The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015030	Mannheimia granulomatis strain B 234/94 chromosome, complete genome	2278480	410105	555324	2278480	protease,tRNA,transposase,portal,terminase,capsid,head,tail,integrase,plate	Mannheimia_phage(14.29%)	163	469061:469110	509613:509662
WP_165888475.1|410105_410891_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_165888476.1|410990_412904_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.3	1.6e-92
WP_165888477.1|412955_413555_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_165888478.1|413630_413990_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_165888479.1|414067_414970_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_165888480.1|415039_416182_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	69.5	2.7e-161
WP_165888481.1|416350_418918_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.4	4.9e-126
WP_050436804.1|419192_419672_+	DoxX family protein	NA	NA	NA	NA	NA
WP_165888482.1|419694_420006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165888483.1|420203_421127_+	DUF692 family protein	NA	NA	NA	NA	NA
WP_165888484.1|421116_421869_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_165888485.1|422000_422582_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_165888486.1|422583_422778_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_165888487.1|422982_423648_+	OmpW family protein	NA	NA	NA	NA	NA
WP_165888488.1|423730_426574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165888489.1|427006_428500_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_165888490.1|428691_430530_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_165888491.1|431277_440673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165888492.1|440834_442124_-	MFS transporter	NA	NA	NA	NA	NA
WP_051498343.1|442329_442656_-	RnfH family protein	NA	NA	NA	NA	NA
WP_165888493.1|442645_443080_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_165888494.1|443135_444191_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.0	1.2e-22
WP_165888495.1|444177_444870_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_165889881.1|444919_445678_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_165888496.1|445733_446495_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_165888497.1|446496_447405_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.4	1.9e-24
WP_165888498.1|447415_449515_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	36.9	1.4e-46
WP_165888499.1|449607_450147_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	40.5	1.9e-24
WP_165888500.1|450273_450609_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	52.3	6.0e-24
WP_165888501.1|450656_451322_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.4	2.1e-49
WP_042804060.1|451517_452066_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_165888502.1|452100_453933_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_165888503.1|454016_454637_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_165888504.1|454682_455036_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_165888505.1|455186_455792_+	transferrin-binding protein-like solute binding protein	NA	NA	NA	NA	NA
WP_165888506.1|455851_457156_+	DUF560 domain-containing protein	NA	NA	NA	NA	NA
WP_027074928.1|457367_457697_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	46.7	1.5e-16
WP_165888507.1|457931_459164_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_027074926.1|459166_460054_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_042804050.1|460238_461537_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.5	2.7e-72
WP_165888508.1|461649_463038_-	GntP family permease	NA	NA	NA	NA	NA
WP_165888509.1|463113_463872_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_165888510.1|463939_465121_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_165888511.1|465193_466537_-	TIGR00366 family protein	NA	NA	NA	NA	NA
WP_165888512.1|466547_467207_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_165888513.1|467224_467872_-	acetate CoA-transferase subunit alpha	NA	NA	NA	NA	NA
WP_165888514.1|468134_469028_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
469061:469110	attL	AATGGCACGCCCTAAAGGATTCGAACCTTTGACCCACGCCTTAGAAGGGC	NA	NA	NA	NA
WP_165888515.1|469445_469739_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	92.8	1.2e-44
WP_165888516.1|469749_470385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165888517.1|470389_471007_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_165888518.1|470987_471338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165888519.1|475142_475769_-|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	78.5	1.9e-84
WP_165888520.1|475990_476710_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_165888521.1|476699_477437_-|tail	phage tail protein	tail	A0A0M3LQI5	Mannheimia_phage	93.3	2.6e-136
WP_165888522.1|477440_478157_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	94.5	1.6e-130
WP_165888523.1|478156_478486_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	2.4e-17
WP_165889882.1|478485_482073_-|tail	phage tail tape measure protein	tail	A0A125RN77	Pseudomonas_phage	39.5	1.5e-35
WP_027074913.1|482141_482384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165888524.1|482463_482697_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_027074911.1|482741_483149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165888525.1|483232_483874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165888526.1|483877_484222_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_165888527.1|484218_484698_-	hypothetical protein	NA	A0A1P8DTH7	Proteus_phage	31.3	1.0e-08
WP_165888528.1|484684_485014_-|head	phage head closure protein	head	A0A0C5AE87	Paenibacillus_phage	39.8	1.1e-14
WP_165888529.1|485056_485377_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_165888530.1|485429_486638_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	62.4	4.2e-136
WP_165888531.1|486704_487304_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1W6JP53	Morganella_phage	74.0	4.0e-79
WP_165888532.1|487296_488514_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	63.3	1.5e-144
WP_165888533.1|488510_488663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165888534.1|488659_490363_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	66.1	1.6e-221
WP_165888535.1|490359_490845_-|terminase	phage terminase small subunit P27 family	terminase	A0A0R6PI76	Moraxella_phage	49.5	1.5e-20
WP_165888536.1|490954_491305_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	64.9	4.0e-39
WP_165888537.1|491846_492041_-	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	77.2	1.1e-19
WP_165888538.1|492024_492396_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_165888539.1|492487_493030_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	51.2	1.9e-43
WP_165889883.1|493019_493259_-	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	39.2	9.5e-08
WP_165888540.1|493333_494239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165889884.1|494576_495029_-	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	66.7	2.9e-34
WP_165888152.1|495033_495213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165888541.1|495570_495915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165888542.1|495942_496236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165888543.1|496272_497418_-	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	29.0	2.6e-34
WP_027074893.1|497498_497858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165888544.1|497847_498207_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	9.6e-12
WP_165888545.1|498199_499228_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	36.1	8.5e-45
WP_165888546.1|499239_500286_-	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	53.5	2.9e-24
WP_165888547.1|500282_500963_-	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	58.5	5.4e-64
WP_165888548.1|501020_501245_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	66.1	8.9e-16
WP_165888549.1|501369_502101_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	38.6	6.9e-41
WP_165888550.1|502104_502608_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_165888551.1|502604_503714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027074885.1|503828_504119_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	46.7	1.1e-13
WP_027074884.1|504120_504417_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	59.4	3.0e-27
WP_165888552.1|505098_505422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165888553.1|505618_505804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165888554.1|505787_505985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165888555.1|505987_506446_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.7	1.4e-36
WP_165888556.1|506474_506834_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	3.6e-19
WP_165888557.1|506904_507708_+	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.9	2.8e-51
WP_165888558.1|507785_508070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165888559.1|508080_508317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165888560.1|508527_509583_+|integrase	site-specific integrase	integrase	A0A077KGX2	Edwardsiella_phage	38.1	9.2e-63
WP_165888561.1|509959_510811_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.0	2.6e-31
509613:509662	attR	AATGGCACGCCCTAAAGGATTCGAACCTTTGACCCACGCCTTAGAAGGGC	NA	NA	NA	NA
WP_165888562.1|510807_510948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165888563.1|510951_512514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165888564.1|512709_513783_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	1.9e-26
WP_165888565.1|513779_514649_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_165888566.1|514645_515485_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_165888567.1|515635_516460_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_165888568.1|516548_517625_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_165888569.1|517688_518792_+	ROK family protein	NA	NA	NA	NA	NA
WP_165888570.1|518926_519817_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	28.9	2.2e-12
WP_165888571.1|519827_520298_-	enoyl-CoA hydratase	NA	F6MIM0	Haemophilus_phage	64.5	1.1e-55
WP_165888572.1|520302_520908_-	DUF4376 domain-containing protein	NA	F6MIL9	Haemophilus_phage	72.9	1.3e-45
WP_165888573.1|521834_522413_-|tail	phage tail protein	tail	Q6QI98	Burkholderia_phage	53.9	2.4e-49
WP_165888574.1|522405_523521_-|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	35.6	7.8e-52
WP_117471603.1|523507_523876_-|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_042802629.1|523929_524466_-|plate	phage baseplate assembly protein V	plate	R9U0U6	Rhizobium_phage	30.4	4.3e-08
WP_165888575.1|524480_525533_-	hypothetical protein	NA	Q6QIA2	Burkholderia_phage	40.2	2.1e-62
WP_042802625.1|525536_525755_-	membrane protein	NA	R9U1D8	Rhizobium_phage	45.3	5.6e-07
WP_042802623.1|525742_526690_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_165888576.1|526689_529293_-|tail	phage tail tape measure protein	tail	K4ICR4	Acidithiobacillus_phage	40.4	7.6e-74
WP_042802621.1|529330_529612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042802619.1|529628_529751_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_165888577.1|529777_530059_-|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	41.2	1.3e-08
WP_042802615.1|530145_530664_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_165888578.1|530663_532058_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	46.0	7.6e-105
WP_165888579.1|532066_532561_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	35.0	4.1e-21
WP_165888580.1|532560_533001_-	DUF1320 domain-containing protein	NA	B7SDP4	Haemophilus_phage	32.0	1.9e-06
WP_165888581.1|533003_533486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165888582.1|533542_534484_-	inorganic pyrophosphatase	NA	A4JWK0	Burkholderia_virus	52.3	3.2e-83
WP_165888583.1|534492_535599_-	peptidase	NA	A4JWJ9	Burkholderia_virus	39.6	3.1e-69
WP_165888584.1|535823_536279_-	phage virion morphogenesis protein	NA	Q5ZQY1	Pseudomonas_phage	34.9	4.2e-20
WP_165888585.1|536402_537677_-|head	phage head morphogenesis protein	head	J9STS2	Pseudomonas_phage	47.5	5.9e-56
WP_165888586.1|537673_539110_-	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	47.7	5.7e-124
WP_165888587.1|539110_540646_-	hypothetical protein	NA	Q6QIC1	Burkholderia_phage	62.4	1.8e-176
WP_042802600.1|540642_541191_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	56.4	6.3e-47
WP_042802598.1|541199_541502_-	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	52.6	8.3e-25
WP_042802596.1|541498_541807_-	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	39.1	2.2e-12
WP_165888588.1|541790_541931_-	hypothetical protein	NA	F6MIK2	Haemophilus_phage	65.6	2.6e-05
WP_042802593.1|541923_542205_-	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_042802591.1|542205_542427_-	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	95.5	2.9e-27
WP_165888589.1|542522_543065_-	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	69.1	5.4e-75
WP_042802588.1|543145_543655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165888590.1|543655_544690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165888591.1|544714_544936_-	excalibur calcium-binding domain-containing protein	NA	Q19UP2	Mannheimia_phage	60.0	6.1e-09
WP_042802582.1|544945_545314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165888592.1|545343_545706_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042802580.1|545840_546035_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_042802578.1|546223_546529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158497417.1|546583_546754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042802576.1|546750_547053_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	54.5	1.2e-15
WP_165888593.1|547110_548037_+	DUF3102 domain-containing protein	NA	Q5ZR03	Pseudomonas_phage	39.4	3.8e-52
WP_165888594.1|548048_549851_+|transposase	transposase family protein	transposase	J9SGQ3	Pseudomonas_phage	41.1	8.2e-120
WP_165888595.1|549871_551044_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	55.3	2.5e-109
WP_165888596.1|551036_551267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165888597.1|551241_551766_+	host-nuclease inhibitor protein Gam	NA	A0A0C4UQY5	Shigella_phage	43.9	5.5e-32
WP_165888598.1|551762_551915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165888599.1|551960_552431_+	hypothetical protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	45.0	6.2e-27
WP_165888600.1|552412_552793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165888601.1|552777_553170_+	regulatory protein GemA	NA	NA	NA	NA	NA
WP_165888602.1|553162_553537_+	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	46.5	1.2e-20
WP_165888603.1|553872_555324_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP015030	Mannheimia granulomatis strain B 234/94 chromosome, complete genome	2278480	724817	732917	2278480	protease,portal,terminase,capsid,head,tail	uncultured_Caudovirales_phage(62.5%)	13	NA	NA
WP_165888724.1|724817_725213_+|tail	phage tail protein	tail	K7PJP5	Enterobacteria_phage	29.7	9.2e-08
WP_165888725.1|725223_726405_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	68.0	2.3e-139
WP_165889895.1|726458_727028_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	57.0	1.8e-52
WP_165888726.1|727028_728252_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	61.9	2.0e-141
WP_165888727.1|728235_728583_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_165888728.1|728575_728893_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	36.5	3.7e-07
WP_165888729.1|728903_729260_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_165888730.1|729584_729944_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	67.3	5.4e-39
WP_165888731.1|729940_731611_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	68.1	1.5e-237
WP_165888732.1|731610_731862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165888733.1|731858_732326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165888734.1|732388_732574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165888735.1|732674_732917_+	hypothetical protein	NA	A0A0R6PHP9	Moraxella_phage	55.4	5.6e-16
>prophage 3
NZ_CP015030	Mannheimia granulomatis strain B 234/94 chromosome, complete genome	2278480	1335294	1344318	2278480	protease,tRNA	Organic_Lake_phycodnavirus(16.67%)	7	NA	NA
WP_165889181.1|1335294_1336476_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	29.7	9.5e-08
WP_165889913.1|1336694_1337606_-|protease	CAAX protease	protease	A0A0S2MYH0	Enterococcus_phage	28.1	1.1e-16
WP_165889182.1|1337682_1339233_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.4	6.0e-103
WP_165889183.1|1339346_1342049_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	30.9	2.9e-108
WP_165889184.1|1342159_1342540_-	deoxyribonuclease	NA	A0A023NGV8	Nitrincola_phage	52.3	3.8e-27
WP_165889185.1|1342603_1343317_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_165889186.1|1343379_1344318_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	83.9	2.0e-125
