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049203625.1|1172611_1173220_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	69.6	3.3e-65
WP_012367627.1|1173222_1174710_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	89.0	5.9e-265
WP_161737197.1|1174709_1176080_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	48.8	1.2e-118
WP_004245973.1|1176076_1177198_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.5	1.0e-104
WP_004245971.1|1177309_1178071_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.3	2.0e-67
WP_004245970.1|1178084_1179038_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.6	1.4e-126
WP_107033975.1|1179040_1179325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245968.1|1179364_1179844_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	2.9e-32
WP_004245967.1|1179846_1180197_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	45.1	3.8e-21
WP_004245966.1|1180198_1180780_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	51.6	1.0e-47
WP_004245963.1|1180776_1181178_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_004247505.1|1181223_1181880_+	hypothetical protein	NA	G8C7Q3	Escherichia_phage	57.7	8.6e-59
WP_004245960.1|1181931_1182237_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	55.4	6.6e-22
WP_049213761.1|1182251_1182539_+	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	9.0e-13
WP_004247508.1|1182567_1182774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145959338.1|1183483_1184020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049213757.1|1183998_1184655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049213755.1|1185295_1185466_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	49.1	1.1e-05
WP_080974785.1|1185539_1186112_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	58.4	4.6e-32
WP_065424105.1|1186187_1186967_+	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	46.8	6.2e-48
WP_049201309.1|1187178_1187658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049201311.1|1187679_1187997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049195350.1|1188140_1188374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161737196.1|1188441_1191372_+|tail	phage tail tape measure protein	tail	A0A2P0WA05	Enterobacter_phage	35.9	6.2e-141
WP_004245945.1|1191383_1191674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247516.1|1192035_1192377_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	50.0	9.0e-28
WP_004247517.1|1192373_1193117_+|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	58.6	7.1e-86
WP_004247518.1|1193113_1193824_+	C40 family peptidase	NA	A0A1P8DTI6	Proteus_phage	62.0	8.9e-86
WP_110706704.1|1193820_1194426_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	56.8	1.9e-52
WP_161737195.1|1194477_1198671_+	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	54.7	1.7e-301
WP_004245936.1|1198664_1199033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367646.1|1199034_1199649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247524.1|1199698_1199959_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
1206878:1206896	attR	CTGCTTATTGGATTATAGT	NA	NA	NA	NA
>prophage 5
NZ_CP049941	Proteus mirabilis strain XH1568 chromosome, complete genome	4012915	1572433	1589160	4012915	integrase,holin	Morganella_phage(16.67%)	20	1573717:1573732	1581680:1581695
WP_141192224.1|1572433_1573606_+	DNA (cytosine-5-)-methyltransferase	NA	A0A191SAU1	Nostoc_phage	32.9	3.9e-46
1573717:1573732	attL	CTGATTTTCTTAATTA	NA	NA	NA	NA
WP_161737123.1|1573741_1574869_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	60.9	2.2e-126
WP_108717285.1|1575347_1575995_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	44.0	3.7e-46
WP_036970213.1|1576325_1577399_+	hypothetical protein	NA	A0A2H4JEZ8	uncultured_Caudovirales_phage	36.3	4.9e-27
WP_004247847.1|1577411_1577810_+	antitermination protein Q	NA	B6SCZ7	Bacteriophage	55.3	4.6e-31
WP_012367807.1|1578031_1578292_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004247849.1|1578449_1578707_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004247850.1|1578712_1578985_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	67.2	1.3e-16
WP_049202017.1|1579291_1579498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141192378.1|1579799_1580822_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	68.8	1.2e-128
WP_161737169.1|1580908_1581661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141192376.1|1581751_1581976_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	67.6	1.0e-16
1581680:1581695	attR	TAATTAAGAAAATCAG	NA	NA	NA	NA
WP_141192379.1|1582022_1582430_+	glycoside hydrolase family protein	NA	A0A1W6JNW4	Morganella_phage	64.7	3.6e-47
WP_165715137.1|1582411_1582570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165715138.1|1582572_1584762_+	DUF1983 domain-containing protein	NA	A0A0P0ZEQ8	Stx2-converting_phage	44.4	1.2e-88
WP_036970230.1|1584751_1585084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141192235.1|1585083_1585770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141192234.1|1585766_1586033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141192233.1|1586049_1586382_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	60.8	3.2e-22
WP_049206349.1|1587636_1589160_+	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	52.2	1.3e-139
>prophage 6
NZ_CP049941	Proteus mirabilis strain XH1568 chromosome, complete genome	4012915	2354698	2370737	4012915		Escherichia_phage(27.27%)	16	NA	NA
WP_012368081.1|2354698_2357137_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
WP_004243609.1|2357148_2357766_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_141191972.1|2357769_2358546_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_141191971.1|2358661_2359204_-	DUF924 family protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	4.2e-19
WP_017628013.1|2359771_2359951_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_004243615.1|2361408_2362065_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.9	2.3e-35
WP_017628010.1|2362061_2363249_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
WP_004243617.1|2363241_2363586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243621.1|2363582_2364275_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243622.1|2364277_2365090_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|2365058_2365379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250719.1|2365391_2365880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049201140.1|2365882_2368186_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.1	1.6e-14
WP_004243627.1|2368268_2368727_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_012368088.1|2368786_2369239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141192174.1|2369249_2370737_-	DUF3383 family protein	NA	A0A088C3U1	Shewanella_sp._phage	35.5	3.2e-77
>prophage 7
NZ_CP049941	Proteus mirabilis strain XH1568 chromosome, complete genome	4012915	2609348	2671188	4012915	protease,transposase	Escherichia_phage(41.67%)	47	NA	NA
WP_001067858.1|2609348_2610053_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_094316489.1|2610092_2610269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001447541.1|2610803_2611688_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001323889.1|2614089_2615667_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_001067858.1|2616314_2617019_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_012477564.1|2617785_2618376_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001493762.1|2618512_2619085_+	recombinase family protein	NA	A0JC18	Ralstonia_phage	38.5	9.9e-19
WP_001493761.1|2619121_2620513_+|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001516695.1|2621292_2621949_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001067858.1|2622650_2623355_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_094316513.1|2623401_2623929_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|2623941_2624802_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067858.1|2626572_2627277_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000656305.1|2628073_2628451_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|2628651_2629311_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_165715162.1|2630280_2631348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243945.1|2631853_2632549_+	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_012368157.1|2632675_2633803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243947.1|2634333_2635041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004248486.1|2638263_2638521_+	MafI family immunity protein	NA	NA	NA	NA	NA
WP_036969478.1|2639221_2639908_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004243954.1|2640499_2640895_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004250418.1|2640906_2642403_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_004243956.1|2642514_2643438_-	transporter	NA	NA	NA	NA	NA
WP_036895432.1|2643857_2644436_-	ATP/GTP-binding protein	NA	M1IB93	Acanthocystis_turfacea_Chlorella_virus	35.1	5.1e-31
WP_049236994.1|2644464_2645043_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004243961.1|2647020_2648547_+	L-lactate permease	NA	NA	NA	NA	NA
WP_141192164.1|2648683_2649403_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_141192165.1|2649413_2650835_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_004250409.1|2650836_2651541_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_004243968.1|2651647_2652061_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_004248496.1|2652517_2652862_+	DMT family protein	NA	NA	NA	NA	NA
WP_004243972.1|2653249_2653633_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_049198785.1|2654100_2654754_-	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_004248501.1|2654878_2656045_-	MFS transporter	NA	NA	NA	NA	NA
WP_026164608.1|2656403_2657261_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004243977.1|2657341_2659381_-	IreA family TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	31.4	4.8e-15
WP_004243978.1|2659618_2661253_-	sodium/solute symporter	NA	A0A240F3J2	Aeromonas_phage	39.0	7.5e-88
WP_004243980.1|2661629_2662640_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012368169.1|2662819_2663890_-	galactose-1-epimerase	NA	NA	NA	NA	NA
WP_087741122.1|2663876_2665049_-	galactokinase	NA	NA	NA	NA	NA
WP_141192331.1|2665160_2666219_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_004248507.1|2666267_2667284_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	48.9	5.7e-86
WP_036895444.1|2667715_2668675_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	25.9	1.1e-17
WP_004243988.1|2668750_2669668_-	cation transporter	NA	NA	NA	NA	NA
WP_004248510.1|2670208_2670646_+	universal stress protein	NA	NA	NA	NA	NA
WP_004248511.1|2670708_2671188_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 8
NZ_CP049941	Proteus mirabilis strain XH1568 chromosome, complete genome	4012915	2871095	2882876	4012915	integrase	Morganella_phage(72.73%)	15	2869273:2869293	2881602:2881622
2869273:2869293	attL	CATGCCCCCAATTATGCCCCC	NA	NA	NA	NA
WP_165715171.1|2871095_2871515_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	92.1	1.9e-67
WP_165715172.1|2872317_2872509_-	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_165715173.1|2872584_2873040_-	osmoprotectant transporter ProQ	NA	A0A1W6JPI6	Morganella_phage	67.6	6.6e-18
WP_165715174.1|2873447_2876168_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	68.9	0.0e+00
WP_165715175.1|2876154_2876529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165715176.1|2876525_2876735_-	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	52.2	2.1e-11
WP_165715177.1|2876731_2876929_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	79.0	1.9e-17
WP_165715211.1|2876925_2877924_-	ash family protein	NA	A0A1W6JPK3	Morganella_phage	50.5	3.9e-79
WP_165715178.1|2877944_2878553_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	68.3	4.1e-71
WP_165715179.1|2878564_2878960_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	57.8	5.6e-29
WP_099432957.1|2878959_2879178_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	45.3	6.6e-08
WP_165715212.1|2879417_2879813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165715115.1|2879845_2880145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165715213.1|2880358_2881570_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.0	3.5e-130
WP_017827221.1|2882003_2882876_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.2	1.1e-34
2881602:2881622	attR	CATGCCCCCAATTATGCCCCC	NA	NA	NA	NA
>prophage 9
NZ_CP049941	Proteus mirabilis strain XH1568 chromosome, complete genome	4012915	3146816	3155666	4012915		Caulobacter_phage(50.0%)	9	NA	NA
WP_004245601.1|3146816_3148385_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_012368337.1|3148785_3149466_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|3149562_3150138_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004249446.1|3150214_3150793_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245605.1|3150860_3151886_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|3151920_3152376_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_141192129.1|3152400_3153543_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_004245609.1|3153543_3154128_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_141192128.1|3154520_3155666_+	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	26.9	5.9e-31
>prophage 10
NZ_CP049941	Proteus mirabilis strain XH1568 chromosome, complete genome	4012915	3276175	3308231	4012915	transposase,integrase	Salmonella_phage(40.0%)	27	3286729:3286743	3292805:3292819
WP_001120891.1|3276175_3276715_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|3276826_3277132_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214119.1|3277159_3278374_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	4.2e-19
WP_001447541.1|3278590_3279475_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_072161421.1|3279505_3280474_-|transposase	IS91-like element ISVsa3 family transposase	transposase	NA	NA	NA	NA
WP_086371372.1|3280965_3281478_-	dihydrofolate reductase	NA	U5J9P6	Bacillus_phage	42.9	9.4e-29
WP_079879887.1|3281568_3281793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|3281823_3283317_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_053044727.1|3283734_3286713_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
3286729:3286743	attL	TATTAAATGTACGAT	NA	NA	NA	NA
WP_000348524.1|3288886_3289330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497807.1|3289794_3290769_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_001995600.1|3290771_3291041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001218618.1|3291042_3292284_+|integrase	integrase family protein	integrase	A0A291AWU1	Escherichia_phage	39.8	1.3e-76
WP_000211147.1|3292413_3294432_-	DNA mismatch repair protein	NA	NA	NA	NA	NA
3292805:3292819	attR	ATCGTACATTTAATA	NA	NA	NA	NA
WP_000127615.1|3294577_3294766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036973667.1|3295204_3295297_-	peptide chain release factor 3	NA	NA	NA	NA	NA
WP_004245649.1|3296056_3297484_-	McrBC 5-methylcytosine restriction system protein	NA	NA	NA	NA	NA
WP_004245650.1|3297487_3299131_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	27.5	1.3e-18
WP_004245651.1|3299150_3299504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004245652.1|3300274_3300721_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_004245653.1|3300689_3301100_-	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_004245656.1|3301229_3302243_+	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_004245657.1|3302359_3302623_-	DUF1435 family protein	NA	NA	NA	NA	NA
WP_004245658.1|3302806_3303349_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004245660.1|3303345_3304983_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_012368409.1|3305411_3306851_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_165715188.1|3307022_3308231_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.3	1.2e-188
