The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	0	13701	2740356		Bacillus_virus(66.67%)	9	NA	NA
WP_173101897.1|1385_2228_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_173101898.1|2381_4265_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_173101899.1|4300_5740_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_173101900.1|6221_6464_+	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_173101901.1|6450_7560_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_173101902.1|7588_9538_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.3	1.3e-142
WP_173101903.1|9723_12255_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.5	2.3e-96
WP_173101904.1|12825_13125_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_173101905.1|13170_13701_+	single-stranded DNA-binding protein	NA	A0A097PAQ3	Streptococcus_pyogenes_phage	60.2	1.1e-45
>prophage 2
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	18603	20256	2740356		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_173101910.1|18603_20256_+	DNA mismatch repair protein MutS	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	28.6	3.5e-16
>prophage 3
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	25837	33908	2740356	transposase	Streptococcus_phage(66.67%)	6	NA	NA
WP_000222573.1|25837_26797_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	7.5e-11
WP_173101914.1|27099_27999_+	DUF1861 family protein	NA	NA	NA	NA	NA
WP_173101915.1|28009_29071_+	glycosidase	NA	NA	NA	NA	NA
WP_173101916.1|29076_30807_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	45.0	1.4e-137
WP_173101917.1|31244_32252_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_173101918.1|32534_33908_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	56.8	2.3e-130
>prophage 4
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	37209	40891	2740356		Lactobacillus_phage(33.33%)	4	NA	NA
WP_173101922.1|37209_37752_+	helix-turn-helix transcriptional regulator	NA	X2CXD8	Lactobacillus_phage	40.0	5.3e-06
WP_173101923.1|37810_38602_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_173101924.1|39564_39888_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	43.2	3.4e-16
WP_016173235.1|39955_40891_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	35.4	7.5e-24
>prophage 5
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	50552	55125	2740356		Planktothrix_phage(25.0%)	4	NA	NA
WP_143139799.1|50552_51596_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.4	4.9e-16
WP_173101930.1|51608_52568_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.0	1.3e-15
WP_016173224.1|52750_53851_+	helix-turn-helix domain-containing protein	NA	A0A288TXV8	Enterococcus_phage	38.7	1.7e-51
WP_016173223.1|54234_55125_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	43.7	3.7e-57
>prophage 6
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	84960	90501	2740356		Bacillus_phage(50.0%)	5	NA	NA
WP_173101956.1|84960_86556_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.0	8.6e-20
WP_173101957.1|86723_87830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173101958.1|88071_88398_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173101959.1|88672_89161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173101960.1|89208_90501_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	36.0	1.5e-70
>prophage 7
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	95373	96840	2740356		Tupanvirus(100.0%)	1	NA	NA
WP_173101966.1|95373_96840_+	arylsulfatase	NA	A0A2K9L1A5	Tupanvirus	24.9	2.3e-19
>prophage 8
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	113972	115544	2740356		Catovirus(100.0%)	1	NA	NA
WP_173104088.1|113972_115544_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	42.7	1.7e-97
>prophage 9
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	123725	127212	2740356		Bacillus_virus(50.0%)	3	NA	NA
WP_173101985.1|123725_124670_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.2	1.1e-22
WP_173101986.1|124695_126078_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_173101987.1|126339_127212_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	29.9	6.3e-09
>prophage 10
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	133461	135084	2740356		Tupanvirus(100.0%)	1	NA	NA
WP_173101993.1|133461_135084_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.6	2.2e-47
>prophage 11
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	148541	151088	2740356		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_173102008.1|148541_151088_+	HAD-IC family P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.1	7.0e-56
>prophage 12
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	155790	159059	2740356		Streptococcus_phage(66.67%)	3	NA	NA
WP_173102013.1|155790_157038_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	55.4	2.7e-114
WP_173102014.1|157275_158082_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.0	3.1e-42
WP_173102015.1|158546_159059_+	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	53.9	7.4e-42
>prophage 13
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	164814	166227	2740356	tRNA	Catovirus(100.0%)	1	NA	NA
WP_173102021.1|164814_166227_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.9	8.0e-54
>prophage 14
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	170663	173221	2740356		Streptococcus_phage(50.0%)	2	NA	NA
WP_173102028.1|170663_171926_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	38.3	7.9e-69
WP_173104090.1|171922_173221_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	28.0	2.0e-14
>prophage 15
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	177084	178125	2740356		Bacillus_phage(100.0%)	1	NA	NA
WP_173102033.1|177084_178125_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	67.2	1.9e-129
>prophage 16
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	186198	187581	2740356		Pandoravirus(100.0%)	1	NA	NA
WP_173102039.1|186198_187581_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.9	1.6e-43
>prophage 17
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	192151	193186	2740356		Enterobacteria_phage(100.0%)	1	NA	NA
WP_173102042.1|192151_193186_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	22.2	8.0e-11
>prophage 18
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	203933	205414	2740356		Streptomyces_phage(50.0%)	2	NA	NA
WP_173102047.1|203933_204650_-	trehalose operon repressor	NA	A0A291LID1	Streptomyces_phage	42.4	1.2e-05
WP_173102048.1|204763_205414_-	beta-phosphoglucomutase	NA	G3MA51	Bacillus_virus	22.4	2.2e-06
>prophage 19
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	217828	220099	2740356		Clostridioides_phage(100.0%)	1	NA	NA
WP_173102058.1|217828_220099_+	CRISPR-associated helicase Cas3'	NA	A0A2R2ZGW0	Clostridioides_phage	22.9	8.7e-26
>prophage 20
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	226525	235691	2740356		Acanthamoeba_polyphaga_moumouvirus(20.0%)	9	NA	NA
WP_173102064.1|226525_227533_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	26.0	6.4e-13
WP_173102065.1|227693_228410_+	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_173102066.1|228768_229728_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_173102067.1|229850_230534_+	metal ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.9	2.5e-13
WP_173102068.1|230610_231450_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_173102069.1|231679_232498_+	pur operon repressor	NA	A0A1V0SKE5	Klosneuvirus	27.5	2.5e-07
WP_173102070.1|232635_233511_+	alpha/beta hydrolase	NA	A0A220T682	Eptesipox_virus	38.5	9.2e-08
WP_173102071.1|233566_234184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173102072.1|234242_235691_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.3	4.8e-46
>prophage 21
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	245509	250516	2740356		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_173102080.1|245509_246559_+	SIS domain-containing protein	NA	M1I1B8	Acanthocystis_turfacea_Chlorella_virus	23.2	1.9e-07
WP_173102081.1|246582_247587_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_173102082.1|247917_249291_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	33.9	3.2e-31
WP_173102083.1|249538_250516_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	32.6	2.0e-43
>prophage 22
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	257938	258553	2740356		Abalone_herpesvirus(100.0%)	1	NA	NA
WP_173102091.1|257938_258553_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	33.5	4.2e-23
>prophage 23
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	261563	267257	2740356	tRNA	Synechococcus_phage(33.33%)	5	NA	NA
WP_173102094.1|261563_262055_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.2	1.0e-16
WP_173102095.1|262047_262992_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.5	2.8e-10
WP_173102096.1|262984_264349_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_173102097.1|264358_265102_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_173102098.1|265094_267257_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1V0SDC3	Indivirus	30.1	3.1e-20
>prophage 24
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	282189	285374	2740356		Streptomyces_phage(25.0%)	4	NA	NA
WP_173102109.1|282189_283515_+	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	45.4	2.3e-18
WP_173102110.1|283747_283969_+	DUF2829 domain-containing protein	NA	A8AT88	Listeria_phage	36.4	9.7e-07
WP_173102111.1|283965_284721_+	3-oxoacyl-ACP reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	27.0	1.2e-11
WP_173102112.1|284861_285374_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	33.3	2.5e-13
>prophage 25
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	301824	309046	2740356	tRNA	Hokovirus(33.33%)	6	NA	NA
WP_173102124.1|301824_302370_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	24.6	3.1e-06
WP_173102125.1|302525_304661_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	A9YVR1	Ostreococcus_tauri_virus	52.6	8.6e-108
WP_173102126.1|304771_305269_+	LURP-one-related family protein	NA	NA	NA	NA	NA
WP_173102127.1|305480_306368_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_173102128.1|306360_307371_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_173102129.1|307546_309046_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	39.6	1.2e-92
>prophage 26
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	317106	318297	2740356		Staphylococcus_phage(100.0%)	1	NA	NA
WP_173102130.1|317106_318297_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	68.4	1.3e-142
>prophage 27
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	321298	328436	2740356	tRNA	Staphylococcus_phage(75.0%)	5	NA	NA
WP_173102134.1|321298_321859_-	class I SAM-dependent methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	44.6	4.5e-32
WP_173102135.1|321851_322817_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	57.0	8.2e-42
WP_173102136.1|322831_323482_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_173102137.1|323893_325693_+	LysM peptidoglycan-binding domain-containing protein	NA	C1KFN7	Lactobacillus_virus	40.8	4.8e-19
WP_173102138.1|326024_328436_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	72.3	0.0e+00
>prophage 28
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	340982	342931	2740356		Brochothrix_phage(50.0%)	2	NA	NA
WP_173102149.1|340982_341975_+	peptidoglycan DD-metalloendopeptidase family protein	NA	D7RWE0	Brochothrix_phage	36.8	3.8e-18
WP_173102150.1|342079_342931_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	26.7	1.4e-08
>prophage 29
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	354817	360338	2740356	transposase	unidentified_phage(25.0%)	6	NA	NA
WP_000222573.1|354817_355777_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	7.5e-11
WP_173104099.1|355856_357329_+	HAD-IC family P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.6	7.4e-18
WP_173102159.1|357496_358492_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_173102160.1|358614_358998_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_173102161.1|358998_359424_-	HIT family protein	NA	D7NW73	Streptomyces_phage	34.1	2.2e-07
WP_173102162.1|359594_360338_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.3e-26
>prophage 30
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	376637	386063	2740356		Streptococcus_phage(60.0%)	8	NA	NA
WP_173102179.1|376637_377507_+	AraC family transcriptional regulator	NA	D0R0F8	Streptococcus_phage	23.6	4.1e-16
WP_173102180.1|378002_378824_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173102181.1|378976_380761_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	45.7	8.1e-128
WP_173102182.1|381075_382347_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	56.1	3.8e-119
WP_173102183.1|382501_383305_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	38.6	1.6e-38
WP_173102184.1|383318_383921_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173102185.1|384295_385375_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_173102186.1|385379_386063_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.2	1.5e-29
>prophage 31
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	389958	391260	2740356		Bacillus_phage(100.0%)	1	NA	NA
WP_173102191.1|389958_391260_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	48.5	1.7e-106
>prophage 32
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	395331	399616	2740356	tRNA	Salmonella_phage(50.0%)	4	NA	NA
WP_173102197.1|395331_397542_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	S4TRQ0	Salmonella_phage	41.0	4.7e-08
WP_173102198.1|397545_397992_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_173102199.1|398074_398992_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_173102200.1|399112_399616_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	52.5	9.3e-21
>prophage 33
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	407862	409059	2740356		Lactobacillus_phage(100.0%)	1	NA	NA
WP_173102208.1|407862_409059_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	8.4e-36
>prophage 34
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	414152	421299	2740356		Cafeteria_roenbergensis_virus(20.0%)	7	NA	NA
WP_173102216.1|414152_416057_-	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	31.2	3.6e-81
WP_173102217.1|416261_416804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173102218.1|416927_417899_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	32.4	4.4e-35
WP_173102219.1|418035_419169_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	31.1	4.5e-39
WP_173102220.1|419331_419676_+	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_173102221.1|419826_420678_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	27.3	1.9e-18
WP_173102222.1|420687_421299_+	metallophosphoesterase family protein	NA	L0LAH5	Bacillus_phage	37.8	4.3e-28
>prophage 35
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	432824	434099	2740356		Enterobacteria_phage(100.0%)	1	NA	NA
WP_173102227.1|432824_434099_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.3	7.2e-62
>prophage 36
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	440274	445852	2740356		Bacillus_phage(66.67%)	3	NA	NA
WP_173102232.1|440274_442023_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.9	9.3e-52
WP_173102233.1|442012_443794_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.7	1.4e-55
WP_173102234.1|443860_445852_-	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	35.1	2.6e-58
>prophage 37
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	449650	454804	2740356		Bacillus_virus(33.33%)	5	NA	NA
WP_173102240.1|449650_450283_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.1	4.4e-28
WP_173102241.1|450305_451121_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_173102242.1|451212_453639_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	4.3e-87
WP_173102243.1|453672_453816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173102244.1|454054_454804_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	2.7e-32
>prophage 38
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	458852	467301	2740356	tRNA	Bacillus_virus(25.0%)	5	NA	NA
WP_173102247.1|458852_459686_-	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	30.7	4.3e-23
WP_173102248.1|459704_459980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173102249.1|460271_462281_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	37.4	1.9e-96
WP_173102250.1|462618_465291_+	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	28.8	2.4e-75
WP_173102251.1|466044_467301_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	41.2	2.0e-80
>prophage 39
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	472648	478361	2740356		Only_Syngen_Nebraska_virus(50.0%)	3	NA	NA
WP_173102255.1|472648_475396_-	cation-transporting P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.8	2.0e-85
WP_173102256.1|475536_475974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173102257.1|476855_478361_+	ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	26.2	7.1e-32
>prophage 40
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	501329	502097	2740356		Pithovirus(100.0%)	1	NA	NA
WP_173102277.1|501329_502097_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.0	3.9e-10
>prophage 41
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	508543	514691	2740356		Lactococcus_phage(25.0%)	6	NA	NA
WP_173102284.1|508543_509113_+	thymidine kinase	NA	A0A1W6JKV9	Lactococcus_phage	52.1	1.9e-46
WP_173102285.1|509183_510257_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_173102286.1|510249_511086_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_173102287.1|511287_512319_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	42.4	4.1e-55
WP_173102288.1|512449_513700_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.6	3.0e-105
WP_173102289.1|513932_514691_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.5	5.3e-28
>prophage 42
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	519455	521581	2740356		Streptococcus_phage(50.0%)	3	NA	NA
WP_173102294.1|519455_519812_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	50.9	5.5e-28
WP_173104107.1|519813_520152_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
WP_173102295.1|520546_521581_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.3	6.3e-24
>prophage 43
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	525353	547635	2740356	terminase,capsid,head,portal,tail,integrase	Streptococcus_phage(27.27%)	25	530567:530584	544092:544109
WP_173102301.1|525353_526124_+	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.6e-09
WP_173102302.1|526140_527421_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_173102303.1|527417_528653_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	45.7	2.2e-108
WP_173102304.1|528639_529137_+	SUF system NifU family Fe-S cluster assembly protein	NA	V5R992	Mycobacterium_phage	34.3	2.7e-12
WP_173102305.1|529196_530588_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
530567:530584	attL	AATGGAAGGGTCTGTGGG	NA	NA	NA	NA
WP_173102306.1|530684_531839_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	31.5	2.4e-48
WP_173102307.1|531883_532729_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_173102308.1|532883_533156_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_173102309.1|533233_533488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173102310.1|533617_533860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173102311.1|533870_534785_+	hypothetical protein	NA	A0A1X9I6L2	Streptococcus_phage	27.7	4.2e-19
WP_173102312.1|534781_536371_+	DNA primase	NA	A7J282	Streptococcus_phage	25.5	1.2e-24
WP_173102313.1|536634_537045_+	DUF3206 domain-containing protein	NA	NA	NA	NA	NA
WP_173102314.1|537041_537230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173102315.1|537216_537600_+	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	44.4	9.2e-21
WP_173102316.1|537728_537866_+	DUF2292 domain-containing protein	NA	NA	NA	NA	NA
WP_173102317.1|537948_538428_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_173102318.1|538420_540115_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	44.2	1.5e-126
WP_173102319.1|540268_541474_+|portal	phage portal protein	portal	A0A2H4J8V4	uncultured_Caudovirales_phage	35.1	5.6e-64
WP_173102320.1|541463_542975_+|capsid	phage major capsid protein	capsid	A0A2H4J312	uncultured_Caudovirales_phage	36.2	2.7e-47
WP_173102321.1|543044_543374_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_173102322.1|543363_543636_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_173102323.1|544744_544948_-	hypothetical protein	NA	NA	NA	NA	NA
544092:544109	attR	AATGGAAGGGTCTGTGGG	NA	NA	NA	NA
WP_173102324.1|545070_545904_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_173102325.1|545964_547635_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.4e-17
>prophage 44
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	551747	555998	2740356		Bacillus_phage(100.0%)	2	NA	NA
WP_173102329.1|551747_554138_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	4.9e-35
WP_173102330.1|554150_555998_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	6.6e-48
>prophage 45
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	562718	563558	2740356		Staphylococcus_phage(100.0%)	1	NA	NA
WP_173102336.1|562718_563558_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	37.5	2.1e-49
>prophage 46
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	575625	576651	2740356		Escherichia_phage(100.0%)	1	NA	NA
WP_173102348.1|575625_576651_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A067ZJG7	Escherichia_phage	35.1	3.5e-51
>prophage 47
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	586568	592456	2740356		Bacillus_phage(100.0%)	4	NA	NA
WP_173102358.1|586568_588326_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	1.3e-45
WP_173102359.1|588322_590071_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.9	1.3e-40
WP_173102360.1|590307_591078_+	putative ABC transporter permease	NA	NA	NA	NA	NA
WP_173102361.1|591289_592456_+	peptidase M23	NA	A0A0E3D983	Bacillus_phage	59.8	4.8e-20
>prophage 48
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	595654	601253	2740356		Streptococcus_phage(33.33%)	6	NA	NA
WP_173102365.1|595654_596362_+	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	37.2	1.9e-24
WP_173102366.1|596387_597152_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_173102367.1|597164_598994_+	polysaccharide biosynthesis protein	NA	L7Y3T9	Megavirus	31.5	5.4e-26
WP_173102368.1|599006_599624_+	sugar transferase	NA	NA	NA	NA	NA
WP_173102369.1|599620_600469_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_173104110.1|600488_601253_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	39.3	1.1e-12
>prophage 49
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	606590	612728	2740356		Streptococcus_phage(66.67%)	6	NA	NA
WP_173102375.1|606590_607757_+	nucleotide sugar dehydrogenase	NA	M1HV26	Paramecium_bursaria_Chlorella_virus	50.8	5.4e-104
WP_173102376.1|607918_608515_+	DUF1361 domain-containing protein	NA	NA	NA	NA	NA
WP_173102377.1|608672_609104_+	universal stress protein	NA	NA	NA	NA	NA
WP_173102378.1|609230_610457_-	DUF1015 domain-containing protein	NA	NA	NA	NA	NA
WP_173102379.1|610456_611641_-	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	51.1	1.9e-112
WP_173102380.1|611642_612728_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	60.8	3.4e-121
>prophage 50
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	638028	641038	2740356		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_173102403.1|638028_638694_+	HAD family phosphatase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	27.2	4.2e-13
WP_173102404.1|638758_638914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173102405.1|639148_641038_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.8	2.6e-100
>prophage 51
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	652794	656013	2740356		Bacillus_virus(33.33%)	5	NA	NA
WP_173102421.1|652794_653304_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	52.5	1.0e-38
WP_173102422.1|653393_653630_+	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_173102423.1|653725_654697_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	50.0	3.2e-25
WP_173102424.1|654811_655288_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_173102425.1|655422_656013_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	39.8	9.5e-25
>prophage 52
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	665457	669670	2740356		Mycobacterium_phage(50.0%)	3	NA	NA
WP_173102431.1|665457_666678_-	serine hydrolase	NA	A0A2K9VHZ2	Mycobacterium_phage	30.2	7.0e-06
WP_173102432.1|667113_668118_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_173102433.1|668341_669670_+	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	37.8	3.3e-73
>prophage 53
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	674520	675048	2740356		Geobacillus_virus(100.0%)	1	NA	NA
WP_173102439.1|674520_675048_+	HAD family hydrolase	NA	A0A0H3UZF4	Geobacillus_virus	40.7	2.3e-22
>prophage 54
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	684774	687414	2740356	tRNA	Catovirus(100.0%)	1	NA	NA
WP_173102447.1|684774_687414_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	43.3	4.0e-163
>prophage 55
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	690603	701215	2740356		Bacillus_phage(40.0%)	10	NA	NA
WP_016172708.1|690603_690804_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.7	1.8e-20
WP_173102451.1|691070_692747_-	ribonuclease J	NA	NA	NA	NA	NA
WP_173102452.1|692748_692961_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_173102453.1|693497_695231_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.0	2.0e-38
WP_173102454.1|695227_696991_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	1.9e-52
WP_173102455.1|697190_697679_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_173102456.1|697860_698799_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_173102457.1|698954_699536_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.0	1.1e-54
WP_173102458.1|699801_700317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173102459.1|700468_701215_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	27.0	1.1e-14
>prophage 56
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	706722	721282	2740356	holin	Bacillus_phage(40.0%)	11	NA	NA
WP_173102465.1|706722_708465_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.9	2.3e-58
WP_173104112.1|708464_709196_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_173102466.1|709338_709758_+|holin	antiholin-like murein hydrolase modulator LrgA	holin	NA	NA	NA	NA
WP_173102467.1|709759_710446_+|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
WP_173102468.1|710466_712719_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	43.5	4.7e-181
WP_173104113.1|712836_713607_+	pyruvate formate lyase-activating protein	NA	NA	NA	NA	NA
WP_173102469.1|713847_715449_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	48.1	4.0e-142
WP_173102470.1|715843_716713_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_173102471.1|716852_717686_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173102472.1|717762_719502_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.8	7.4e-33
WP_173102473.1|719482_721282_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	3.1e-42
>prophage 57
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	743079	746589	2740356		Leptospira_phage(33.33%)	4	NA	NA
WP_173102491.1|743079_744276_+	hypothetical protein	NA	Q6NE04	Leptospira_phage	36.8	7.5e-61
WP_000048811.1|744335_745184_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	57.9	7.9e-81
WP_102568195.1|745194_745476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081528322.1|745551_746589_+	conjugal transfer protein	NA	A0A2H4JEZ8	uncultured_Caudovirales_phage	54.5	1.2e-22
>prophage 58
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	750490	753588	2740356		Erysipelothrix_phage(33.33%)	4	NA	NA
WP_002593556.1|750490_750763_+	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	46.4	2.7e-11
WP_009296082.1|750722_751112_+	TnpV protein	NA	D0R0F4	Streptococcus_phage	42.6	7.4e-18
WP_024725385.1|751677_752088_+	FosX/FosE/FosI family fosfomycin resistance thiol transferase	NA	NA	NA	NA	NA
WP_006873172.1|752781_753588_-	helix-turn-helix domain-containing protein	NA	A0A0A8WIV9	Clostridium_phage	38.2	2.7e-06
>prophage 59
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	757859	763651	2740356		Streptococcus_phage(50.0%)	7	NA	NA
WP_117461919.1|757859_758504_+	DNA primase	NA	S5M810	Pseudoalteromonas_phage	44.4	1.4e-08
WP_173104114.1|758472_759810_+	virulence-associated protein E	NA	A0A0A7RTG3	Clostridium_phage	33.4	2.1e-59
WP_173102494.1|760051_760249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173102495.1|760249_761920_+	recombinase family protein	NA	K4JU73	Streptococcus_phage	25.0	1.5e-27
WP_081528326.1|762106_762970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000573637.1|762982_763249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000542588.1|763252_763651_+	PrgI family protein	NA	E4ZFJ8	Streptococcus_phage	99.2	1.8e-64
>prophage 60
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	769996	787392	2740356		Moumouvirus(16.67%)	9	NA	NA
WP_081528329.1|769996_771703_+	DNA topoisomerase 3	NA	A0A2P1ELA0	Moumouvirus	27.6	4.3e-25
WP_017771820.1|771743_772706_+	DNA (cytosine-5-)-methyltransferase	NA	D2IZY5	Enterococcus_phage	51.1	4.9e-79
WP_081528330.1|772715_781106_+	DEAD/DEAH box helicase family protein	NA	A0A248SL14	Klebsiella_phage	36.7	5.0e-276
WP_081528331.1|781158_781818_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000033212.1|781967_782189_+	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	52.2	3.8e-11
WP_001049189.1|782190_783213_+	DNA cytosine methyltransferase	NA	A0A191SB20	Nostoc_phage	36.0	4.9e-45
WP_049513413.1|783226_784183_+	HaeIII family restriction endonuclease	NA	NA	NA	NA	NA
WP_049513486.1|784224_786108_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_049513415.1|786138_787392_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	31.2	1.8e-36
>prophage 61
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	790874	806011	2740356	transposase	Streptococcus_phage(54.55%)	16	NA	NA
WP_081528337.1|790874_791723_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.0	6.4e-22
WP_081528338.1|791722_792352_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_000420682.1|792804_793119_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
WP_000985015.1|793134_793521_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
WP_000813488.1|793549_794935_+	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
WP_000879507.1|794937_795090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016397615.1|795112_796375_+	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	100.0	1.3e-233
WP_029645760.1|796319_796532_+	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	78.7	1.5e-12
WP_001814874.1|796580_796664_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001038795.1|796788_797526_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.2	3.1e-134
WP_000019067.1|797782_799030_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.9	3.9e-12
WP_081528340.1|799579_800428_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001035198.1|800939_801095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081528341.1|801193_802858_+	recombinase family protein	NA	A0A0S2SXR4	Bacillus_phage	24.9	8.6e-23
WP_173102497.1|802857_804525_+	recombinase family protein	NA	D2XR37	Bacillus_phage	23.5	1.5e-19
WP_081528343.1|804517_806011_+	recombinase family protein	NA	A0A0S2SXR4	Bacillus_phage	23.9	8.3e-17
>prophage 62
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	814310	817368	2740356		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_173102504.1|814310_814943_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	34.7	1.5e-20
WP_173102505.1|815439_815715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173102506.1|816516_817368_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	42.0	3.3e-34
>prophage 63
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	835017	838105	2740356		Mycoplasma_phage(50.0%)	2	NA	NA
WP_173102525.1|835017_836127_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	35.0	1.4e-21
WP_173102526.1|837034_838105_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.9	3.0e-29
>prophage 64
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	841958	848927	2740356		Acanthocystis_turfacea_Chlorella_virus(50.0%)	6	NA	NA
WP_173102531.1|841958_842660_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	39.4	4.8e-15
WP_173102532.1|843060_844095_+	putrescine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.7	9.2e-15
WP_173102533.1|844199_845591_+	APC family permease	NA	NA	NA	NA	NA
WP_173102534.1|845574_846675_+	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	56.0	2.0e-116
WP_173104115.1|846677_847664_+	carbamate kinase	NA	NA	NA	NA	NA
WP_173102535.1|847829_848927_+	agmatine deiminase	NA	M1HES8	Acanthocystis_turfacea_Chlorella_virus	46.5	2.3e-93
>prophage 65
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	854320	872891	2740356		Streptococcus_phage(40.0%)	17	NA	NA
WP_173102541.1|854320_856198_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	36.9	1.3e-51
WP_173102542.1|856230_856545_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_173102543.1|856587_857184_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_173102544.1|857245_857884_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	51.7	6.6e-56
WP_173102545.1|858018_858348_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_173102546.1|858360_859299_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.8	2.8e-34
WP_173102547.1|859351_860233_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_173102548.1|860219_860561_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	46.4	1.3e-18
WP_173102549.1|860641_861532_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	57.8	2.3e-83
WP_173102550.1|862364_863483_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_173102551.1|863570_864173_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	58.0	2.2e-53
WP_173102552.1|864303_866493_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	63.8	1.5e-272
WP_173102553.1|866898_867666_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	4.9e-29
WP_173102554.1|867655_869704_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_173102555.1|870020_870170_+	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_173102556.1|870183_871695_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	27.9	2.6e-42
WP_173102557.1|871694_872891_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	30.1	2.4e-22
>prophage 66
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	877661	879098	2740356	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_173102562.1|877661_879098_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	42.9	1.1e-87
>prophage 67
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	908179	910390	2740356		Enterococcus_phage(50.0%)	2	NA	NA
WP_173102591.1|908179_909037_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	40.4	4.4e-39
WP_173102592.1|909037_910390_+	exodeoxyribonuclease VII large subunit	NA	L7Y4U7	Megavirus	27.5	4.4e-25
>prophage 68
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	931499	936120	2740356	tRNA	Klosneuvirus(50.0%)	2	NA	NA
WP_173102615.1|931499_934292_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	27.5	5.1e-92
WP_173102616.1|934596_936120_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	38.2	1.1e-77
>prophage 69
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	943003	945088	2740356		Streptococcus_phage(100.0%)	1	NA	NA
WP_173102624.1|943003_945088_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.1	1.3e-116
>prophage 70
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	951438	954318	2740356		Streptococcus_phage(100.0%)	4	NA	NA
WP_173102629.1|951438_952074_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	52.9	8.0e-54
WP_173104120.1|952184_952478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173102630.1|952555_952879_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_173102631.1|953007_954318_+	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	36.2	1.1e-60
>prophage 71
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	960203	963331	2740356		Bacillus_virus(50.0%)	3	NA	NA
WP_071863656.1|960203_960890_+	cell division ATP-binding protein FtsE	NA	G3M9Y6	Bacillus_virus	24.5	3.2e-16
WP_173102636.1|960873_961767_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_173102637.1|961882_963331_+	cardiolipin synthase	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	31.1	8.4e-06
>prophage 72
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	966694	970420	2740356		Bacillus_virus(33.33%)	4	NA	NA
WP_173102641.1|966694_967501_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.4	1.1e-15
WP_173102642.1|967533_968292_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.2	6.7e-15
WP_173102643.1|968302_968980_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_173102644.1|969127_970420_-	MFS transporter	NA	A0A1B0RXA6	Streptococcus_phage	38.6	6.0e-72
>prophage 73
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	976095	976986	2740356		Bacillus_phage(100.0%)	1	NA	NA
WP_173102651.1|976095_976986_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.7	6.1e-76
>prophage 74
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	983691	990202	2740356	transposase	Bodo_saltans_virus(20.0%)	6	NA	NA
WP_173102657.1|983691_984582_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	29.6	5.5e-24
WP_173102658.1|984645_985083_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	44.7	8.6e-23
WP_000222573.1|985228_986188_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	7.5e-11
WP_071863680.1|986303_986525_+	YneF family protein	NA	NA	NA	NA	NA
WP_173102659.1|986675_988427_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.1	1.6e-51
WP_173102660.1|988426_990202_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.6	1.1e-20
>prophage 75
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1000795	1003771	2740356		Bacillus_virus(50.0%)	2	NA	NA
WP_173102667.1|1000795_1001728_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	50.5	3.4e-85
WP_173102668.1|1002043_1003771_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	59.9	1.1e-198
>prophage 76
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1009427	1010970	2740356		Xanthomonas_phage(50.0%)	2	NA	NA
WP_173102674.1|1009427_1009874_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	39.0	4.2e-17
WP_173102675.1|1009998_1010970_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	43.3	5.9e-48
>prophage 77
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1026246	1031639	2740356		Stx2-converting_phage(50.0%)	6	NA	NA
WP_173102689.1|1026246_1027554_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	24.5	1.7e-13
WP_173102690.1|1027851_1027998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173102691.1|1028067_1028451_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_173102692.1|1028577_1029306_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_173102693.1|1029351_1030374_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_173102694.1|1030370_1031639_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.1	2.5e-38
>prophage 78
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1043243	1049623	2740356	tRNA	Lactococcus_phage(33.33%)	5	NA	NA
WP_016172403.1|1043243_1043444_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	63.6	2.7e-16
WP_173102704.1|1043647_1046398_+	DEAD/DEAH box helicase family protein	NA	A0A127AW80	Bacillus_phage	27.1	6.4e-47
WP_173102705.1|1046477_1046981_+	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_173102706.1|1047068_1048262_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_173102707.1|1048324_1049623_+|tRNA	asparagine--tRNA ligase	tRNA	H2EDM5	Moumouvirus	31.7	2.2e-58
>prophage 79
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1058330	1060448	2740356		Lactobacillus_phage(100.0%)	1	NA	NA
WP_173102711.1|1058330_1060448_+	hypothetical protein	NA	U3PJ04	Lactobacillus_phage	36.7	6.5e-23
>prophage 80
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1066362	1070534	2740356		Oenococcus_phage(33.33%)	5	NA	NA
WP_173102719.1|1066362_1067295_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	52.0	1.2e-82
WP_173102720.1|1067395_1068340_-	hydroxyacid dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	22.1	4.9e-07
WP_173102721.1|1068427_1069231_-	DUF1189 domain-containing protein	NA	NA	NA	NA	NA
WP_173102722.1|1069385_1069826_+	GtrA family protein	NA	NA	NA	NA	NA
WP_173102723.1|1069925_1070534_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	60.1	3.2e-68
>prophage 81
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1076181	1076880	2740356		Lactococcus_phage(50.0%)	2	NA	NA
WP_071863753.1|1076181_1076382_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	67.7	1.7e-18
WP_173102730.1|1076481_1076880_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.0	3.4e-18
>prophage 82
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1085269	1094614	2740356		Staphylococcus_phage(40.0%)	10	NA	NA
WP_173102737.1|1085269_1087168_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.6	7.5e-47
WP_173102738.1|1087201_1088149_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.0	4.3e-120
WP_173102739.1|1088183_1088684_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	39.0	4.9e-22
WP_173102740.1|1088753_1089407_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_173102741.1|1089544_1090390_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	36.7	3.6e-17
WP_173104127.1|1090897_1091746_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_173102742.1|1091774_1092428_+	YpmS family protein	NA	NA	NA	NA	NA
WP_173102743.1|1092432_1092954_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_173102744.1|1092946_1093168_+	YozE family protein	NA	NA	NA	NA	NA
WP_173102745.1|1093183_1094614_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.6	1.2e-25
>prophage 83
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1100535	1103535	2740356		Helicobacter_phage(50.0%)	2	NA	NA
WP_173102750.1|1100535_1102404_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	33.4	2.1e-49
WP_173102751.1|1102428_1103535_+	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	39.3	4.0e-40
>prophage 84
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1108350	1110583	2740356		uncultured_Mediterranean_phage(66.67%)	3	NA	NA
WP_173102756.1|1108350_1109241_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	32.1	1.6e-36
WP_173102757.1|1109256_1110009_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	28.9	3.0e-07
WP_173102758.1|1109998_1110583_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.7	1.6e-16
>prophage 85
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1117268	1118654	2740356		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_173102765.1|1117268_1118654_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	37.2	3.2e-63
>prophage 86
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1123381	1123657	2740356		Bacillus_phage(100.0%)	1	NA	NA
WP_016172327.1|1123381_1123657_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	71.9	3.1e-26
>prophage 87
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1127018	1128728	2740356		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_173102772.1|1127018_1128728_+	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.8	1.3e-53
>prophage 88
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1135150	1137766	2740356	tRNA	Streptococcus_phage(50.0%)	3	NA	NA
WP_173102780.1|1135150_1136047_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	43.0	1.7e-62
WP_173102781.1|1136196_1136559_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_173102782.1|1136545_1137766_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	49.8	6.1e-42
>prophage 89
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1141760	1144523	2740356		Indivirus(50.0%)	3	NA	NA
WP_173102787.1|1141760_1142561_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.2	3.8e-16
WP_173102788.1|1142550_1143540_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_173102789.1|1143536_1144523_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.0	4.3e-14
>prophage 90
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1149737	1156142	2740356	tRNA	Tupanvirus(33.33%)	7	NA	NA
WP_173102797.1|1149737_1150727_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.2	1.6e-53
WP_173102798.1|1150738_1152217_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_173102799.1|1152307_1153300_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	29.0	5.9e-19
WP_173102800.1|1153430_1154156_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_173102801.1|1154139_1154670_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_173102802.1|1154662_1155139_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_173102803.1|1155128_1156142_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.4	1.5e-57
>prophage 91
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1161451	1163143	2740356	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_173102808.1|1161451_1163143_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	33.3	2.8e-77
>prophage 92
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1167881	1176445	2740356	protease	Flavobacterium_phage(33.33%)	5	NA	NA
WP_173102813.1|1167881_1168667_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.0	2.0e-25
WP_173102814.1|1168697_1169498_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_173102815.1|1169724_1170993_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_173102816.1|1171104_1175454_+	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	38.2	2.0e-18
WP_173102817.1|1175692_1176445_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	5.5e-17
>prophage 93
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1180440	1185649	2740356		Erysipelothrix_phage(50.0%)	5	NA	NA
WP_173102823.1|1180440_1181817_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.3	1.2e-75
WP_173102824.1|1182021_1182810_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_173104129.1|1182793_1183936_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_071864770.1|1184039_1184573_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_173102825.1|1184671_1185649_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	38.9	6.9e-20
>prophage 94
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1189106	1190687	2740356		Streptococcus_phage(100.0%)	1	NA	NA
WP_173102829.1|1189106_1190687_+	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	28.2	2.5e-35
>prophage 95
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1197057	1202638	2740356	protease	Cronobacter_phage(33.33%)	4	NA	NA
WP_173104130.1|1197057_1199316_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	41.1	6.7e-127
WP_016172193.1|1199757_1200024_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_173102835.1|1200023_1201751_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	32.3	3.0e-18
WP_173102836.1|1201927_1202638_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.3	4.8e-15
>prophage 96
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1209493	1210231	2740356		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_173102842.1|1209493_1210231_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	27.8	1.7e-10
>prophage 97
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1218039	1218774	2740356		Planktothrix_phage(100.0%)	1	NA	NA
WP_173102852.1|1218039_1218774_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	2.1e-29
>prophage 98
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1226383	1231230	2740356	integrase	Lactococcus_phage(33.33%)	6	1219672:1219721	1228301:1228350
1219672:1219721	attL	AAGCGGGTGACGAGAATCGAACTCGCGACGGAAGCTTGGGAAGCTTCTGT	NA	NA	NA	NA
WP_173102860.1|1226383_1226905_+	helix-turn-helix domain-containing protein	NA	Q38607	Lactococcus_phage	32.6	1.9e-05
WP_173102861.1|1226954_1228097_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	36.4	1.1e-56
WP_173102862.1|1228615_1229146_+	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
1228301:1228350	attR	AAGCGGGTGACGAGAATCGAACTCGCGACGGAAGCTTGGGAAGCTTCTGT	NA	NA	NA	NA
WP_173102863.1|1229138_1230254_+	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_173102864.1|1230267_1230579_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_173102865.1|1230591_1231230_+	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	32.1	2.6e-20
>prophage 99
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1241475	1246883	2740356	tRNA	Streptococcus_phage(66.67%)	4	NA	NA
WP_173102873.1|1241475_1242348_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	39.5	5.1e-51
WP_173102874.1|1242450_1244232_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.0	1.6e-70
WP_173102875.1|1244476_1244653_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_173102876.1|1244942_1246883_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.3	1.2e-113
>prophage 100
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1250246	1252901	2740356		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_173102883.1|1250246_1252901_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.3	9.9e-21
>prophage 101
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1262184	1266164	2740356		Streptococcus_phage(50.0%)	4	NA	NA
WP_173102892.1|1262184_1263465_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	33.8	1.2e-43
WP_173102893.1|1263791_1264751_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_173102894.1|1265071_1265209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173102895.1|1265546_1266164_+	LysM peptidoglycan-binding domain-containing protein	NA	M4HQ50	Bacillus_phage	43.4	8.1e-27
>prophage 102
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1273600	1276328	2740356		Bacillus_phage(50.0%)	2	NA	NA
WP_173102904.1|1273600_1274086_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	59.2	8.3e-35
WP_173104136.1|1274123_1276328_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	34.1	6.5e-34
>prophage 103
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1281553	1283440	2740356	holin	Streptococcus_phage(50.0%)	2	NA	NA
WP_173102909.1|1281553_1282174_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	53.0	4.3e-52
WP_173102910.1|1283068_1283440_+|holin	phage holin family protein	holin	A0A097QQ04	Enterococcus_phage	48.1	6.4e-19
>prophage 104
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1287623	1292608	2740356		Hokovirus(50.0%)	4	NA	NA
WP_173102914.1|1287623_1288556_+	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	45.0	5.7e-64
WP_173102915.1|1288777_1289287_+	signal peptidase I	NA	NA	NA	NA	NA
WP_173102916.1|1289304_1289820_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_173102917.1|1290055_1292608_+	glucosaminidase domain-containing protein	NA	Q9ZXE4	Bacillus_phage	42.9	3.6e-20
>prophage 105
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1299317	1299953	2740356		Synechococcus_phage(100.0%)	1	NA	NA
WP_173102924.1|1299317_1299953_+	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	29.2	1.3e-08
>prophage 106
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1310642	1314108	2740356		Bacillus_phage(50.0%)	4	NA	NA
WP_173102929.1|1310642_1311281_+	thermonuclease family protein	NA	O64020	Bacillus_phage	37.6	5.3e-21
WP_173104139.1|1311372_1311648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173102930.1|1311888_1312452_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_173102931.1|1312578_1314108_+	alkyl hydroperoxide reductase subunit F	NA	A0A2K9L162	Tupanvirus	30.9	1.7e-33
>prophage 107
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1326356	1328752	2740356		Bacillus_phage(50.0%)	3	NA	NA
WP_173102945.1|1326356_1327028_+	hypothetical protein	NA	U5PU21	Bacillus_phage	36.2	6.8e-19
WP_173102946.1|1327027_1327888_+	sce7725 family protein	NA	NA	NA	NA	NA
WP_173102947.1|1328032_1328752_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	2.2e-15
>prophage 108
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1334825	1336569	2740356	transposase	Staphylococcus_phage(50.0%)	2	NA	NA
WP_173102953.1|1334825_1335341_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	3.6e-20
WP_002337512.1|1335579_1336569_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	42.8	1.4e-57
>prophage 109
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1339908	1349122	2740356		Bacillus_phage(50.0%)	8	NA	NA
WP_173102956.1|1339908_1341369_-	ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	35.8	5.7e-79
WP_173102957.1|1341631_1342129_-	kinase	NA	NA	NA	NA	NA
WP_173102958.1|1342133_1342697_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_173102959.1|1342882_1344406_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.2	5.3e-51
WP_173102960.1|1344534_1344759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173102961.1|1344872_1345424_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_173104140.1|1345512_1347387_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	5.3e-45
WP_173102962.1|1347379_1349122_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	3.3e-41
>prophage 110
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1358467	1363755	2740356		Pandoravirus(33.33%)	5	NA	NA
WP_173104141.1|1358467_1359634_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	37.6	1.2e-42
WP_173102971.1|1359633_1360698_-	3-dehydroquinate synthase	NA	C7U071	Ostreococcus_tauri_virus	33.7	6.7e-29
WP_173102972.1|1360701_1361727_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_173102973.1|1361741_1362608_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_173102974.1|1362990_1363755_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	27.5	2.7e-11
>prophage 111
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1371496	1372132	2740356		Pandoravirus(100.0%)	1	NA	NA
WP_173102983.1|1371496_1372132_-	orotate phosphoribosyltransferase	NA	S4W4D9	Pandoravirus	36.0	1.6e-30
>prophage 112
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1377783	1381179	2740356		Halovirus(50.0%)	3	NA	NA
WP_173102988.1|1377783_1378881_-	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.1	6.0e-57
WP_173102989.1|1378883_1380164_-	dihydroorotase	NA	NA	NA	NA	NA
WP_173102990.1|1380252_1381179_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	32.5	4.2e-27
>prophage 113
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1387960	1390603	2740356	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_173102998.1|1387960_1390603_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	35.0	5.7e-69
>prophage 114
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1394768	1399225	2740356		Klosneuvirus(50.0%)	6	NA	NA
WP_173103002.1|1394768_1396118_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	31.9	3.7e-48
WP_173103003.1|1396175_1397327_-	VanZ family protein	NA	NA	NA	NA	NA
WP_173103004.1|1397413_1397722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173103005.1|1397829_1398054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173104144.1|1398066_1398402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103006.1|1398568_1399225_-	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.9	3.1e-08
>prophage 115
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1403770	1404406	2740356		Paenibacillus_phage(100.0%)	1	NA	NA
WP_173103011.1|1403770_1404406_+	Holliday junction resolvase RecU	NA	R9TMF8	Paenibacillus_phage	34.9	1.8e-21
>prophage 116
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1407413	1414672	2740356		Bacillus_phage(25.0%)	8	NA	NA
WP_173103014.1|1407413_1408100_-	DnaD domain protein	NA	A0A0N7AE27	Bacillus_phage	35.1	1.8e-11
WP_173103015.1|1408217_1408595_-	RidA family protein	NA	NA	NA	NA	NA
WP_173103016.1|1408591_1409035_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_173103017.1|1409305_1410238_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	66.0	9.2e-115
WP_173103018.1|1410408_1411305_-	glucosaminidase domain-containing protein	NA	A0A0A7RUS8	Clostridium_phage	41.1	4.5e-18
WP_173103019.1|1411558_1413553_-	transketolase	NA	NA	NA	NA	NA
WP_173103020.1|1413640_1413883_-	DUF896 family protein	NA	NA	NA	NA	NA
WP_173103021.1|1414051_1414672_+	transcriptional repressor LexA	NA	A0A0N9RTK0	Paenibacillus_phage	32.8	1.0e-05
>prophage 117
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1418462	1419146	2740356		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_173103025.1|1418462_1419146_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.7	5.0e-17
>prophage 118
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1423231	1425808	2740356		Streptococcus_phage(50.0%)	2	NA	NA
WP_173103029.1|1423231_1424611_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	53.9	5.7e-137
WP_173103030.1|1424755_1425808_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	24.8	1.2e-14
>prophage 119
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1430203	1434466	2740356		Serratia_phage(50.0%)	2	NA	NA
WP_173103035.1|1430203_1432231_-	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	37.2	2.6e-98
WP_173104145.1|1432252_1434466_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	40.7	6.5e-127
>prophage 120
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1446214	1447453	2740356	protease	Bacillus_virus(100.0%)	1	NA	NA
WP_173103046.1|1446214_1447453_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.7	1.9e-139
>prophage 121
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1450637	1454183	2740356		Vibrio_phage(50.0%)	3	NA	NA
WP_173103050.1|1450637_1451669_-	signal peptide peptidase SppA	NA	A0A1C9LW82	Vibrio_phage	27.7	1.4e-10
WP_173103051.1|1451693_1451984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103052.1|1452377_1454183_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A0A1J0F994	Only_Syngen_Nebraska_virus	36.2	6.2e-91
>prophage 122
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1460014	1468012	2740356		Streptococcus_phage(50.0%)	6	NA	NA
WP_173103058.1|1460014_1460950_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.0	1.2e-53
WP_173103059.1|1461000_1461987_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	62.9	3.9e-116
WP_173103060.1|1461983_1462868_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.8	3.2e-08
WP_173103061.1|1463071_1463791_-	amino acid racemase	NA	NA	NA	NA	NA
WP_173104146.1|1463796_1465008_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_173103062.1|1465192_1468012_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.4	5.2e-312
>prophage 123
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1472558	1478458	2740356		Bacillus_phage(33.33%)	5	NA	NA
WP_173103065.1|1472558_1473296_+	amino acid ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.7	3.6e-13
WP_173103066.1|1473405_1474050_-	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_173103067.1|1474065_1475130_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_173103068.1|1475317_1476484_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	28.5	1.3e-30
WP_173103069.1|1476628_1478458_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.5	2.2e-136
>prophage 124
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1482949	1485774	2740356		Klosneuvirus(50.0%)	2	NA	NA
WP_173103074.1|1482949_1483462_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	41.1	8.5e-30
WP_173103075.1|1483473_1485774_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.6	1.4e-76
>prophage 125
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1492950	1493694	2740356		Catovirus(100.0%)	1	NA	NA
WP_173103081.1|1492950_1493694_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	38.4	1.8e-20
>prophage 126
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1499497	1500850	2740356		Ugandan_cassava_brown_streak_virus(100.0%)	1	NA	NA
WP_173103087.1|1499497_1500850_-	ribonuclease PH	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	34.7	1.5e-17
>prophage 127
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1504123	1504855	2740356		Planktothrix_phage(100.0%)	1	NA	NA
WP_173104150.1|1504123_1504855_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	4.8e-34
>prophage 128
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1509632	1515100	2740356	tRNA	Orpheovirus(50.0%)	3	NA	NA
WP_173103095.1|1509632_1510676_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	33.5	1.3e-29
WP_173103096.1|1511035_1511359_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_173103097.1|1511419_1515100_-	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	24.7	8.6e-23
>prophage 129
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1527798	1530128	2740356	transposase	Moumouvirus(50.0%)	3	NA	NA
WP_173103111.1|1527798_1528791_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	34.8	3.7e-13
WP_173103112.1|1528794_1528938_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_000222573.1|1529168_1530128_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	7.5e-11
>prophage 130
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1535188	1536538	2740356		Pandoravirus(100.0%)	1	NA	NA
WP_173103116.1|1535188_1536538_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.1	7.2e-44
>prophage 131
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1549643	1550384	2740356		Tetraselmis_virus(100.0%)	1	NA	NA
WP_173103126.1|1549643_1550384_-	SDR family oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	28.2	1.2e-08
>prophage 132
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1562106	1562973	2740356		Staphylococcus_phage(100.0%)	1	NA	NA
WP_173103140.1|1562106_1562973_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	37.0	8.4e-46
>prophage 133
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1571022	1579865	2740356		Erysipelothrix_phage(33.33%)	4	NA	NA
WP_173104154.1|1571022_1571874_-	conjugal transfer protein	NA	A0A2K5B2A4	Erysipelothrix_phage	41.9	5.2e-08
WP_173103150.1|1573898_1575746_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.7	4.5e-20
WP_173103151.1|1575906_1577127_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_173103152.1|1577261_1579865_-	ATP-dependent chaperone ClpB	NA	A0A2I7SAX5	Vibrio_phage	33.7	6.3e-129
>prophage 134
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1588729	1597744	2740356	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_173103159.1|1588729_1589848_-	Nif3-like dinuclear metal center hexameric protein	NA	J3IYW3	Acanthamoeba_polyphaga_lentillevirus	37.0	3.9e-11
WP_173103160.1|1589844_1590546_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_173103161.1|1590648_1591572_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	42.6	5.5e-35
WP_173103162.1|1591571_1592942_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_173103163.1|1592960_1593437_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_173103164.1|1593641_1594244_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_173103165.1|1594246_1595089_-	DNA-formamidopyrimidine glycosylase	NA	F8WPX6	Bacillus_phage	32.1	6.1e-25
WP_173103166.1|1595101_1597744_-	DNA polymerase I	NA	F8WQ35	Bacillus_phage	37.0	1.2e-53
>prophage 135
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1603749	1606179	2740356		Bacillus_phage(50.0%)	3	NA	NA
WP_173103172.1|1603749_1604484_-	serine/threonine protein phosphatase	NA	A7KV25	Bacillus_phage	29.4	1.2e-13
WP_173103173.1|1604617_1605478_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_173103174.1|1605486_1606179_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	6.5e-33
>prophage 136
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1609479	1609974	2740356		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_173103179.1|1609479_1609974_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	38.2	2.2e-22
>prophage 137
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1617940	1622471	2740356		Streptococcus_phage(50.0%)	4	NA	NA
WP_173103186.1|1617940_1619779_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	36.1	6.4e-19
WP_173103187.1|1619926_1620691_-	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_173103188.1|1620693_1620969_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_173103189.1|1621064_1622471_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.9	1.6e-46
>prophage 138
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1626545	1648367	2740356		Synechococcus_phage(27.27%)	18	NA	NA
WP_173103192.1|1626545_1629137_-	magnesium-translocating P-type ATPase	NA	A7IUR5	Paramecium_bursaria_Chlorella_virus	26.7	7.1e-56
WP_173103193.1|1629702_1631193_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_173103194.1|1631384_1632488_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	28.2	4.2e-26
WP_173104157.1|1632617_1633595_-	GMP reductase	NA	G3MBI2	Bacillus_virus	79.8	6.0e-149
WP_173103195.1|1633783_1634698_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_173103196.1|1634834_1636088_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_173103197.1|1636102_1637644_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.2	7.4e-77
WP_173103198.1|1637703_1638282_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.2	2.1e-29
WP_173103199.1|1638278_1639334_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	39.6	5.1e-61
WP_173103200.1|1639352_1640792_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	7.7e-52
WP_173103201.1|1640776_1642999_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.7	4.0e-148
WP_173103202.1|1642998_1643676_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_173103203.1|1643677_1643932_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_173103204.1|1643933_1644662_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	43.6	8.9e-49
WP_173103205.1|1644961_1645342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173103206.1|1645414_1646710_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.7	4.5e-19
WP_173103207.1|1646764_1647895_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_173103208.1|1647878_1648367_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.4	1.8e-21
>prophage 139
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1651974	1652592	2740356		Clostridium_phage(100.0%)	1	NA	NA
WP_173103213.1|1651974_1652592_-	glycoside hydrolase family 73 protein	NA	A0A0A7RUS8	Clostridium_phage	42.7	3.8e-24
>prophage 140
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1661529	1662231	2740356		Planktothrix_phage(100.0%)	1	NA	NA
WP_173103222.1|1661529_1662231_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.0	1.0e-33
>prophage 141
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1671056	1673474	2740356		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_173103232.1|1671056_1673474_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	37.9	5.5e-10
>prophage 142
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1685192	1692225	2740356		Bacillus_virus(66.67%)	3	NA	NA
WP_173103242.1|1685192_1687421_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	43.9	3.0e-180
WP_173103243.1|1687702_1690156_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.0	9.9e-92
WP_173103244.1|1690167_1692225_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.3	5.3e-115
>prophage 143
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1695606	1710319	2740356	tRNA,protease	Erwinia_phage(12.5%)	13	NA	NA
WP_173103248.1|1695606_1696998_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	28.3	9.7e-44
WP_173103249.1|1697010_1697556_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_173103250.1|1697583_1698483_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.4	3.6e-31
WP_173103251.1|1698994_1700302_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_173103252.1|1700428_1702507_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	36.0	5.2e-102
WP_173103253.1|1702624_1703491_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_173103254.1|1703551_1704319_-	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	38.6	3.0e-23
WP_173103255.1|1704299_1705169_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_173103256.1|1705316_1705604_+	DUF1905 domain-containing protein	NA	NA	NA	NA	NA
WP_173103257.1|1705693_1706881_-	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	27.8	4.3e-32
WP_173103258.1|1707141_1708146_-	nucleoid-associated protein	NA	X5JA08	Clostridium_phage	22.7	7.5e-14
WP_173103259.1|1708232_1709339_-	serine hydrolase	NA	A0A2K9VHZ2	Mycobacterium_phage	26.2	4.1e-05
WP_173103260.1|1709467_1710319_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.6	4.8e-54
>prophage 144
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1728938	1731312	2740356		Bacillus_phage(50.0%)	2	NA	NA
WP_173103270.1|1728938_1729625_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.6	5.7e-29
WP_173103271.1|1729890_1731312_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D8KPW3	Synechococcus_phage	30.8	7.9e-33
>prophage 145
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1735429	1747263	2740356		Streptomyces_phage(25.0%)	9	NA	NA
WP_173104163.1|1735429_1738741_-	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	32.5	4.2e-154
WP_173103275.1|1738835_1739015_+	YjzD family protein	NA	NA	NA	NA	NA
WP_173103276.1|1739244_1740441_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_173103277.1|1740645_1742085_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.5	1.7e-43
WP_173103278.1|1742369_1743173_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_173103279.1|1743310_1743514_+	PLDc_N domain-containing protein	NA	NA	NA	NA	NA
WP_173103280.1|1743514_1744417_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.0	2.5e-32
WP_173103281.1|1744413_1745178_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_173103282.1|1745367_1747263_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A0N9QYX6	Chrysochromulina_ericina_virus	27.0	1.7e-22
>prophage 146
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1753034	1755562	2740356		Streptococcus_phage(50.0%)	2	NA	NA
WP_173103286.1|1753034_1753631_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	39.6	3.6e-32
WP_173103287.1|1753759_1755562_+	glycerophosphoryl diester phosphodiesterase membrane domain-containing protein	NA	A0A0S2MYI4	Enterococcus_phage	24.7	5.0e-08
>prophage 147
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1761268	1771073	2740356	tRNA	Streptococcus_phage(50.0%)	9	NA	NA
WP_173103294.1|1761268_1762531_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.7	1.4e-20
WP_173103295.1|1762596_1763082_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_173103296.1|1763088_1763844_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	32.2	4.8e-21
WP_173103297.1|1763881_1765069_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	49.6	1.5e-101
WP_173103298.1|1765278_1767390_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	57.8	2.3e-214
WP_173103299.1|1767492_1768218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173103300.1|1768310_1768799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173103301.1|1768893_1770357_-	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	29.3	8.4e-22
WP_173103302.1|1770356_1771073_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.5	1.2e-32
>prophage 148
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1779257	1781867	2740356		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_173103310.1|1779257_1781867_-	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	41.9	2.1e-87
>prophage 149
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1787356	1788814	2740356		Acinetobacter_phage(100.0%)	1	NA	NA
WP_173103317.1|1787356_1788814_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	37.5	6.1e-81
>prophage 150
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1795475	1798052	2740356		Lactobacillus_phage(50.0%)	4	NA	NA
WP_173103324.1|1795475_1796024_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	34.0	1.5e-11
WP_173103325.1|1796053_1796644_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_173103326.1|1796793_1797177_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173103327.1|1797173_1798052_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.7e-09
>prophage 151
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1803457	1805919	2740356		Bacillus_phage(100.0%)	2	NA	NA
WP_173103333.1|1803457_1804186_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	1.2e-37
WP_173103334.1|1804182_1805919_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	36.0	4.5e-30
>prophage 152
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1813660	1822877	2740356		Streptococcus_phage(40.0%)	9	NA	NA
WP_173104170.1|1813660_1815700_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.0	8.6e-73
WP_173103342.1|1815879_1818072_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.3	2.0e-115
WP_173103343.1|1818071_1818281_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_173103344.1|1818298_1818748_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_173103345.1|1818861_1819851_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_173103346.1|1820350_1820581_-	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_173103347.1|1820742_1821396_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	48.2	9.8e-47
WP_173103348.1|1821399_1822101_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	2.4e-14
WP_173103349.1|1822100_1822877_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.2e-14
>prophage 153
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1826789	1827859	2740356		Staphylococcus_phage(50.0%)	2	NA	NA
WP_173103353.1|1826789_1827077_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	53.7	3.8e-19
WP_173103354.1|1827187_1827859_-	3D domain-containing protein	NA	G9J212	Bacillus_phage	58.4	1.6e-23
>prophage 154
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1837339	1840279	2740356		Staphylococcus_phage(50.0%)	2	NA	NA
WP_173103366.1|1837339_1837798_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	59.2	6.4e-45
WP_173103367.1|1837906_1840279_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.5	2.8e-99
>prophage 155
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1844256	1845981	2740356		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_173103372.1|1844256_1845981_+	pyruvate oxidase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	27.2	1.5e-38
>prophage 156
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1852458	1858725	2740356		Anomala_cuprea_entomopoxvirus(25.0%)	6	NA	NA
WP_173103377.1|1852458_1853235_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.1	2.2e-13
WP_173103378.1|1853231_1854185_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_173103379.1|1854181_1855129_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	38.2	3.7e-55
WP_173103380.1|1855332_1855785_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173103381.1|1855936_1857148_+	MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	23.8	8.3e-07
WP_173103382.1|1857420_1858725_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	84.3	4.2e-206
>prophage 157
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1878952	1883041	2740356		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_173104174.1|1878952_1880308_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	7.5e-25
WP_173103398.1|1880453_1881266_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_173103399.1|1881325_1883041_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.7	7.0e-60
>prophage 158
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1886434	1887334	2740356		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_173103404.1|1886434_1887334_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.3	5.2e-22
>prophage 159
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1895565	1908793	2740356		Staphylococcus_phage(40.0%)	12	NA	NA
WP_173103411.1|1895565_1897050_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.7	1.8e-11
WP_173103412.1|1897062_1897461_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_173103413.1|1897435_1898338_-	ribokinase	NA	NA	NA	NA	NA
WP_173103414.1|1898334_1899318_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_173103415.1|1899575_1899890_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	40.6	2.3e-17
WP_173103416.1|1900103_1902473_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	51.3	1.6e-25
WP_173103417.1|1902543_1903092_-	CvpA family protein	NA	NA	NA	NA	NA
WP_173103418.1|1903095_1903545_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_173103419.1|1903744_1904680_+	ribonuclease HIII	NA	NA	NA	NA	NA
WP_173104175.1|1904802_1905162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103420.1|1905255_1907010_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.3	3.3e-49
WP_173103421.1|1907059_1908793_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.0	1.2e-38
>prophage 160
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1926430	1927132	2740356		Planktothrix_phage(100.0%)	1	NA	NA
WP_173103435.1|1926430_1927132_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	2.1e-34
>prophage 161
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1932841	1934674	2740356		Campylobacter_phage(100.0%)	1	NA	NA
WP_173103440.1|1932841_1934674_-	hypothetical protein	NA	X2KLG0	Campylobacter_phage	21.3	8.7e-08
>prophage 162
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1939400	1941120	2740356	integrase	Lactococcus_phage(50.0%)	2	1933260:1933273	1947862:1947875
1933260:1933273	attL	GTTTTAATATTAGG	NA	NA	NA	NA
WP_161999580.1|1939400_1939922_+	helix-turn-helix domain-containing protein	NA	Q38607	Lactococcus_phage	32.6	1.9e-05
WP_173103447.1|1939974_1941120_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	32.5	2.0e-50
1947862:1947875	attR	GTTTTAATATTAGG	NA	NA	NA	NA
>prophage 163
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1945735	1953787	2740356		Tupanvirus(33.33%)	11	NA	NA
WP_173103453.1|1945735_1947673_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.6	1.3e-57
WP_173104178.1|1947788_1947920_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_173103454.1|1947997_1948147_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_173103455.1|1948157_1948535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103456.1|1948548_1948722_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_173103457.1|1948753_1949023_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_173103458.1|1949323_1950004_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_173103459.1|1950080_1950830_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.3	8.6e-31
WP_173103460.1|1951057_1952167_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_173103461.1|1952242_1952845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173104179.1|1953043_1953787_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	33.7	4.6e-16
>prophage 164
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1970368	1973208	2740356	integrase	Bacillus_phage(50.0%)	3	1970227:1970240	1971738:1971751
1970227:1970240	attL	TTTTGCTCTCTTTA	NA	NA	NA	NA
WP_002295028.1|1970368_1971571_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2MV79	Bacillus_phage	28.5	1.5e-32
WP_002295027.1|1971630_1971834_-	DUF3173 family protein	NA	NA	NA	NA	NA
1971738:1971751	attR	TTTTGCTCTCTTTA	NA	NA	NA	NA
WP_002295025.1|1971975_1973208_-	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	30.1	3.2e-46
>prophage 165
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	1988805	1997469	2740356		Mycoplasma_phage(40.0%)	10	NA	NA
WP_173103476.1|1988805_1989615_-	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	26.6	9.7e-12
WP_173103477.1|1989626_1990715_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	43.5	9.0e-37
WP_173103478.1|1991080_1992064_+	YhdH/YhfP family quinone oxidoreductase	NA	NA	NA	NA	NA
WP_173103479.1|1992075_1992831_+	phosphopantothenate--cysteine ligase	NA	NA	NA	NA	NA
WP_173103480.1|1992846_1993404_+	phosphopantothenoylcysteine decarboxylase	NA	Q9J5A8	Fowlpox_virus	39.2	5.3e-25
WP_173103481.1|1993403_1994057_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_173103482.1|1994136_1995036_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_173103483.1|1995100_1996009_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_173104182.1|1996101_1996857_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	48.5	2.6e-59
WP_173103484.1|1996935_1997469_+	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	39.5	1.2e-23
>prophage 166
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2001784	2002474	2740356		Pandoravirus(100.0%)	1	NA	NA
WP_173103490.1|2001784_2002474_-	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	44.7	6.7e-46
>prophage 167
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2013527	2037949	2740356	tRNA,protease	Bacillus_virus(20.0%)	21	NA	NA
WP_173103501.1|2013527_2014274_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	37.0	3.3e-30
WP_173103502.1|2014297_2016091_-	LTA synthase family protein	NA	NA	NA	NA	NA
WP_173103503.1|2016351_2017173_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	60.3	1.3e-77
WP_173103504.1|2017172_2018654_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.1	1.9e-106
WP_173103505.1|2018861_2019218_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_173103506.1|2019519_2020293_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173103507.1|2020400_2022029_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.3	2.4e-155
WP_173103508.1|2022074_2022359_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	45.2	6.2e-14
WP_173103509.1|2022562_2023189_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_173103510.1|2023293_2023938_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_173103511.1|2023993_2024797_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.3	1.2e-35
WP_173103512.1|2024885_2025755_-	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_173103513.1|2025755_2027081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103514.1|2027077_2028916_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	34.1	7.5e-36
WP_173103515.1|2028920_2029625_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.8	1.2e-42
WP_173103516.1|2029824_2030682_-	DegV family protein	NA	NA	NA	NA	NA
WP_173103517.1|2030674_2031241_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_173103518.1|2031875_2034239_-	beta galactosidase jelly roll domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	25.1	8.8e-21
WP_173103519.1|2034407_2036135_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_173103520.1|2036158_2036479_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_173104183.1|2036548_2037949_-	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	29.5	2.1e-46
>prophage 168
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2042921	2046533	2740356		Enterococcus_phage(66.67%)	3	NA	NA
WP_173103524.1|2042921_2043146_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	44.0	1.0e-11
WP_173103525.1|2043328_2045491_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.3	6.6e-265
WP_173104186.1|2045570_2046533_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	71.5	4.7e-130
>prophage 169
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2063865	2064747	2740356		Staphylococcus_phage(100.0%)	1	NA	NA
WP_173103540.1|2063865_2064747_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	3.9e-22
>prophage 170
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2072278	2079047	2740356		Bacillus_virus(33.33%)	7	NA	NA
WP_173103550.1|2072278_2072821_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	30.6	3.2e-11
WP_173103551.1|2072919_2073090_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_016171295.1|2073102_2073255_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_173103552.1|2073441_2074083_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_173103553.1|2074244_2074739_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	36.7	1.1e-10
WP_173103554.1|2075484_2076465_+	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_173103555.1|2076536_2079047_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	28.9	6.0e-60
>prophage 171
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2094332	2100667	2740356		Gordonia_phage(50.0%)	2	NA	NA
WP_173103571.1|2094332_2097503_-	DEAD/DEAH box helicase	NA	A0A160DHD3	Gordonia_phage	29.3	1.4e-37
WP_173103572.1|2097550_2100667_-	SMC family ATPase	NA	A0A059T7I2	Listeria_phage	28.0	1.1e-10
>prophage 172
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2104170	2104904	2740356		Staphylococcus_phage(100.0%)	2	NA	NA
WP_173103576.1|2104170_2104524_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	33.6	4.8e-08
WP_173103577.1|2104520_2104904_-	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	37.6	2.8e-09
>prophage 173
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2133304	2142362	2740356		Lactobacillus_phage(40.0%)	10	NA	NA
WP_173103601.1|2133304_2133958_+	ATP-binding cassette domain-containing protein	NA	F2Y165	Organic_Lake_phycodnavirus	25.9	7.3e-10
WP_173103602.1|2133938_2134697_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_173103603.1|2134730_2135513_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	34.5	2.0e-30
WP_173103604.1|2135770_2136091_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_173103605.1|2136306_2136681_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_173103606.1|2136978_2137935_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_173103607.1|2137935_2138358_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173103608.1|2138494_2140288_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.4	1.2e-54
WP_173103609.1|2140446_2141703_-	PAS domain-containing protein	NA	A0A2P0ZL82	Lactobacillus_phage	59.7	1.6e-61
WP_173103610.1|2141753_2142362_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	51.0	1.1e-52
>prophage 174
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2161175	2165545	2740356	tRNA	Enterobacteria_phage(33.33%)	6	NA	NA
WP_173103622.1|2161175_2161688_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	37.0	3.4e-18
WP_173103623.1|2161791_2162271_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_173103624.1|2162634_2163897_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.7	1.8e-20
WP_173103625.1|2164044_2164653_-|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_173103626.1|2164742_2165210_-	universal stress protein	NA	NA	NA	NA	NA
WP_173103627.1|2165224_2165545_-	thioredoxin family protein	NA	I6ZI43	Aeromonas_phage	34.5	5.3e-06
>prophage 175
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2172769	2177515	2740356	tRNA	Salmonella_virus(50.0%)	3	NA	NA
WP_173103633.1|2172769_2174659_-	acyltransferase family protein	NA	A0A1R3Y5Q6	Salmonella_virus	26.4	2.0e-20
WP_173103634.1|2174713_2175589_-	YitT family protein	NA	NA	NA	NA	NA
WP_173103635.1|2175742_2177515_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SJ84	Klosneuvirus	25.1	2.3e-13
>prophage 176
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2181874	2182804	2740356		Lactococcus_phage(100.0%)	1	NA	NA
WP_173103641.1|2181874_2182804_-	cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	40.8	4.6e-58
>prophage 177
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2188230	2190779	2740356		Planktothrix_phage(50.0%)	5	NA	NA
WP_173103645.1|2188230_2188977_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	3.9e-31
WP_173103646.1|2188985_2189342_-	YxeA family protein	NA	NA	NA	NA	NA
WP_173103647.1|2189582_2189942_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016173762.1|2190004_2190205_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016173761.1|2190257_2190779_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.8	5.6e-13
>prophage 178
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2202272	2203790	2740356		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_173103660.1|2202272_2203790_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	33.6	4.6e-07
>prophage 179
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2208218	2208878	2740356		Lactobacillus_virus(100.0%)	1	NA	NA
WP_173103665.1|2208218_2208878_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	48.4	6.4e-54
>prophage 180
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2221326	2230155	2740356	tRNA,holin	uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_173103676.1|2221326_2222475_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	41.6	2.8e-81
WP_173103677.1|2222688_2223429_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_173103678.1|2223468_2226105_-	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	30.6	1.5e-82
WP_173103679.1|2226670_2227702_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_173103680.1|2227878_2228766_+	VOC family protein	NA	NA	NA	NA	NA
WP_173103681.1|2228991_2230155_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	33.5	2.9e-17
>prophage 181
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2237560	2238235	2740356		Synechococcus_phage(100.0%)	1	NA	NA
WP_173103686.1|2237560_2238235_-	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	25.5	3.5e-07
>prophage 182
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2241713	2245430	2740356		Clostridium_botulinum_C_phage(50.0%)	4	NA	NA
WP_173103689.1|2241713_2242082_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	31.9	9.5e-07
WP_173103690.1|2242093_2243212_-	alanine racemase	NA	NA	NA	NA	NA
WP_173103691.1|2243242_2243593_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_173103692.1|2243891_2245430_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.1	3.9e-62
>prophage 183
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2248623	2255359	2740356		Bacillus_phage(50.0%)	6	NA	NA
WP_173103695.1|2248623_2250348_+	AarF/ABC1/UbiB kinase family protein	NA	C7U092	Ostreococcus_tauri_virus	28.3	1.2e-40
WP_173103696.1|2250446_2250893_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_173103697.1|2250968_2251640_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	1.6e-23
WP_173103698.1|2251717_2253205_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_173103699.1|2253364_2254036_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.6	6.8e-27
WP_173104192.1|2254051_2255359_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.3	1.8e-15
>prophage 184
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2261085	2261709	2740356		Catovirus(100.0%)	1	NA	NA
WP_173103705.1|2261085_2261709_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.2	3.7e-35
>prophage 185
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2265891	2266629	2740356		Streptococcus_phage(100.0%)	1	NA	NA
WP_173104193.1|2265891_2266629_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	61.3	5.6e-83
>prophage 186
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2273128	2274331	2740356		Bacillus_virus(100.0%)	1	NA	NA
WP_173103715.1|2273128_2274331_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-28
>prophage 187
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2279711	2280275	2740356		Synechococcus_phage(100.0%)	1	NA	NA
WP_173103720.1|2279711_2280275_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.9	3.0e-12
>prophage 188
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2286423	2287173	2740356		Planktothrix_phage(100.0%)	1	NA	NA
WP_173103726.1|2286423_2287173_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.6	1.7e-31
>prophage 189
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2295344	2296343	2740356		uncultured_virus(100.0%)	1	NA	NA
WP_173103735.1|2295344_2296343_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	31.7	1.8e-07
>prophage 190
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2300322	2305050	2740356		Wolbachia_phage(50.0%)	2	NA	NA
WP_173103740.1|2300322_2302476_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	43.1	3.3e-59
WP_173103741.1|2302491_2305050_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	25.8	1.4e-40
>prophage 191
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2312129	2355770	2740356	plate,terminase,head,portal,holin,protease,capsid,tail,integrase	Streptococcus_phage(34.38%)	66	2312586:2312603	2358803:2358820
WP_173103750.1|2312129_2313602_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	43.5	2.3e-96
2312586:2312603	attL	AAAGAAGTAAAAGAAAAA	NA	NA	NA	NA
WP_173103751.1|2313684_2313879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173104194.1|2313897_2314218_-	hypothetical protein	NA	A3F671	Streptococcus_phage	37.2	5.0e-12
WP_173103752.1|2314361_2314847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103753.1|2314863_2315046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103754.1|2315063_2315444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103755.1|2315590_2316529_-	SH3 domain-containing protein	NA	A0A0C5KKZ6	Enterococcus_phage	84.0	5.9e-154
WP_173103756.1|2316531_2316837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103757.1|2316838_2317111_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_173103758.1|2317123_2317366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103759.1|2317420_2317924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156137044.1|2317862_2318051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103760.1|2318070_2320245_-|plate	BppU family phage baseplate upper protein	plate	NA	NA	NA	NA
WP_173103761.1|2320244_2321264_-	hypothetical protein	NA	Q9T1A4	Listeria_phage	32.9	1.3e-37
WP_173103762.1|2321264_2322284_-|tail	phage tail protein	tail	Q9T1A5	Listeria_phage	50.9	1.8e-100
WP_173103763.1|2322292_2323120_-|tail	phage tail family protein	tail	A0A059T6D8	Listeria_phage	40.2	1.5e-47
WP_173104195.1|2323122_2326608_-|tail	phage tail tape measure protein	tail	M1PKM6	Streptococcus_phage	39.6	3.1e-14
WP_173103764.1|2327821_2328202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103765.1|2328257_2328863_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_173103766.1|2328876_2329272_-	hypothetical protein	NA	A0A059T681	Listeria_phage	41.7	1.5e-13
WP_173103767.1|2329268_2329664_-	hypothetical protein	NA	A0A1S5SF89	Streptococcus_phage	40.7	2.8e-12
WP_173104196.1|2329660_2330050_-|head,tail	phage head-tail adapter protein	head,tail	A0A1S5SFE6	Streptococcus_phage	36.1	4.1e-16
WP_173103768.1|2330036_2330315_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1S5SF81	Streptococcus_phage	47.7	3.9e-13
WP_173103769.1|2330451_2331597_-|capsid	phage major capsid protein	capsid	A0A1W6JPL4	Staphylococcus_phage	60.2	1.7e-123
WP_173103770.1|2331620_2332364_-|protease	Clp protease ClpP	protease	A0A2P0ZLE3	Lactobacillus_phage	53.5	8.2e-50
WP_173104197.1|2332353_2333505_-|portal	phage portal protein	portal	A8AT96	Listeria_phage	44.6	4.2e-93
WP_173103771.1|2333545_2333704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103772.1|2333714_2335352_-|terminase	terminase large subunit	terminase	A0A1S5SF58	Streptococcus_phage	65.4	1.9e-208
WP_173104198.1|2335348_2335708_-	hypothetical protein	NA	A0A2H4JBV9	uncultured_Caudovirales_phage	70.9	6.2e-35
WP_173103773.1|2335844_2336153_-	HNH endonuclease	NA	A0A2P0ZLC6	Lactobacillus_phage	59.6	6.2e-28
WP_173103774.1|2336353_2336767_-	hypothetical protein	NA	A0A2I7SC40	Paenibacillus_phage	29.1	1.7e-12
WP_173103775.1|2336976_2337474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173103776.1|2337502_2337820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173103777.1|2337835_2338411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173103778.1|2338451_2338625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103779.1|2338621_2339020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103780.1|2339016_2339244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103781.1|2339240_2339438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103782.1|2339434_2339938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103783.1|2339955_2340867_-	DNA (cytosine-5-)-methyltransferase	NA	D2IZY5	Enterococcus_phage	54.0	1.4e-96
WP_173103784.1|2340901_2341105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103785.1|2341308_2341761_-	dUTP diphosphatase	NA	A0A1X9I9M6	Staphylococcus_phage	35.0	8.6e-10
WP_173103786.1|2341841_2342330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103787.1|2342341_2342827_-	single-stranded DNA-binding protein	NA	A0A1L2JYW3	Streptococcus_phage	60.2	2.9e-43
WP_173103788.1|2342823_2343462_-	HNH endonuclease	NA	A0A2H4JB70	uncultured_Caudovirales_phage	40.1	1.2e-36
WP_173103789.1|2343458_2344268_-	replisome organizer	NA	A0A1P8VVR3	Streptococcus_phage	58.8	5.5e-39
WP_173103790.1|2344271_2344913_-	hypothetical protein	NA	U5U4M2	Lactobacillus_phage	33.8	1.1e-29
WP_173103791.1|2344909_2345899_-	DUF1351 domain-containing protein	NA	NA	NA	NA	NA
WP_016173616.1|2345895_2346630_-	ERF family protein	NA	A0A0K2CYY2	Paenibacillus_phage	49.2	1.4e-30
WP_173103792.1|2346788_2347496_-	Rha family transcriptional regulator	NA	D2IZW4	Enterococcus_phage	47.6	3.0e-49
WP_173103793.1|2347530_2347686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016173614.1|2347702_2347897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103794.1|2347893_2348175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103795.1|2348264_2348516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173103796.1|2348496_2348652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173101895.1|2348665_2348842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103797.1|2348838_2349366_-	ORF6C domain-containing protein	NA	NA	NA	NA	NA
WP_173103798.1|2349358_2350315_-	hypothetical protein	NA	J7KDG2	Streptococcus_phage	27.3	1.7e-15
WP_173103799.1|2350286_2350790_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_086314903.1|2350816_2351041_-	DUF739 family protein	NA	A0A141E1D4	Streptococcus_phage	69.0	2.0e-20
WP_173103800.1|2351200_2351977_+	helix-turn-helix domain-containing protein	NA	U5U470	Staphylococcus_phage	41.6	4.4e-46
WP_173103801.1|2352073_2352763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173104199.1|2352871_2353138_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_173103802.1|2353237_2354389_+|integrase	site-specific integrase	integrase	A0A0S2MYI6	Enterococcus_phage	41.7	2.3e-75
WP_173103803.1|2354477_2354750_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	63.3	2.4e-23
WP_173103804.1|2355038_2355770_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.9	2.0e-24
2358803:2358820	attR	TTTTTCTTTTACTTCTTT	NA	NA	NA	NA
>prophage 192
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2379279	2379735	2740356		Lactobacillus_phage(100.0%)	1	NA	NA
WP_173103828.1|2379279_2379735_-	GNAT family N-acetyltransferase	NA	E9LUK4	Lactobacillus_phage	43.8	6.2e-32
>prophage 193
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2400647	2401340	2740356		Micromonas_pusilla_virus(100.0%)	1	NA	NA
WP_173103847.1|2400647_2401340_-	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	35.0	5.4e-27
>prophage 194
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2405318	2407268	2740356		Bacillus_virus(50.0%)	2	NA	NA
WP_173103851.1|2405318_2406263_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-19
WP_173103852.1|2406263_2407268_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.4	2.5e-17
>prophage 195
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2418767	2420440	2740356		Staphylococcus_phage(50.0%)	2	NA	NA
WP_173103858.1|2418767_2419625_-	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	5.5e-13
WP_173103859.1|2419600_2420440_-	energy-coupling factor ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	1.2e-12
>prophage 196
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2436868	2437621	2740356		Pithovirus(100.0%)	1	NA	NA
WP_173103873.1|2436868_2437621_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.9	1.0e-10
>prophage 197
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2443204	2449575	2740356		Catovirus(33.33%)	6	NA	NA
WP_173103879.1|2443204_2444392_-	elongation factor Tu	NA	A0A1V0SC62	Catovirus	29.9	1.3e-09
WP_173103880.1|2444544_2446629_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	29.1	8.8e-65
WP_071864205.1|2446732_2447203_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003127956.1|2447266_2447680_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_173103881.1|2448109_2448793_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_173103882.1|2448990_2449575_+	recombinase family protein	NA	A0A1V0SLR3	Klosneuvirus	21.4	2.6e-06
>prophage 198
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2452790	2453609	2740356		Grouper_iridovirus(100.0%)	1	NA	NA
WP_173103886.1|2452790_2453609_-	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	41.9	7.7e-57
>prophage 199
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2457128	2462727	2740356		Staphylococcus_phage(33.33%)	5	NA	NA
WP_173104204.1|2457128_2458691_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.5	1.3e-20
WP_173103890.1|2458984_2460106_-	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	41.3	5.7e-71
WP_173103891.1|2460183_2460582_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_173103892.1|2460626_2461289_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_173103893.1|2461425_2462727_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	59.9	3.6e-125
>prophage 200
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2470790	2502467	2740356	integrase	Streptococcus_phage(77.27%)	35	2464015:2464032	2514271:2514288
2464015:2464032	attL	ACTTTTATTCATTTATTA	NA	NA	NA	NA
WP_173103901.1|2470790_2471714_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.6	4.8e-07
WP_173103902.1|2471735_2472017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103903.1|2472199_2472805_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_173103904.1|2472809_2473382_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_173103905.1|2473622_2474546_+	type I pantothenate kinase	NA	NA	NA	NA	NA
WP_173103906.1|2474628_2476194_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.6	3.2e-19
WP_173104206.1|2476470_2477313_-	site-specific DNA-methyltransferase	NA	A0A291LAN5	Bordetella_phage	40.7	1.7e-59
WP_173103907.1|2478521_2479385_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_173103908.1|2479567_2479939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173103909.1|2480156_2481008_+	Rep protein	NA	Q9QTH8	Spiroplasma_phage	31.9	5.2e-08
WP_173103910.1|2481056_2481260_+	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_173104207.1|2481246_2482455_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	28.2	5.5e-27
WP_173103911.1|2482615_2483809_-|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	34.2	8.3e-44
WP_000633907.1|2483835_2484036_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_000845143.1|2484533_2484764_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	78.9	1.0e-27
WP_000804879.1|2484760_2485183_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	68.6	7.5e-48
WP_173103912.1|2485713_2486067_+	helix-turn-helix domain-containing protein	NA	A0A1S5SFA6	Streptococcus_phage	88.8	1.4e-52
WP_032506803.1|2486124_2486313_-	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	61.4	7.4e-16
WP_000691737.1|2486410_2488330_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	97.2	0.0e+00
WP_001791010.1|2488345_2488462_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_173103913.1|2488706_2489636_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	56.2	9.2e-83
WP_000768373.1|2489652_2490675_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	75.5	2.4e-132
WP_173103914.1|2490671_2492699_-	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	65.4	1.8e-195
WP_000331165.1|2492695_2495149_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	78.9	0.0e+00
WP_000723887.1|2495132_2495528_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	72.6	5.9e-47
WP_000248477.1|2495599_2496238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000870467.1|2496293_2496788_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	63.4	2.8e-54
WP_000675717.1|2496854_2497634_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_001009054.1|2497675_2497897_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	93.2	3.1e-29
WP_000055376.1|2497893_2498184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000426689.1|2498180_2499365_-	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	68.1	6.3e-161
WP_001130244.1|2499546_2500950_-	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	66.5	2.2e-176
WP_000185761.1|2500971_2501745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001234191.1|2501754_2502132_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	76.4	9.6e-47
WP_000421279.1|2502152_2502467_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	77.7	1.2e-42
2514271:2514288	attR	ACTTTTATTCATTTATTA	NA	NA	NA	NA
>prophage 201
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2513408	2514110	2740356		Planktothrix_phage(100.0%)	1	NA	NA
WP_173103918.1|2513408_2514110_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.1	2.0e-37
>prophage 202
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2564596	2566447	2740356		Rhodococcus_phage(100.0%)	1	NA	NA
WP_173103964.1|2564596_2566447_-	C40 family peptidase	NA	A0A1W6DXV0	Rhodococcus_phage	39.1	2.3e-08
>prophage 203
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2574237	2575311	2740356		Planktothrix_phage(100.0%)	1	NA	NA
WP_173103971.1|2574237_2575311_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.4	4.1e-26
>prophage 204
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2580363	2583370	2740356		Moumouvirus(50.0%)	2	NA	NA
WP_173103976.1|2580363_2582109_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	40.2	4.6e-83
WP_173103977.1|2582335_2583370_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.2	2.9e-29
>prophage 205
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2607192	2619920	2740356	integrase	Streptococcus_phage(33.33%)	15	2599824:2599838	2616259:2616273
2599824:2599838	attL	ATATTCTGATTCAAT	NA	NA	NA	NA
WP_002372037.1|2607192_2607600_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	48.9	3.6e-31
WP_002372035.1|2607957_2608317_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_173103995.1|2608313_2610431_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	64.4	9.7e-245
WP_173103996.1|2610652_2611465_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_173103997.1|2611626_2612883_+	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	30.1	7.9e-45
WP_002372025.1|2612972_2613170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002406008.1|2613275_2614325_+|integrase	site-specific integrase	integrase	A0A2H4JGN1	uncultured_Caudovirales_phage	25.4	4.3e-20
WP_173103998.1|2614685_2614901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173103999.1|2615050_2615800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137613986.1|2615805_2616801_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
2616259:2616273	attR	ATATTCTGATTCAAT	NA	NA	NA	NA
WP_137614773.1|2617130_2617790_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	40.3	1.0e-06
WP_173104000.1|2617941_2618376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170178040.1|2618491_2618668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137614771.1|2618973_2619267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173104001.1|2619263_2619920_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.9	7.8e-28
>prophage 206
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2624244	2630661	2740356	transposase	Streptococcus_phage(25.0%)	7	NA	NA
WP_173104003.1|2624244_2625561_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.4	3.4e-54
WP_137614766.1|2625660_2626068_-	DUF2871 domain-containing protein	NA	NA	NA	NA	NA
WP_173104004.1|2626077_2626767_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	1.9e-32
WP_173104212.1|2626779_2627844_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_173104005.1|2627861_2628458_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_137614762.1|2628583_2629990_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	36.8	1.2e-68
WP_173104006.1|2630253_2630661_-	hypothetical protein	NA	A0A2H4IYT1	uncultured_Caudovirales_phage	47.2	1.7e-12
>prophage 207
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2634470	2635706	2740356	integrase	Leuconostoc_phage(100.0%)	1	2630026:2630042	2643555:2643571
2630026:2630042	attL	GTGATTTAAAAAAATTA	NA	NA	NA	NA
WP_137598940.1|2634470_2635706_+|integrase	site-specific integrase	integrase	A0A097BYJ7	Leuconostoc_phage	24.9	2.9e-15
WP_137598940.1|2634470_2635706_+|integrase	site-specific integrase	integrase	A0A097BYJ7	Leuconostoc_phage	24.9	2.9e-15
2643555:2643571	attR	TAATTTTTTTAAATCAC	NA	NA	NA	NA
>prophage 208
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2658924	2666314	2740356		Phaeocystis_globosa_virus(50.0%)	2	NA	NA
WP_173104028.1|2658924_2662596_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	1.0e-63
WP_173104029.1|2662699_2666314_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.2	5.8e-48
>prophage 209
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2681056	2688751	2740356		Anomala_cuprea_entomopoxvirus(33.33%)	9	NA	NA
WP_173104043.1|2681056_2681764_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	4.3e-16
WP_173104044.1|2681808_2682495_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_173104045.1|2682565_2683915_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_173104046.1|2684093_2684480_+	VOC family protein	NA	NA	NA	NA	NA
WP_173104047.1|2684535_2685081_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	35.6	5.2e-17
WP_173104048.1|2685103_2685913_-	ATP-dependent sacrificial sulfur transferase LarE	NA	NA	NA	NA	NA
WP_173104049.1|2686017_2686728_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_173104050.1|2686748_2688014_-	nickel pincer cofactor biosynthesis protein LarC	NA	NA	NA	NA	NA
WP_173104051.1|2688010_2688751_-	nickel pincer cofactor biosynthesis protein LarB	NA	A0A288TYA6	Enterococcus_phage	44.0	2.0e-19
>prophage 210
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2692639	2698965	2740356	protease	Organic_Lake_phycodnavirus(33.33%)	5	NA	NA
WP_173104056.1|2692639_2693350_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.4	1.8e-09
WP_173104057.1|2693440_2693731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173104058.1|2693945_2695190_-	U32 family peptidase	NA	Q6DW11	Phage_TP	33.8	3.9e-44
WP_173104059.1|2695385_2696309_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_173104060.1|2696466_2698965_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	40.4	9.7e-127
>prophage 211
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2706192	2718172	2740356	tRNA	Bacillus_phage(33.33%)	11	NA	NA
WP_173104215.1|2706192_2706882_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.9	1.8e-38
WP_173104062.1|2706871_2708092_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.9	1.3e-23
WP_173104063.1|2708566_2709844_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.8	2.9e-95
WP_173104064.1|2710144_2711608_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_173104065.1|2711814_2712288_+	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_173104066.1|2712371_2713856_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.2	4.6e-100
WP_173104067.1|2714055_2714745_-	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_173104068.1|2714816_2715917_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_071865595.1|2716294_2716483_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_173104069.1|2716527_2717418_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.1	1.6e-15
WP_173104070.1|2717407_2718172_-	ParA family protein	NA	Q8JL10	Natrialba_phage	31.7	5.3e-28
>prophage 212
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2723762	2724713	2740356		Niemeyer_virus(100.0%)	1	NA	NA
WP_173104075.1|2723762_2724713_-	paraslipin	NA	A0A0U2UF06	Niemeyer_virus	28.8	3.8e-15
>prophage 213
NZ_AP022822	Enterococcus saigonensis strain VE80	2740356	2732483	2734370	2740356		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_173104081.1|2732483_2734370_-	endonuclease MutS2	NA	F2Y0V3	Organic_Lake_phycodnavirus	26.9	8.3e-14
>prophage 1
NZ_AP022823	Enterococcus saigonensis strain VE80 plasmid pVE80-1, complete sequence	76008	26833	61418	76008	integrase,transposase	Streptococcus_phage(33.33%)	40	37870:37888	60684:60702
WP_173104225.1|26833_27562_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	40.0	2.3e-20
WP_002318457.1|27585_27906_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	49.0	1.2e-21
WP_173104226.1|27886_28171_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	59.4	2.4e-18
WP_081140310.1|28767_29532_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_071863431.1|29528_30182_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.5	7.5e-23
WP_002307506.1|30265_30688_-	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	58.5	2.4e-38
WP_173104240.1|31894_32125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173104227.1|32166_32481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010731557.1|32484_32772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173104228.1|32907_34407_-	primase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002389872.1|34998_35424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287942.1|35440_36253_-	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	32.6	4.7e-30
37870:37888	attL	GGTTCTGTTGCAAAGTTTT	NA	NA	NA	NA
WP_173104229.1|37942_38623_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	1.6e-108
WP_002339787.1|39195_39462_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002339788.1|39451_39808_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_173104230.1|39890_40670_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_173104231.1|40683_41400_-	Fic family protein	NA	NA	NA	NA	NA
WP_173104232.1|41448_42048_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	35.6	3.2e-28
WP_034706604.1|42292_42757_-	signal peptidase II	NA	NA	NA	NA	NA
WP_029486039.1|42780_43005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051661423.1|43211_43547_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_029486041.1|43570_45538_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.9	2.7e-92
WP_029486042.1|45567_45903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000222573.1|46273_47233_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	2.0e-32
WP_173104233.1|47316_48399_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	35.1	2.3e-45
WP_029486043.1|48616_49957_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1P8CWQ1	Bacillus_phage	40.2	2.8e-16
WP_081117352.1|50375_50591_-	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_173104234.1|50720_51883_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	3.5e-79
WP_002301358.1|52393_52936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002307628.1|53248_53800_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	41.7	2.9e-31
WP_173104235.1|54091_56017_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.0	3.3e-98
WP_068561834.1|56315_56630_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068561832.1|56673_57582_+	cation transporter	NA	NA	NA	NA	NA
WP_034536057.1|57681_58293_-	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_068561828.1|58309_58672_-	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	42.2	2.9e-16
WP_010620828.1|58853_59108_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_161841584.1|59092_59359_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_173104236.1|59569_60187_-	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_173104237.1|60203_60566_-	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	41.3	2.9e-16
WP_173104238.1|60737_61418_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.8e-127
60684:60702	attR	GGTTCTGTTGCAAAGTTTT	NA	NA	NA	NA
>prophage 2
NZ_AP022823	Enterococcus saigonensis strain VE80 plasmid pVE80-1, complete sequence	76008	69628	75668	76008	transposase	Streptococcus_phage(66.67%)	10	NA	NA
WP_173104239.1|69628_70309_+|transposase	IS6-like element ISEnfa1 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	88.1	1.4e-112
WP_086321365.1|70516_71344_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000933358.1|71343_72093_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002346952.1|72085_73003_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.2	4.6e-42
WP_000395511.1|73185_73800_-	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	46.8	5.5e-07
WP_002387760.1|73789_74116_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_001808810.1|74152_74317_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000191454.1|74355_75036_+|transposase	IS6-like element ISEnfa1 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	88.5	3.7e-113
WP_002326825.1|75168_75441_-	antitoxin	NA	A0A1X9I6E5	Streptococcus_phage	96.7	5.4e-07
WP_000527318.1|75458_75668_-	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	98.6	1.4e-31
