The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP021893	Escherichia coli strain 2018-06-4CC	4753810	1032999	1046182	4753810		Escherichia_phage(40.0%)	12	NA	NA
WP_001295182.1|1032999_1033761_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1033754_1034381_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1034520_1035660_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1035722_1036715_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104429.1|1036808_1038173_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1038261_1039038_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1039042_1039681_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590404.1|1039677_1040940_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	6.3e-135
WP_000847985.1|1040936_1041845_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001295181.1|1042040_1042808_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141339.1|1042858_1043515_-	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	45.3	5.6e-50
WP_032202565.1|1043620_1046182_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.9e-30
>prophage 2
NZ_AP021893	Escherichia coli strain 2018-06-4CC	4753810	1650800	1660242	4753810		Enterobacteria_phage(85.71%)	10	NA	NA
WP_172408775.1|1650800_1651727_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1651731_1652463_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1652443_1652551_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1652610_1653342_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1653563_1655249_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1655245_1655965_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1656011_1656482_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001373589.1|1656522_1656984_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001423058.1|1657108_1659109_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001333512.1|1659105_1660242_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 3
NZ_AP021893	Escherichia coli strain 2018-06-4CC	4753810	1750514	1760059	4753810		Bacillus_phage(28.57%)	8	NA	NA
WP_001115957.1|1750514_1751909_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
WP_000183060.1|1752083_1752977_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_032173264.1|1753302_1754319_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	50.2	9.8e-86
WP_032173265.1|1754650_1755769_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.8	1.4e-133
WP_032173266.1|1755772_1756738_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	6.4e-87
WP_047662165.1|1756740_1757241_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_032224293.1|1757233_1758682_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.4	4.8e-54
WP_032172825.1|1758685_1760059_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.9	2.2e-32
>prophage 4
NZ_AP021893	Escherichia coli strain 2018-06-4CC	4753810	2258012	2321019	4753810	protease,portal,integrase,tail,lysis	Enterobacteria_phage(45.45%)	72	2265588:2265604	2295597:2295613
WP_001260865.1|2258012_2258834_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2258933_2259017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743957.1|2259109_2259445_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2259841_2261095_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|2261201_2262095_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|2262229_2263450_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2263574_2264270_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2264222_2265515_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2265588:2265604	attL	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_000148710.1|2265673_2266288_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526477.1|2266330_2267185_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2267186_2267804_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_072169196.1|2267814_2270238_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	1.3e-208
WP_001761878.1|2270298_2272725_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.3	2.3e-213
WP_001295396.1|2272923_2273229_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_072104773.1|2273336_2274047_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2274049_2274610_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2274644_2274986_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001295395.1|2275120_2275447_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_001295394.1|2275652_2276867_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836059.1|2276878_2277898_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2277955_2278066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877007.1|2278085_2279366_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	7.3e-155
WP_000005552.1|2279400_2279652_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_032216168.1|2279724_2282196_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	3.2e-58
WP_001083273.1|2282289_2282481_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2282477_2282666_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001328010.1|2283081_2283369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001241297.1|2283337_2283715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379591.1|2283714_2283867_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001003381.1|2284059_2284467_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|2284544_2284772_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|2284755_2285277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032200040.1|2285952_2286375_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	8.2e-63
WP_001441843.1|2286882_2287020_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	97.8	1.5e-18
WP_000753057.1|2287057_2287234_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	1.9e-26
WP_000887491.1|2288096_2288309_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000980999.1|2288525_2288777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|2288843_2289122_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_032200038.1|2289123_2290173_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	3.3e-113
WP_001204787.1|2290190_2290568_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_172408811.1|2290723_2291248_-	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	52.9	1.3e-46
WP_000592549.1|2291440_2292400_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_024168019.1|2292806_2293520_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000839587.1|2293710_2293926_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	2.9e-32
WP_112901559.1|2293930_2294149_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.3	4.6e-17
WP_001013163.1|2294173_2294470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029364068.1|2294597_2295131_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	2.6e-98
WP_001071774.1|2295127_2295625_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
2295597:2295613	attR	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_000066495.1|2295988_2296201_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071528545.1|2296211_2296400_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|2296547_2296703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|2296875_2297049_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|2297344_2297551_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_000421825.1|2298101_2298641_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001072975.1|2300745_2300958_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001459763.1|2300957_2302433_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	2.0e-281
WP_077763148.1|2302410_2304438_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.5	0.0e+00
WP_001097045.1|2304524_2304848_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_001283153.1|2304840_2305116_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677108.1|2305127_2305706_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001079398.1|2305702_2306104_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211099.1|2306115_2306859_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	99.6	3.0e-132
WP_001298500.1|2306919_2307306_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_001161009.1|2307314_2307644_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001459760.1|2307615_2310690_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	95.5	0.0e+00
WP_000447253.1|2310689_2311019_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_032198005.1|2311028_2311727_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.3	1.2e-132
WP_032223304.1|2311732_2312476_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	1.4e-150
WP_032198003.1|2312373_2313021_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	2.5e-111
WP_001230352.1|2316546_2317146_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.3e-109
WP_151326849.1|2317210_2320438_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	58.8	6.4e-06
WP_097408724.1|2320437_2321019_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.1	8.9e-100
>prophage 5
NZ_AP021893	Escherichia coli strain 2018-06-4CC	4753810	2463817	2586687	4753810	holin,terminase,coat,tail,tRNA,transposase,lysis	Escherichia_phage(40.98%)	118	NA	NA
WP_000826416.1|2463817_2465026_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.7e-206
WP_001261013.1|2465557_2466226_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_032202759.1|2466528_2467122_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001300478.1|2467118_2468111_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234023.1|2468234_2469215_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_000140873.1|2469206_2469746_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2469808_2470033_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|2470172_2471828_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013789.1|2472052_2473396_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414567.1|2473612_2474536_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098568.1|2474573_2476214_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_088551916.1|2476589_2477958_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001320773.1|2478058_2478208_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2478279_2478453_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|2478697_2479228_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000115937.1|2480459_2481899_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027964.1|2482095_2482896_-	YdcF family protein	NA	NA	NA	NA	NA
WP_025670749.1|2483167_2487070_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048951.1|2487270_2487876_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627365.1|2487926_2489243_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000471482.1|2491067_2493374_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_063856378.1|2493437_2494298_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123448.1|2494529_2495120_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039895.1|2495101_2496052_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|2496152_2497466_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206197.1|2497492_2498698_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|2498697_2499120_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973371.1|2499109_2500537_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_032202595.1|2500538_2501327_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|2501326_2502094_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206388.1|2502090_2503161_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189201.1|2503168_2503666_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|2503680_2504427_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2504435_2504723_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191077.1|2504734_2505664_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186468.1|2505948_2507994_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535466.1|2508241_2510515_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|2510572_2512072_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_025670752.1|2512307_2513213_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001300734.1|2513384_2513711_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|2513718_2513904_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900943.1|2513900_2516540_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762236.1|2516747_2517737_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_001298828.1|2517847_2518270_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2518266_2518533_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628243.1|2518806_2522331_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837924.1|2522697_2523831_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001300461.1|2523971_2524406_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_001157925.1|2524671_2524845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795384.1|2525184_2525298_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2525366_2525600_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078178.1|2525916_2526507_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001351719.1|2526604_2527180_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	1.2e-101
WP_172408814.1|2527179_2530407_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	58.8	6.4e-06
WP_001233121.1|2530471_2531071_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	7.2e-105
WP_172408815.1|2531138_2534618_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_000090943.1|2534678_2535281_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	4.0e-87
WP_001351716.1|2535217_2535961_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	1.0e-145
WP_001152432.1|2535966_2536665_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_000024051.1|2536664_2537003_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_172408816.1|2536995_2540229_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.4	1.5e-111
WP_012565075.1|2540702_2541062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|2541212_2542175_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_000144678.1|2542201_2542594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029815.1|2542590_2542971_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000524260.1|2542971_2543355_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_000908084.1|2543752_2543929_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_063856380.1|2543971_2545111_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	74.5	3.1e-157
WP_000770042.1|2545209_2545974_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
WP_001351715.1|2546078_2547191_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
WP_000763704.1|2547174_2548581_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_000625348.1|2548583_2549885_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000089447.1|2549865_2550960_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000613571.1|2550963_2551215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204037.1|2551150_2552083_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_001291094.1|2552075_2552867_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001097895.1|2553004_2554462_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_157915680.1|2554599_2554728_-|lysis	lysis protein	lysis	A0A1B5FPA1	Escherichia_phage	81.6	7.0e-10
WP_172408817.1|2554693_2555065_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	94.9	1.0e-53
WP_001351713.1|2555061_2555559_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_000839565.1|2555558_2555774_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|2556025_2556400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|2556571_2557000_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_152922190.1|2558044_2558587_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	6.4e-76
WP_000247763.1|2558583_2558874_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_025670565.1|2558873_2559473_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.5	3.2e-105
WP_000813269.1|2559941_2560097_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000323025.1|2560168_2560456_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2560455_2560695_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_172408818.1|2560719_2561025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001349760.1|2561227_2561560_+	FlxA-like family protein	NA	NA	NA	NA	NA
WP_000589013.1|2561996_2563337_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_122056959.1|2563514_2563622_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	1.1e-08
WP_001117227.1|2564133_2565333_+	MFS transporter	NA	NA	NA	NA	NA
WP_000957772.1|2565344_2566037_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000019009.1|2566033_2566915_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000625667.1|2567045_2568323_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001676522.1|2568386_2570384_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_001151151.1|2570724_2571147_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_069722905.1|2571187_2572258_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_000693836.1|2572329_2572755_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391949.1|2572738_2573020_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362155.1|2573120_2573540_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_001169151.1|2573938_2574094_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_063856386.1|2574090_2574579_-	super-infection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2575020_2575242_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2575241_2575412_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2575486_2575762_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_024232464.1|2575863_2578464_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
WP_000166319.1|2578456_2579266_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2579322_2579517_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2579509_2579719_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2579797_2580013_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2580014_2581250_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157406.1|2581301_2582237_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123737.1|2582365_2583739_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2584216_2585200_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|2585454_2586687_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 6
NZ_AP021893	Escherichia coli strain 2018-06-4CC	4753810	3024922	3111229	4753810	protease,portal,head,plate,terminase,capsid,integrase,tail,tRNA,lysis	Salmonella_phage(57.63%)	91	3017885:3017900	3113800:3113815
3017885:3017900	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|3024922_3026215_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_063856169.1|3026305_3027649_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	3.6e-80
WP_032202383.1|3027659_3028271_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_016231093.1|3028425_3032376_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3032510_3033005_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3033549_3034515_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043578.1|3034637_3036404_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_001202202.1|3036404_3038126_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
WP_001241676.1|3038167_3038872_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3039156_3039375_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3040234_3042511_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3042541_3042862_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3043184_3043409_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188140.1|3043481_3045428_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746460.1|3045424_3046540_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001380339.1|3046690_3047647_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599802.1|3047643_3049302_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|3049726_3050422_+	aquaporin Z	NA	NA	NA	NA	NA
WP_001338421.1|3050916_3051816_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458809.1|3051959_3053612_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|3053623_3054592_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|3054724_3056443_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000566372.1|3056479_3057481_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136577.1|3057491_3058922_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|3059020_3060034_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_097504552.1|3060030_3060861_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3060857_3061181_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270734.1|3061306_3061822_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027213.1|3062039_3062768_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	4.6e-29
WP_000756569.1|3062785_3063517_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3063523_3064240_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3064239_3064908_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295339.1|3065198_3065930_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149767.1|3066128_3067256_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_000389260.1|3067296_3067785_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|3067844_3068690_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093854.1|3068686_3069640_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996005.1|3069649_3070783_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126073.1|3070877_3071990_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3072340_3072817_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3072904_3073807_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|3073867_3074590_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3074573_3074861_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195225.1|3075020_3075278_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	3.0e-23
WP_000681108.1|3075307_3075685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|3075954_3077640_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|3077875_3078094_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011800.1|3078184_3079285_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	86.3	1.2e-177
WP_032258246.1|3079281_3079767_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	1.8e-66
WP_172408824.1|3079763_3082841_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.5	0.0e+00
WP_000763314.1|3082833_3082953_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	84.6	4.1e-12
WP_001281009.1|3082967_3083270_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|3083324_3083840_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_172408825.1|3083849_3085022_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	3.2e-205
WP_000905023.1|3085164_3085731_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
WP_172408855.1|3085761_3086265_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.6	5.4e-45
WP_040073407.1|3086264_3086867_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	8.6e-98
WP_032172853.1|3086838_3087282_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	50.3	6.2e-37
WP_172408826.1|3087284_3088787_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.4	3.6e-153
WP_048217755.1|3088783_3089389_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.6e-110
WP_061548810.1|3089381_3090290_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	5.9e-143
WP_001522712.1|3090276_3090636_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	88.2	5.0e-53
WP_032344227.1|3090632_3091211_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	7.2e-94
WP_061548811.1|3091367_3093164_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_061548812.1|3093170_3093614_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.6	3.1e-60
WP_001522707.1|3093606_3094038_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	4.9e-71
WP_061548813.1|3094133_3094562_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	1.4e-46
WP_000727851.1|3094558_3094936_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
WP_001069905.1|3094937_3095450_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000171568.1|3095430_3095646_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_061548814.1|3095649_3095853_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	8.8e-31
WP_000673529.1|3095852_3096317_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	8.4e-77
WP_042099595.1|3096412_3097063_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	3.3e-111
WP_061548815.1|3097066_3098125_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	6.4e-181
WP_021532216.1|3098141_3098975_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	85.2	3.7e-123
WP_061351135.1|3099117_3100884_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000520364.1|3100883_3101918_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	89.0	2.4e-172
WP_000497736.1|3101969_3103121_-	TIGR02391 family protein	NA	NA	NA	NA	NA
WP_001217575.1|3103430_3103664_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3103674_3103863_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_040075603.1|3104016_3106431_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
WP_047204267.1|3106427_3107285_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.8e-158
WP_000752610.1|3107281_3107509_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001504056.1|3107508_3107742_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	7.0e-32
WP_001504055.1|3107809_3108151_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	5.1e-55
WP_001504054.1|3108114_3108315_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	95.5	4.6e-32
WP_059340354.1|3108322_3108832_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	97.6	3.7e-86
WP_001247707.1|3108864_3109086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047320.1|3109211_3109781_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.9e-39
WP_001513672.1|3109796_3109988_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_000290937.1|3110176_3111229_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
3113800:3113815	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 7
NZ_AP021893	Escherichia coli strain 2018-06-4CC	4753810	3649712	3732852	4753810	holin,protease,portal,plate,terminase,capsid,integrase,tail,head	Enterobacteria_phage(32.31%)	96	3686413:3686468	3728941:3728996
WP_000131044.1|3649712_3651746_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3651874_3652462_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3652475_3653948_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159095.1|3653961_3655632_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3655844_3656513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3656755_3657451_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3657443_3658871_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3658881_3659601_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3660127_3660982_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046307.1|3661207_3662533_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|3662641_3662878_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3662889_3663483_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001459486.1|3664072_3664924_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001564478.1|3665063_3669320_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|3670434_3670536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3670899_3671163_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3671162_3671303_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3671337_3671565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|3672388_3672931_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3673005_3673593_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716383.1|3673650_3674319_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001301239.1|3676860_3678504_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301243.1|3678472_3679183_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3679495_3679825_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000070699.1|3681103_3681793_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643332.1|3681789_3682746_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667036.1|3682742_3684941_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	4.3e-38
WP_000121346.1|3684950_3685907_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111347.1|3685885_3686296_+	hypothetical protein	NA	NA	NA	NA	NA
3686413:3686468	attL	TTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_012602456.1|3687113_3688328_+	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_072095179.1|3688362_3689766_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.0e-106
WP_000355484.1|3690199_3690973_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000904983.1|3691030_3691585_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.3	2.8e-87
WP_104769903.1|3691614_3692118_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	60.6	3.7e-46
WP_053903524.1|3692117_3692720_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.0e-98
WP_172408831.1|3692691_3693135_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	60.5	1.9e-46
WP_000383554.1|3693782_3694367_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	1.6e-112
WP_000785308.1|3694357_3695416_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.9	1.6e-200
WP_000424745.1|3695402_3695828_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	6.7e-81
WP_001519515.1|3695827_3696376_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	1.2e-95
WP_001519514.1|3696375_3697455_-	hypothetical protein	NA	U5P0H6	Shigella_phage	99.4	3.4e-206
WP_000219910.1|3697451_3698780_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_001519513.1|3698840_3700676_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.3	2.2e-306
WP_000661054.1|3700817_3701087_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090997.1|3701086_3701443_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	9.0e-63
WP_001519512.1|3701442_3702939_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.8	3.8e-272
WP_000497751.1|3702922_3703093_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779279.1|3703101_3703662_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_000213502.1|3703658_3704165_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
WP_001519511.1|3704139_3704550_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.1	2.9e-73
WP_000927707.1|3704546_3704870_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	98.1	3.3e-56
WP_000601364.1|3704872_3705073_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	8.4e-26
WP_172408832.1|3705122_3706328_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.0	1.7e-222
WP_001193633.1|3706342_3706993_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	7.3e-119
WP_000466255.1|3706970_3708212_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605606.1|3708211_3708394_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_065312442.1|3708405_3709902_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	1.7e-299
WP_000929174.1|3710152_3710638_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	99.4	2.1e-86
WP_089586273.1|3710763_3711114_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	1.2e-62
WP_001089762.1|3711264_3711600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089586272.1|3711700_3712270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001356320.1|3712433_3712826_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	87.6	9.3e-53
WP_113416945.1|3712809_3713286_-	glycoside hydrolase family 104 protein	NA	S5FV07	Shigella_phage	94.9	1.6e-83
WP_000544528.1|3713272_3713578_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_029396340.1|3713899_3714589_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.5	1.1e-56
WP_001568558.1|3714585_3714726_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	1.3e-09
WP_134894238.1|3714722_3715085_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	2.5e-60
WP_074468305.1|3715081_3715372_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	3.3e-47
WP_000211034.1|3715364_3715535_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_050010320.1|3715534_3715990_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	5.4e-60
WP_001303586.1|3715986_3716088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000017329.1|3716177_3716687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162721248.1|3717224_3717788_-	hypothetical protein	NA	K7P7J4	Enterobacteria_phage	72.3	2.2e-10
WP_096891597.1|3718194_3718404_-	hypothetical protein	NA	A0A0F6TK62	Escherichia_coli_O157_typing_phage	79.7	4.7e-27
WP_000062289.1|3718421_3718622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029488730.1|3718618_3718912_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	94.6	1.9e-42
WP_172408833.1|3718908_3719610_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.9	1.2e-127
WP_172408834.1|3719606_3720626_-	replication protein	NA	M1FN81	Enterobacteria_phage	67.3	2.2e-109
WP_021571942.1|3720622_3721162_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	4.4e-61
WP_001067459.1|3721243_3721474_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	8.5e-22
WP_000858975.1|3721578_3722268_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_060710353.1|3722556_3723027_+	SocA family protein	NA	D0UIM3	Aggregatibacter_phage	40.1	5.6e-20
WP_060710354.1|3723026_3723410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233576.1|3723883_3724090_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|3724165_3724462_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_001302855.1|3724467_3725253_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000186846.1|3725249_3725930_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682559.1|3725926_3726085_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.2	1.5e-22
WP_000129285.1|3726081_3726639_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_001386642.1|3726649_3726931_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763373.1|3727029_3727248_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000488407.1|3727295_3727574_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000051905.1|3727772_3728936_+|integrase	site-specific integrase	integrase	S5FNS2	Shigella_phage	100.0	4.1e-229
WP_000893279.1|3729140_3730394_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	2.2e-95
3728941:3728996	attR	TTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3730405_3731509_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|3731796_3732852_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
