The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP021891	Escherichia coli strain 2017.01.04CC	4615626	990895	1004078	4615626		Escherichia_phage(40.0%)	12	NA	NA
WP_001295182.1|990895_991657_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|991650_992277_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|992416_993556_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|993618_994611_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104429.1|994704_996069_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|996157_996934_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|996938_997577_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_124038344.1|997573_998836_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.7	1.4e-134
WP_000847985.1|998832_999741_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001295181.1|999936_1000704_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141323.1|1000754_1001411_-	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	45.8	3.3e-50
WP_001272928.1|1001516_1004078_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_AP021891	Escherichia coli strain 2017.01.04CC	4615626	1379546	1390824	4615626	integrase,transposase	Enterobacteria_phage(58.82%)	18	1375856:1375872	1394078:1394094
1375856:1375872	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001163428.1|1379546_1379747_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_021571402.1|1379870_1380215_-	hypothetical protein	NA	A0A2I6PID6	Escherichia_phage	97.4	1.7e-58
WP_001277766.1|1380315_1380495_-	Eag protein	NA	K7PL40	Enterobacteria_phage	96.6	2.8e-28
WP_021571401.1|1380591_1381158_-	ead/Ea22-like family protein	NA	K7PK20	Enterobacteria_phage	70.7	2.0e-88
WP_001214440.1|1381154_1381322_-	DUF2737 family protein	NA	G9L664	Escherichia_phage	100.0	1.5e-23
WP_001111304.1|1381332_1381629_-	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_124038460.1|1381652_1382036_-	hypothetical protein	NA	K7P7R8	Enterobacteria_phage	99.2	8.5e-67
WP_124038461.1|1382035_1382641_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	99.5	1.2e-107
WP_001183771.1|1382897_1383068_-	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	100.0	1.3e-24
WP_038977032.1|1383151_1383400_-	hypothetical protein	NA	K7P6N6	Enterobacteria_phage	98.8	4.5e-37
WP_001037043.1|1383534_1383693_-	hypothetical protein	NA	K7PMD4	Enterobacterial_phage	100.0	9.9e-22
WP_124038462.1|1383692_1383989_-	hypothetical protein	NA	K7PH98	Enterobacteria_phage	98.0	9.5e-50
WP_000213975.1|1384028_1384229_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_124038518.1|1385056_1385734_-	glucosyltransferase domain-containing protein	NA	F1C5A9	Cronobacter_phage	34.6	2.3e-22
WP_085947771.1|1386519_1387681_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_124038406.1|1387905_1388268_-	GtrA family protein	NA	U5P0S6	Shigella_phage	87.5	3.0e-53
WP_124038405.1|1388483_1389491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124038407.1|1389666_1390824_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.7	1.7e-222
1394078:1394094	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_AP021891	Escherichia coli strain 2017.01.04CC	4615626	1641842	1651283	4615626		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569358.1|1641842_1642769_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1642773_1643505_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1643485_1643593_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1643652_1644384_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1644605_1646291_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1646287_1647007_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1647053_1647524_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1647563_1648025_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_124038421.1|1648149_1650150_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_089601661.1|1650146_1651283_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	1.9e-162
>prophage 4
NZ_AP021891	Escherichia coli strain 2017.01.04CC	4615626	1742026	1750828	4615626		Klebsiella_phage(16.67%)	6	NA	NA
WP_001115987.1|1742026_1743421_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	1.7e-19
WP_000999466.1|1743578_1744574_+	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_000183075.1|1744816_1745710_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000234389.1|1746019_1747039_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	48.0	3.2e-84
WP_000043439.1|1748006_1749413_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_028120151.1|1749661_1750828_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	51.9	5.5e-109
>prophage 5
NZ_AP021891	Escherichia coli strain 2017.01.04CC	4615626	2185476	2297768	4615626	lysis,portal,transposase,integrase,terminase,protease,tail	Enterobacteria_phage(42.31%)	114	2179743:2179761	2297482:2297500
2179743:2179761	attL	TGCTCCGGTGTCAGTTCTG	NA	NA	NA	NA
WP_001260865.1|2185476_2186298_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2186397_2186481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743957.1|2186573_2186909_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2187305_2188559_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|2188665_2189559_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|2189693_2190914_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2191038_2191734_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2191686_2192979_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2193137_2193752_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_023281261.1|2193794_2194649_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2194650_2195268_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_072131186.1|2195278_2197702_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	4.8e-208
WP_032161813.1|2197762_2200189_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	7.7e-214
WP_001300836.1|2200387_2200693_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_072131602.1|2200800_2201481_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2201513_2202074_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2202108_2202450_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2202584_2202911_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2203116_2204331_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_023281252.1|2204342_2205362_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	3.7e-16
WP_001360138.1|2205419_2205530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124038385.1|2205549_2206830_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	9.6e-155
WP_000005552.1|2206864_2207116_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_124038386.1|2207188_2209660_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083271.1|2209753_2209945_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2209941_2210130_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000159335.1|2210632_2210833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001241297.1|2210801_2211179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379591.1|2211178_2211331_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_124038387.1|2211523_2211931_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	1.5e-24
WP_000476993.1|2212008_2212236_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_124038388.1|2212219_2212741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054487.1|2212721_2213687_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_001441842.1|2213727_2214150_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.5	4.7e-66
WP_170386723.1|2214264_2215236_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_001441843.1|2215729_2215867_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	97.8	1.5e-18
WP_000753057.1|2215904_2216081_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	1.9e-26
WP_000887491.1|2216943_2217156_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000980999.1|2217372_2217624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|2217690_2217969_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_032200038.1|2217970_2219020_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	3.3e-113
WP_001204787.1|2219037_2219415_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_000780584.1|2219570_2220095_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_000592549.1|2220287_2221247_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_024168019.1|2221653_2222367_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000839587.1|2222557_2222773_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	2.9e-32
WP_000165360.1|2222777_2222996_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	63.8	1.6e-17
WP_001013163.1|2223020_2223317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029364068.1|2223444_2223978_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	2.6e-98
WP_001071774.1|2223974_2224472_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|2224835_2225048_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071528545.1|2225058_2225247_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|2225397_2225553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|2225725_2225899_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|2226194_2226401_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_000421825.1|2226951_2227491_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_124038390.1|2227499_2229599_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.3	0.0e+00
WP_124038391.1|2229595_2229808_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	5.4e-31
WP_000985957.1|2229807_2231316_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	2.9e-288
WP_088550210.1|2231260_2233288_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_124038392.1|2233374_2233698_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	2.5e-51
WP_001283153.1|2233690_2233966_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_020219021.1|2233977_2234556_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_124038393.1|2234552_2234954_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	98.5	4.6e-71
WP_000211109.1|2234965_2235709_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001297778.1|2235769_2236156_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
WP_124038394.1|2236164_2236494_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	98.2	1.9e-54
WP_000447253.1|2239522_2239852_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_032200034.1|2239861_2240560_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.3	5.6e-133
WP_032200033.1|2240564_2241308_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	1.0e-148
WP_023277304.1|2241205_2241853_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	4.7e-110
WP_172409715.1|2241913_2245312_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	88.2	0.0e+00
WP_001233093.1|2245378_2245978_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	98.0	2.2e-109
WP_124038432.1|2246042_2249066_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	1.9e-68
WP_001421130.1|2249065_2249647_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	92.7	2.1e-101
WP_001421370.1|2250466_2250664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000347482.1|2251380_2252664_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_023281233.1|2252752_2254213_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.2	1.5e-42
WP_000214712.1|2254248_2254452_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000215549.1|2254628_2255315_-	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000636568.1|2255403_2256150_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_001515364.1|2256286_2258332_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_001024746.1|2258375_2258894_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000671731.1|2259169_2259562_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_000592826.1|2259816_2260707_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
WP_000901367.1|2260925_2261021_-	protein MgtS	NA	NA	NA	NA	NA
WP_001054207.1|2261147_2262335_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000087214.1|2262529_2263429_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000803659.1|2263459_2263678_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|2263709_2264093_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000843414.1|2264112_2264547_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000885033.1|2264758_2265424_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000210799.1|2265448_2266639_-	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_032161825.1|2266788_2267904_-	putative protein YneK	NA	NA	NA	NA	NA
WP_000366501.1|2267981_2268863_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000156615.1|2268963_2270352_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000257409.1|2270415_2271342_+	glutaminase B	NA	NA	NA	NA	NA
WP_001191019.1|2271341_2271701_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000854633.1|2272986_2274438_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_001469607.1|2274644_2275559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001286597.1|2275562_2276321_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000558527.1|2276377_2276668_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774189.1|2276691_2277567_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000172466.1|2277594_2278617_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_001222721.1|2278628_2279621_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_001459750.1|2279620_2280649_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001194849.1|2280642_2282178_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	23.6	7.2e-16
WP_000154351.1|2282426_2283380_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113162.1|2283458_2285051_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001301023.1|2291223_2291490_+	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_001125439.1|2291489_2292812_+	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_000876763.1|2294826_2295357_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000825452.1|2295369_2295873_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_016947065.1|2296631_2297768_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
2297482:2297500	attR	CAGAACTGACACCGGAGCA	NA	NA	NA	NA
>prophage 6
NZ_AP021891	Escherichia coli strain 2017.01.04CC	4615626	2385381	2484414	4615626	lysis,transposase,terminase,tRNA,tail	Escherichia_phage(39.47%)	83	NA	NA
WP_000826416.1|2385381_2386590_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.7e-206
WP_001261013.1|2387121_2387790_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_001723473.1|2388092_2388686_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001296725.1|2388682_2389675_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_023281211.1|2389798_2390779_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_124038400.1|2390770_2391310_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2391372_2391597_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|2391735_2393391_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_001723470.1|2393615_2394959_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414567.1|2395175_2396099_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_124038399.1|2396136_2397777_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|2398175_2398325_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2398396_2398570_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|2398814_2399345_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000115943.1|2400574_2402014_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027942.1|2402210_2403011_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139543.1|2403282_2407185_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048950.1|2407385_2407991_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_124038398.1|2408044_2409361_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000097802.1|2413554_2414415_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123448.1|2414646_2415237_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039895.1|2415218_2416169_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|2416269_2417583_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206197.1|2417609_2418815_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|2418814_2419237_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_063081685.1|2419226_2420654_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969784.1|2420655_2421444_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|2421443_2422211_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206388.1|2422207_2423278_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189201.1|2423285_2423783_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|2423797_2424544_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2424552_2424840_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191077.1|2424851_2425781_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_124038397.1|2426065_2428111_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_124038396.1|2428358_2430632_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|2430689_2432189_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067519.1|2432424_2433330_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001300734.1|2433501_2433828_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|2433835_2434021_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_023281204.1|2434017_2436657_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762236.1|2436864_2437854_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_001298828.1|2437964_2438387_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2438383_2438650_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628243.1|2438923_2442448_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837924.1|2442814_2443948_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001295593.1|2444088_2444523_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001157925.1|2444787_2444961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795384.1|2445300_2445414_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2445482_2445716_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078178.1|2446032_2446623_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_024238404.1|2446720_2447296_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	2.7e-101
WP_172409716.1|2447295_2450646_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	39.1	1.3e-12
WP_001233114.1|2450710_2451310_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
WP_172409717.1|2451377_2454857_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_000741589.1|2454917_2455565_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_000140750.1|2455462_2456206_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.9e-148
WP_024238971.1|2456211_2456910_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.4	1.6e-127
WP_000024051.1|2456909_2457248_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_124038513.1|2457240_2458407_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	36.5	3.0e-54
WP_124038508.1|2460244_2461651_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	8.8e-186
WP_053272183.1|2461653_2462955_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.3	1.8e-148
WP_172409718.1|2462935_2464030_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.2	2.9e-112
WP_000613571.1|2464033_2464285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204037.1|2464220_2465153_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_001291094.1|2465145_2465937_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001097895.1|2466074_2467532_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_032196017.1|2467728_2467884_-	membrane protein	NA	K7PHU6	Enterobacteria_phage	100.0	2.0e-11
WP_085947771.1|2467949_2469111_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001351713.1|2469391_2469889_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_000839565.1|2469888_2470104_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|2470355_2470730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|2470901_2471330_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000640161.1|2472375_2472918_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000247763.1|2472914_2473205_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000166319.1|2476183_2476993_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2477049_2477244_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2477236_2477446_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2477524_2477740_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2477741_2478977_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157407.1|2479028_2479964_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123737.1|2480092_2481466_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2481943_2482927_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|2483181_2484414_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 7
NZ_AP021891	Escherichia coli strain 2017.01.04CC	4615626	3566372	3622386	4615626	integrase,plate,transposase,capsid	Streptococcus_phage(20.0%)	59	3574452:3574501	3585304:3585353
WP_172409736.1|3566372_3567401_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000582631.1|3567419_3567782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024233086.1|3567778_3567991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130238211.1|3568324_3568663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016159682.1|3568664_3569075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021513209.1|3569207_3569483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124783487.1|3569494_3570166_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000005469.1|3570219_3570390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124783488.1|3570409_3570598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021562836.1|3572602_3573142_+	recombinase family protein	NA	Q2A092	Sodalis_phage	41.3	5.4e-27
WP_000788776.1|3573694_3573847_-	hypothetical protein	NA	NA	NA	NA	NA
3574452:3574501	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAATGCG	NA	NA	NA	NA
WP_172409737.1|3574589_3575663_+|integrase	tyrosine-type recombinase/integrase	integrase	W6MYA3	Pseudomonas_phage	37.7	9.4e-47
WP_140017598.1|3575680_3577081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097734168.1|3577306_3577519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140017597.1|3577588_3578983_-	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_001575473.1|3578985_3579159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024046449.1|3579170_3579965_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_097734171.1|3580046_3580400_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_097734173.1|3580687_3580954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097734174.1|3581706_3581958_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	36.2	1.7e-07
WP_097734176.1|3582117_3582798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097734177.1|3582794_3583907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097734178.1|3583903_3585022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000893278.1|3585494_3586748_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3585304:3585353	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAATGCG	NA	NA	NA	NA
WP_001285288.1|3586759_3587863_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_124038439.1|3588150_3589206_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	1.5e-116
WP_000174677.1|3589244_3589646_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|3589703_3590948_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3591039_3591498_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293003.1|3591758_3593216_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001353768.1|3593272_3593830_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001321003.1|3593741_3594008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059847.1|3594241_3594694_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263493.1|3594703_3595102_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|3595104_3595398_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_124038438.1|3595449_3596505_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207587.1|3596575_3597361_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_005136326.1|3597305_3599045_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|3599268_3599766_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_015675129.1|3599941_3600715_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.3e-20
WP_000729704.1|3600900_3601161_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615976.1|3601163_3601442_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|3601597_3602338_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_124038437.1|3602308_3603076_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3603281_3603860_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973083.1|3604099_3606544_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|3606586_3607060_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118036.1|3607213_3607984_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_096151642.1|3608024_3609161_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000008098.1|3609591_3609768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101841.1|3609764_3609983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124038436.1|3609960_3614187_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_024238614.1|3614262_3616404_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|3616613_3617132_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|3617826_3618327_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3618361_3618586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|3618636_3620112_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611742.1|3620118_3620532_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393832.1|3620535_3622386_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
