The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP022337	Mameliella alba strain KU6B	5386988	2234317	2251079	5386988	protease,head,portal,tail	Dinoroseobacter_phage(25.0%)	21	NA	NA
WP_088668716.1|2234317_2234899_-|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
WP_043143471.1|2234957_2235578_-	MarC family protein	NA	NA	NA	NA	NA
WP_043143476.1|2237663_2238086_+	nucleoside-diphosphate kinase	NA	NA	NA	NA	NA
WP_043143478.1|2238172_2238505_-	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_074620829.1|2238501_2239302_-	isocitrate lyase/phosphoenolpyruvate mutase family protein	NA	NA	NA	NA	NA
WP_172429764.1|2239294_2240485_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_167647767.1|2240750_2241125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172429765.1|2241126_2242404_+	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	39.9	5.5e-70
WP_172429766.1|2242763_2243963_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	35.9	7.5e-61
WP_082024671.1|2243955_2244183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172429767.1|2244217_2244757_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	48.1	8.1e-31
WP_043143495.1|2246158_2246752_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_043143497.1|2246748_2247084_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_172429768.1|2247080_2247497_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_172429769.1|2247543_2247951_+|tail	phage major tail protein, TP901-1 family	tail	A0A1J0GVL1	Pseudoalteromonas_phage	33.6	2.0e-05
WP_172429770.1|2247954_2248287_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_172429771.1|2248273_2248474_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_074620840.1|2248470_2249121_+|tail	phage tail tape measure protein	tail	D6PFD6	uncultured_phage	31.2	2.9e-14
WP_167647772.1|2249131_2249764_+	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	50.7	5.2e-61
WP_172429772.1|2249763_2250648_+	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	39.7	5.9e-55
WP_043143510.1|2250644_2251079_+	peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	44.5	3.1e-25
>prophage 2
NZ_AP022337	Mameliella alba strain KU6B	5386988	3449442	3548563	5386988	tRNA,integrase,terminase,protease,holin,transposase	Streptococcus_phage(14.29%)	90	3451659:3451676	3483762:3483779
WP_172430354.1|3449442_3450147_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_172430355.1|3450206_3451745_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
3451659:3451676	attL	GCCCGCGGCGCCAAGCCG	NA	NA	NA	NA
WP_172430356.1|3452626_3452920_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_172430357.1|3452929_3453202_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_172430358.1|3453387_3453852_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_043147220.1|3453903_3454227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172430359.1|3454285_3454975_-	recombinase family protein	NA	A0A0F7L6S1	uncultured_marine_virus	44.3	3.1e-35
WP_172430360.1|3455048_3455537_-|terminase	phage terminase small subunit P27 family	terminase	Q6DMU4	Streptococcus_phage	41.0	7.4e-23
WP_172430361.1|3455970_3456180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172430362.1|3456176_3457403_-	site-specific DNA-methyltransferase	NA	A0A0A8ILE7	Aurantimonas_phage	54.4	8.4e-124
WP_172430363.1|3457966_3460117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172430364.1|3460035_3460212_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172430365.1|3460317_3461346_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_172430366.1|3462220_3463897_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.6	8.7e-23
WP_172430367.1|3463913_3465470_+	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_172430368.1|3465462_3466566_+	DUF917 domain-containing protein	NA	NA	NA	NA	NA
WP_172430369.1|3466565_3467666_+	DUF917 domain-containing protein	NA	NA	NA	NA	NA
WP_172430370.1|3467682_3469242_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_172430371.1|3469442_3470420_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_172430372.1|3470625_3472611_+	transketolase	NA	NA	NA	NA	NA
WP_172430373.1|3473435_3474413_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_043141930.1|3474597_3475293_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_069208487.1|3475298_3476072_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.0	1.4e-23
WP_074623286.1|3476096_3477458_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_088670802.1|3477454_3478255_+	4-hydroxy-2-oxo-heptane-1,7-dioate aldolase	NA	NA	NA	NA	NA
WP_172430374.1|3478251_3478671_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_172430375.1|3478681_3479644_+	oxidoreductase	NA	NA	NA	NA	NA
WP_043141371.1|3479640_3480453_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172430376.1|3481781_3482054_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	46.2	8.0e-11
WP_082024633.1|3482050_3482419_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_172430377.1|3484709_3485078_-|transposase	transposase	transposase	NA	NA	NA	NA
3483762:3483779	attR	CGGCTTGGCGCCGCGGGC	NA	NA	NA	NA
WP_172430378.1|3484978_3486076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172430379.1|3486797_3487724_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_172430380.1|3487781_3488249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172430381.1|3488251_3488677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172430382.1|3488887_3489238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043138470.1|3489360_3490524_+	serine hydrolase	NA	B6DZZ7	Stx2-converting_phage	33.3	7.3e-45
WP_172430383.1|3490520_3491165_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	41.1	3.6e-33
WP_043137741.1|3492806_3493871_-	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_043137743.1|3494095_3494314_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_172430384.1|3495138_3498318_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	32.8	6.3e-123
WP_172431474.1|3498449_3500036_-	5-guanidino-2-oxopentanoate decarboxylase	NA	E4WLQ6	Ostreococcus_tauri_virus	24.0	1.4e-14
WP_172430385.1|3500035_3501484_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_167647224.1|3501554_3501782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043137754.1|3501936_3503037_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_074623302.1|3503158_3504352_-	O-succinylhomoserine sulfhydrylase	NA	NA	NA	NA	NA
WP_052244283.1|3504605_3505514_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_172430386.1|3505635_3507519_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_043137763.1|3507588_3508095_-	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_043137766.1|3508371_3508710_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_074623304.1|3508765_3509146_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_172430387.1|3509146_3512110_-	disulfide oxidoreductase	NA	A0A248SJQ0	Salicola_phage	32.4	1.6e-24
WP_088716277.1|3512168_3512678_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_043137772.1|3512809_3513100_+	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_043137775.1|3513099_3514062_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_172430388.1|3514121_3515132_+	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_172430389.1|3515128_3516721_+	ATP-dependent DNA ligase	NA	NA	NA	NA	NA
WP_172430390.1|3516821_3517688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172430391.1|3517720_3518695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074623310.1|3518868_3520692_+	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_172430392.1|3520855_3521158_-	DUF4389 domain-containing protein	NA	NA	NA	NA	NA
WP_172431475.1|3521295_3522354_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_043137795.1|3522355_3522625_-	DksA/TraR family C4-type zinc finger protein	NA	D5JF71	Klebsiella_phage	44.0	1.3e-10
WP_172430393.1|3522766_3523285_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_043137800.1|3523342_3523579_-	YdcH family protein	NA	NA	NA	NA	NA
WP_172430394.1|3523689_3524361_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_172430395.1|3524445_3526098_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.2	4.5e-56
WP_172430396.1|3526262_3527210_+	methyltransferase	NA	NA	NA	NA	NA
WP_043137807.1|3527236_3528745_-|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_172430397.1|3529396_3530443_-	DUF1036 domain-containing protein	NA	NA	NA	NA	NA
WP_043137812.1|3530516_3530714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083342343.1|3530827_3531685_-	DMT family transporter	NA	NA	NA	NA	NA
WP_043137817.1|3531767_3532361_-	amino acid transporter	NA	NA	NA	NA	NA
WP_172430398.1|3532485_3533196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133065620.1|3533202_3533922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172430399.1|3534005_3534572_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_069209437.1|3534693_3535443_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_172430400.1|3535578_3536313_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_172430401.1|3536320_3538099_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_074623324.1|3538124_3539045_-	DMT family transporter	NA	NA	NA	NA	NA
WP_139132301.1|3540063_3540759_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_043137834.1|3540821_3541145_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_043137836.1|3541332_3541665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172430402.1|3541763_3542294_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_172430403.1|3542323_3543106_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_043137844.1|3543189_3544662_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.6	4.5e-23
WP_012187121.1|3545037_3546420_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_133066192.1|3546562_3547153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043137847.1|3547301_3547502_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_043137850.1|3547498_3548563_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 3
NZ_AP022337	Mameliella alba strain KU6B	5386988	3612211	3642679	5386988	head,transposase	Thiobacimonas_phage(78.12%)	51	NA	NA
WP_172430434.1|3612211_3612568_+	hypothetical protein	NA	A0A1B0T6E3	Thiobacimonas_phage	34.8	6.1e-11
WP_088669759.1|3612684_3613206_-	hypothetical protein	NA	A0A1B0T6D7	Thiobacimonas_phage	53.8	3.8e-41
WP_088669760.1|3613202_3613628_-	hypothetical protein	NA	A0A1B0T6E0	Thiobacimonas_phage	51.8	1.6e-21
WP_088672187.1|3613624_3615964_-	hypothetical protein	NA	G8DH54	Emiliania_huxleyi_virus	29.8	2.2e-24
WP_088672188.1|3615977_3616238_-	DUF1799 domain-containing protein	NA	A0A1B0T6D6	Thiobacimonas_phage	53.8	1.6e-16
WP_088672189.1|3616327_3616639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172430435.1|3616652_3617585_-	hypothetical protein	NA	A0A1B0T6E1	Thiobacimonas_phage	68.4	2.7e-122
WP_172430436.1|3617588_3617735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172430437.1|3617731_3618166_-	hypothetical protein	NA	A0A1B0T6E9	Thiobacimonas_phage	50.0	3.0e-28
WP_088669766.1|3618165_3618594_-	DUF1320 domain-containing protein	NA	A0A1B0T6F3	Thiobacimonas_phage	65.5	7.1e-46
WP_172430438.1|3618690_3619152_-	hypothetical protein	NA	A0A1B0T6E5	Thiobacimonas_phage	40.7	2.1e-11
WP_172430439.1|3619162_3620056_-|head	Mu-like prophage major head subunit gpT family protein	head	M4SRT6	Rhodobacter_phage	69.0	1.0e-118
WP_172430440.1|3620069_3620507_-	hypothetical protein	NA	A0A1B0T6E4	Thiobacimonas_phage	68.5	2.5e-46
WP_172430441.1|3620506_3621511_-	hypothetical protein	NA	A0A1B0T6E7	Thiobacimonas_phage	33.3	4.9e-37
WP_172430442.1|3621566_3622091_-	phage virion morphogenesis protein	NA	A0A1B0T6E8	Thiobacimonas_phage	56.2	1.0e-46
WP_172430443.1|3622188_3623412_-|head	phage head protein	head	A0A1B0T6H8	Thiobacimonas_phage	60.2	2.9e-92
WP_172430444.1|3623404_3623716_-	DUF935 family protein	NA	NA	NA	NA	NA
WP_172430445.1|3623712_3625032_-	DUF935 domain-containing protein	NA	A0A1B0T6F2	Thiobacimonas_phage	62.7	2.9e-154
WP_088669774.1|3625035_3625863_-	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	55.4	2.9e-80
WP_172430446.1|3627640_3627889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088669776.1|3627918_3628671_-	phage Gp37/Gp68 family protein	NA	M4R142	Tetraselmis_viridis_virus	53.2	3.7e-66
WP_172430447.1|3628670_3628988_-	hypothetical protein	NA	A0A1B0T6F5	Thiobacimonas_phage	54.5	1.5e-29
WP_172430448.1|3628984_3629182_-	hypothetical protein	NA	A0A1B0T6L2	Pelagibaca_phage	66.7	1.3e-18
WP_172430449.1|3629178_3629745_-	DUF3486 family protein	NA	A0A1B0T6G0	Thiobacimonas_phage	76.0	3.8e-55
WP_088669779.1|3629748_3630051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088669780.1|3630047_3630380_-	DUF2730 family protein	NA	A0A1B0T6F6	Thiobacimonas_phage	47.0	1.2e-21
WP_172430450.1|3630423_3630969_-	carboxylesterase	NA	NA	NA	NA	NA
WP_133065813.1|3631650_3632022_-	hypothetical protein	NA	A0A1B0T6G2	Thiobacimonas_phage	47.1	4.0e-21
WP_088669783.1|3632030_3632294_-	hypothetical protein	NA	A0A1B0T6G9	Thiobacimonas_phage	56.3	1.6e-19
WP_088669784.1|3632290_3632737_-	regulatory protein GemA	NA	A0A1B0T6H1	Thiobacimonas_phage	59.4	1.5e-43
WP_088669785.1|3632733_3632970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088669786.1|3633089_3633323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165775097.1|3633346_3633487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088669788.1|3633549_3633765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088669789.1|3633764_3633989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088669790.1|3634000_3634639_-	DUF3164 family protein	NA	M4STB6	Rhodobacter_phage	63.9	1.7e-72
WP_165775098.1|3634635_3634809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088669791.1|3634805_3635036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088669792.1|3635028_3635397_-	hypothetical protein	NA	A0A1B0T6G8	Thiobacimonas_phage	54.7	1.6e-30
WP_088669967.1|3635393_3635912_-	hypothetical protein	NA	A0A1B0T6J7	Thiobacimonas_phage	58.4	8.3e-49
WP_172430451.1|3635889_3636681_-	ATP-binding protein	NA	A0A1B0T6H3	Thiobacimonas_phage	47.5	5.9e-54
WP_088669794.1|3636695_3638813_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A1B0T6H2	Thiobacimonas_phage	52.2	5.5e-200
WP_088669795.1|3638809_3639661_-	ParB N-terminal domain-containing protein	NA	A0A1B0T6H9	Thiobacimonas_phage	48.9	7.2e-66
WP_088669796.1|3639653_3639902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088669797.1|3639894_3640134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088669798.1|3640130_3640397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088669799.1|3640389_3640647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172430452.1|3640658_3641108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088669801.1|3641216_3641456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088669802.1|3641622_3641907_-	hypothetical protein	NA	A0A1B0T6N5	Pelagibaca_phage	54.2	6.2e-06
WP_165775101.1|3642007_3642679_+	hypothetical protein	NA	A0A1B0T6H5	Thiobacimonas_phage	63.7	6.0e-84
>prophage 4
NZ_AP022337	Mameliella alba strain KU6B	5386988	4668540	4679311	5386988	terminase	Paracoccus_phage(25.0%)	17	NA	NA
WP_172430966.1|4668540_4670013_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	59.5	3.3e-151
WP_172430967.1|4669981_4670473_-|terminase	terminase small subunit	terminase	A0A192Y693	Salmonella_phage	67.2	9.0e-45
WP_172430968.1|4671152_4671734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172430969.1|4671730_4671982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172430970.1|4671978_4672203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172430971.1|4672199_4672550_-	DUF2493 domain-containing protein	NA	A0A291L9X7	Bordetella_phage	49.6	1.3e-18
WP_172430972.1|4672546_4672882_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172430973.1|4673242_4673629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172430974.1|4673625_4675179_-	DEAD/DEAH box helicase family protein	NA	A0A0U2BUD5	Paracoccus_phage	65.9	2.1e-196
WP_172431513.1|4675172_4675418_-	hypothetical protein	NA	A0A0U2BX28	Paracoccus_phage	63.0	3.1e-22
WP_172430975.1|4675423_4676386_-	hypothetical protein	NA	A0A0F7L5X2	uncultured_marine_virus	37.0	1.5e-32
WP_172430976.1|4676385_4676718_-	DUF1064 domain-containing protein	NA	A0A1X9HVJ6	Ruegeria_phage	52.3	1.9e-22
WP_172430977.1|4676714_4676882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172430978.1|4676886_4677291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172430979.1|4677813_4678248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172430980.1|4678296_4678518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172430981.1|4678633_4679311_+	hypothetical protein	NA	I3UM39	Rhodobacter_phage	54.9	4.0e-35
>prophage 5
NZ_AP022337	Mameliella alba strain KU6B	5386988	4682362	4688278	5386988		Ruegeria_phage(28.57%)	11	NA	NA
WP_172430991.1|4682362_4682743_+	hypothetical protein	NA	A0A1X9HWB8	Ruegeria_phage	47.2	3.6e-25
WP_172430992.1|4682739_4682949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172430993.1|4682941_4683709_+	hypothetical protein	NA	A0A1X9HW41	Ruegeria_phage	52.5	1.8e-23
WP_172430994.1|4683705_4684848_+	recombinase RecT	NA	A6XMH9	Bacillus_virus	40.6	4.8e-41
WP_172430995.1|4684847_4685390_+	hypothetical protein	NA	A0A0U2C161	Paracoccus_phage	39.7	3.4e-21
WP_172430996.1|4685386_4685737_+	HNH endonuclease	NA	A0A0U2C107	Paracoccus_phage	41.5	1.1e-15
WP_172430997.1|4685733_4685901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172430998.1|4685897_4686284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172428521.1|4686280_4687006_+	hypothetical protein	NA	A0A219YFC7	Ochrobactrum_phage	38.2	1.4e-30
WP_172430999.1|4687041_4687377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172431000.1|4687369_4688278_+	phage Gp37/Gp68 family protein	NA	K7ZPX2	Xanthomonas_citri_phage	57.1	1.5e-93
>prophage 1
NZ_AP022338	Mameliella alba strain KU6B plasmid pKUB257, complete sequence	256516	121747	181465	256516	integrase,transposase	uncultured_Mediterranean_phage(14.29%)	57	153364:153379	184424:184439
WP_172431604.1|121747_122803_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_172431605.1|123101_123986_+	DUF1403 family protein	NA	NA	NA	NA	NA
WP_172431606.1|123988_124603_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	26.2	1.0e-13
WP_172431607.1|125018_125483_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	44.4	7.0e-23
WP_172431608.1|125479_126043_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_172431609.1|126095_126812_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_172431610.1|126808_130033_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.7	3.2e-66
WP_172431611.1|130029_131703_-	TIGR04141 family sporadically distributed protein	NA	NA	NA	NA	NA
WP_172431612.1|131699_132902_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_172431613.1|132891_134409_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	37.5	8.3e-81
WP_172431697.1|134405_135023_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_172431614.1|135378_136296_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_172431615.1|136285_137116_-	type IV toxin-antitoxin system AbiEi family antitoxin	NA	NA	NA	NA	NA
WP_172431616.1|137761_138472_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_172431698.1|138937_139894_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_172431617.1|141014_141248_+	biotin attachment protein	NA	NA	NA	NA	NA
WP_172431699.1|141247_141934_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_172431618.1|141930_142629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172431700.1|142753_143161_+	heme-binding protein	NA	NA	NA	NA	NA
WP_172431619.1|143225_143423_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172431620.1|143440_144961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172431621.1|145009_145984_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_172431622.1|145980_146322_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_172431623.1|146797_148585_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_172431624.1|148581_149517_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_172431625.1|149506_149704_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_172431701.1|149705_150467_+	thiazole synthase	NA	NA	NA	NA	NA
WP_172431626.1|150463_151072_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_172431627.1|151068_151992_+	ThiF family adenylyltransferase	NA	S4VW33	Pandoravirus	31.9	2.2e-07
WP_172431628.1|152041_152713_+	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_172431629.1|153065_154091_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.7	3.5e-06
153364:153379	attL	TTCGAAGAACGGAAGC	NA	NA	NA	NA
WP_172431630.1|154199_154957_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.4	2.2e-10
WP_172431631.1|155204_155519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172431632.1|155534_155741_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_076625847.1|155743_156892_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	29.3	6.8e-35
WP_172431633.1|156888_157650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172431634.1|158542_159466_+	DUF1738 domain-containing protein	NA	A0A1V0EBY3	Caulobacter_phage	41.7	2.1e-47
WP_172431635.1|159556_159946_+	DUF3768 domain-containing protein	NA	NA	NA	NA	NA
WP_172431636.1|160091_162065_+	ParB/RepB/Spo0J family partition protein	NA	A0A0F7L836	uncultured_marine_virus	34.6	5.1e-06
WP_172431637.1|162131_162725_+	regulator	NA	NA	NA	NA	NA
WP_172431638.1|162724_163381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172431639.1|163493_167753_+	strawberry notch family protein	NA	A0A076FMQ0	Aureococcus_anophage	24.6	7.9e-20
WP_172431640.1|167878_168265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172431641.1|168266_168707_+	hypothetical protein	NA	A0A1B1IUL8	uncultured_Mediterranean_phage	58.6	5.8e-35
WP_172431642.1|168703_168985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172431643.1|169066_169345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172431644.1|169463_170192_+	DUF736 family protein	NA	NA	NA	NA	NA
WP_172431645.1|170408_170639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172431646.1|170679_171186_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_172431647.1|171233_171623_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_043755221.1|172253_173183_+	DUF2493 domain-containing protein	NA	A0A291L9X7	Bordetella_phage	33.9	2.8e-07
WP_172431648.1|173771_174017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133357907.1|174873_175080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172431649.1|175599_176181_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_172431650.1|176167_178495_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_172431651.1|178494_180519_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_172431652.1|180754_181465_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	29.7	1.2e-18
184424:184439	attR	GCTTCCGTTCTTCGAA	NA	NA	NA	NA
>prophage 1
NZ_AP022340	Mameliella alba strain KU6B plasmid pKUB77, complete sequence	76727	0	7712	76727		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_009804228.1|329_710_+	DUF3768 domain-containing protein	NA	NA	NA	NA	NA
WP_009804229.1|826_1123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009804230.1|1202_1586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037930962.1|1587_2064_+	hypothetical protein	NA	A0A1B1IUL8	uncultured_Mediterranean_phage	59.6	1.6e-30
WP_037931030.1|2169_2799_+	hypothetical protein	NA	A0A1B0UZ37	Roseobacter_phage	40.7	6.1e-30
WP_172431742.1|3314_7712_+	strawberry notch family protein	NA	A0A076FMQ0	Aureococcus_anophage	23.5	1.5e-18
>prophage 2
NZ_AP022340	Mameliella alba strain KU6B plasmid pKUB77, complete sequence	76727	11800	64005	76727	integrase,transposase	Geobacillus_virus(20.0%)	47	24457:24489	27788:27820
WP_172431746.1|11800_13156_+	AAA family ATPase	NA	A0A240F4U1	Ochrobactrum_phage	25.9	5.2e-18
WP_172431747.1|14400_15681_+	replication protein C	NA	L7TKN6	Rhizobium_phage	27.1	2.4e-17
WP_172431748.1|15693_16791_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_172431770.1|16947_17832_+	DUF1403 family protein	NA	NA	NA	NA	NA
WP_172431749.1|17834_18449_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	26.6	7.1e-15
WP_172431750.1|18818_22424_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_172431751.1|22567_24079_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.9	1.1e-98
WP_172431752.1|24134_24458_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
24457:24489	attL	AATTATGTGGCGACGGTTATTATGCGGAGTCGA	NA	NA	NA	NA
WP_009827275.1|24546_25536_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH72	Gordonia_phage	29.3	3.6e-08
WP_009827273.1|25532_26447_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_080457380.1|26440_27670_-|integrase	tyrosine-type recombinase/integrase	integrase	A7XX23	Thermus_virus	26.7	1.5e-08
WP_172431753.1|27876_28257_-|transposase	transposase	transposase	NA	NA	NA	NA
27788:27820	attR	TCGACTCCGCATAATAACCGTCGCCACATAATT	NA	NA	NA	NA
WP_172431754.1|28413_29010_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_172431755.1|29006_30032_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_065331505.1|31077_31416_+	DUF736 family protein	NA	NA	NA	NA	NA
WP_172431756.1|32048_32225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172431771.1|32751_33372_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172431757.1|33364_35293_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_172431772.1|35309_37223_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_172431758.1|37240_38662_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_172431759.1|38857_39112_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_172431760.1|39343_39631_-	DCL family protein	NA	NA	NA	NA	NA
WP_172431761.1|39649_42271_-	DEAD/DEAH box helicase	NA	M1HJE2	Paramecium_bursaria_Chlorella_virus	24.8	4.9e-12
WP_172431773.1|42267_43191_-	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_172431762.1|44468_45893_-	type IV secretion system protein B10	NA	NA	NA	NA	NA
WP_172431763.1|45895_46630_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_172431764.1|46635_47316_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_172431765.1|47333_48347_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_064225047.1|48347_48647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064225010.1|48781_49549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172431766.1|49545_50658_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	54.9	4.3e-26
WP_172431767.1|50654_50864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172431768.1|50860_53239_-	type IV secretion system protein B4	NA	NA	NA	NA	NA
WP_037931006.1|53228_53507_-	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_009574106.1|53618_53900_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_037931001.1|53916_54474_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	42.6	1.1e-19
WP_037930998.1|54553_54868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037930995.1|55000_55579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009804208.1|55572_55773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037930992.1|55838_56060_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_009804213.1|56378_57578_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_009804214.1|57580_58501_-	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_009804215.1|58500_59259_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_009804216.1|59335_60091_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.7	7.2e-17
WP_009804217.1|60163_61801_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017468330.1|61916_62819_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_172431769.1|63267_64005_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
