The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043955	Morganella morganii subsp. morganii strain 171229813 chromosome, complete genome	3982591	133698	142546	3982591		Escherichia_phage(66.67%)	8	NA	NA
WP_165894473.1|133698_136152_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.7	5.8e-217
WP_004237907.1|136163_136781_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	8.0e-75
WP_004237908.1|136782_137643_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.7	1.1e-26
WP_004237909.1|137728_138340_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.2	2.4e-23
WP_004237910.1|138407_138698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024474701.1|138825_139512_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004237912.1|139600_140221_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	55.5	3.0e-61
WP_004237914.1|140590_142546_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.0	5.7e-82
>prophage 2
NZ_CP043955	Morganella morganii subsp. morganii strain 171229813 chromosome, complete genome	3982591	1335089	1382129	3982591	portal,terminase,plate,capsid,tail,head,holin	Morganella_phage(35.71%)	63	NA	NA
WP_004238015.1|1335089_1335719_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.2	2.1e-54
WP_032098699.1|1335737_1336964_-	DUF3440 domain-containing protein	NA	L0P6Z6	Lactobacillus_phage	33.7	8.2e-63
WP_032098716.1|1337196_1337670_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_165894511.1|1337915_1339091_-	recombinase	NA	A0A2H4J1K3	uncultured_Caudovirales_phage	29.6	1.0e-30
WP_165894512.1|1340289_1341117_-	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	52.5	1.4e-77
WP_102831270.1|1341183_1341546_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	65.5	1.8e-34
WP_165894513.1|1341766_1341976_-	hypothetical protein	NA	A0A1W6JP89	Morganella_phage	75.7	2.2e-21
WP_165894514.1|1342090_1342813_-	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	36.1	1.6e-29
WP_111759650.1|1342880_1343126_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	42.0	5.7e-08
WP_165894515.1|1343164_1343644_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	95.6	6.9e-82
WP_036409365.1|1343707_1343908_+	hypothetical protein	NA	A0A1W6JP45	Morganella_phage	98.5	3.5e-32
WP_049247062.1|1343900_1344092_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	96.8	5.4e-30
WP_165894516.1|1344088_1344976_+	HTH domain-containing protein	NA	A0A1W6JP36	Morganella_phage	83.1	1.9e-117
WP_165894517.1|1344972_1345221_+	hypothetical protein	NA	A0A1W6JP32	Morganella_phage	45.0	4.3e-11
WP_165894770.1|1345289_1347257_+	phage N-6-adenine-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	43.2	9.3e-117
WP_165894518.1|1347228_1347648_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	67.9	6.1e-50
WP_165894519.1|1347644_1348043_+	hypothetical protein	NA	A0A1W6JP58	Morganella_phage	42.1	1.0e-14
WP_165894520.1|1348039_1348795_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	82.1	1.4e-126
WP_165894521.1|1348797_1349208_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1W6JP40	Morganella_phage	98.1	1.6e-55
WP_165894522.1|1349225_1349939_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	55.0	1.8e-54
WP_165894523.1|1349938_1350955_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	93.5	3.8e-191
WP_165894524.1|1350985_1351663_+	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	90.7	4.9e-118
WP_165894525.1|1351761_1352151_-	DUF1413 domain-containing protein	NA	NA	NA	NA	NA
WP_165894526.1|1352218_1352476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165894527.1|1352641_1352854_+|holin	holin	holin	A0A1W6JNY9	Morganella_phage	77.1	1.1e-23
WP_165894528.1|1352846_1353323_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	91.0	2.9e-80
WP_165894529.1|1353304_1353463_+	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	86.7	2.0e-14
WP_165894530.1|1353459_1353984_+	hypothetical protein	NA	H9C185	Pectobacterium_phage	43.5	1.4e-19
WP_165894531.1|1355099_1355744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165894532.1|1355770_1356019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165894533.1|1356015_1356300_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_165894771.1|1356684_1357257_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_165894534.1|1357231_1359205_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	46.4	2.8e-145
WP_112544590.1|1359214_1359466_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_165894772.1|1359522_1361118_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.8	7.1e-91
WP_165894535.1|1361114_1361969_+	S49 family peptidase	NA	A0A1I9KF73	Aeromonas_phage	37.6	1.2e-49
WP_165894536.1|1361971_1362598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165894537.1|1362597_1362990_+|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	34.0	4.9e-09
WP_165894538.1|1363062_1364109_+|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	27.4	1.6e-27
WP_165894539.1|1364121_1364532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165894540.1|1364521_1364860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165894541.1|1364859_1365408_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_165894542.1|1365410_1365578_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	54.8	8.1e-06
WP_165894543.1|1365574_1367056_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	44.9	2.3e-104
WP_165894544.1|1367065_1367434_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_165894545.1|1367436_1367727_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_165894546.1|1367845_1369735_+	hypothetical protein	NA	A0A1B1IQT0	uncultured_Mediterranean_phage	36.5	3.3e-10
WP_165894547.1|1369769_1370177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165894548.1|1370228_1370696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165894549.1|1370815_1372216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165894550.1|1372212_1373283_+|tail	phage tail protein	tail	A0A2I7S9G1	Vibrio_phage	30.7	2.2e-40
WP_165894773.1|1373282_1373870_+|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_165894551.1|1373869_1374307_+	hypothetical protein	NA	B5TK74	Pseudomonas_phage	51.8	5.8e-19
WP_165894552.1|1374307_1375447_+|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	33.6	2.2e-38
WP_165894553.1|1375443_1376037_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_165894554.1|1376087_1377083_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	41.0	2.7e-19
WP_165894555.1|1377084_1377714_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	37.0	7.8e-25
WP_165894556.1|1377685_1378039_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	48.7	1.0e-10
WP_165894557.1|1378035_1378719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165894558.1|1378708_1379263_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	72.5	4.5e-69
WP_165894559.1|1379505_1380252_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_165894560.1|1380450_1380867_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	91.3	2.3e-65
WP_165894561.1|1380866_1382129_+	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	95.9	2.3e-233
>prophage 3
NZ_CP043955	Morganella morganii subsp. morganii strain 171229813 chromosome, complete genome	3982591	1459121	1528301	3982591	portal,terminase,capsid,protease,integrase,tail,tRNA,head,transposase	Morganella_phage(79.25%)	84	1455520:1455535	1522722:1522737
1455520:1455535	attL	CTTTTTCAAGTGCGCT	NA	NA	NA	NA
WP_004238115.1|1459121_1460225_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_036417826.1|1460395_1460860_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_036417797.1|1460813_1461503_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004240623.1|1461643_1462897_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	8.0e-21
WP_165894562.1|1463337_1464468_+	hypothetical protein	NA	J9Q803	Salmonella_phage	28.6	4.5e-23
WP_165894563.1|1464586_1464976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165894564.1|1465356_1465701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165894565.1|1465916_1467584_-	hypothetical protein	NA	X2KLG0	Campylobacter_phage	24.3	2.8e-13
WP_071997735.1|1468959_1469202_-	excisionase	NA	NA	NA	NA	NA
WP_015422824.1|1469264_1469492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165894566.1|1469976_1470441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165894567.1|1470696_1470909_-	hypothetical protein	NA	A0A1W6JP89	Morganella_phage	77.1	7.1e-23
WP_036421170.1|1471038_1471686_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	61.0	1.6e-70
WP_046025056.1|1471795_1471996_+	regulatory protein	NA	A0A1W6JP24	Morganella_phage	71.2	2.4e-20
WP_165894568.1|1472025_1472490_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	48.0	8.0e-35
WP_144079368.1|1472553_1472754_+	hypothetical protein	NA	A0A1W6JP45	Morganella_phage	69.7	4.3e-22
WP_046025054.1|1472746_1472941_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	85.9	4.8e-26
WP_107678691.1|1472937_1473822_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	86.7	6.0e-132
WP_163623306.1|1473821_1474262_+	hypothetical protein	NA	A0A1W6JP58	Morganella_phage	38.6	3.0e-15
WP_163623307.1|1474258_1475050_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	85.2	8.6e-122
WP_163623308.1|1475049_1476066_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	88.5	1.3e-178
WP_163623309.1|1476096_1476534_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	91.0	5.9e-72
WP_046024440.1|1476909_1477122_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	98.6	5.8e-33
WP_036414508.1|1477347_1478277_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	99.6	5.7e-149
WP_036414510.1|1478545_1478980_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_087825463.1|1479585_1479738_+	MbeCy	NA	A0A1W6JNZ9	Morganella_phage	100.0	8.9e-20
WP_036414512.1|1479906_1480113_+	hypothetical protein	NA	A0A1W6JNU4	Morganella_phage	100.0	1.3e-32
WP_004240322.1|1480594_1480786_+	hypothetical protein	NA	A0A1W6JNY9	Morganella_phage	98.4	1.9e-30
WP_049246421.1|1480778_1481255_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	96.8	4.6e-86
WP_163623276.1|1481254_1481395_+	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	89.1	1.6e-15
WP_098935592.1|1481391_1481769_+	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	90.4	8.1e-54
WP_049245931.1|1482374_1482686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046025042.1|1482730_1483081_+	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	96.6	1.8e-63
WP_046025041.1|1483077_1483281_+	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	97.0	5.2e-31
WP_064483686.1|1483416_1483887_+|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	89.1	3.8e-77
WP_064483685.1|1483890_1485621_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	93.4	0.0e+00
WP_165894569.1|1485617_1485779_+	hypothetical protein	NA	A0A1W6JP78	Morganella_phage	100.0	6.6e-21
WP_165894570.1|1485768_1486992_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	97.3	7.8e-231
WP_004239758.1|1486981_1487590_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1W6JP53	Morganella_phage	91.0	5.8e-102
WP_165894571.1|1487599_1488817_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	91.6	1.9e-208
WP_004239763.1|1488903_1489206_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	81.0	7.0e-40
WP_165894572.1|1489216_1489540_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	96.3	2.4e-54
WP_165894573.1|1489532_1489982_+	HK97 gp10 family phage protein	NA	A0A1W6JP15	Morganella_phage	96.6	1.9e-73
WP_165894574.1|1489978_1490314_+	hypothetical protein	NA	A0A1W6JP05	Morganella_phage	91.9	3.8e-55
WP_165894575.1|1490373_1490841_+|tail	phage tail protein	tail	A0A1W6JP06	Morganella_phage	94.8	2.4e-79
WP_165894576.1|1490844_1491228_+|tail	phage tail protein	tail	A0A1W6JP08	Morganella_phage	96.9	3.3e-63
WP_165894577.1|1491239_1491524_+	DUF4035 domain-containing protein	NA	A0A1W6JP68	Morganella_phage	93.6	4.1e-42
WP_165894578.1|1491548_1494809_+|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	95.3	0.0e+00
WP_004238700.1|1494805_1495141_+|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	95.5	6.7e-60
WP_132275799.1|1495137_1495896_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	94.0	2.2e-143
WP_132275796.1|1495898_1496591_+	peptidase P60	NA	A0A1W6JP31	Morganella_phage	95.6	2.7e-135
WP_046025122.1|1496672_1497221_+	lipoprotein	NA	NA	NA	NA	NA
WP_132275793.1|1497287_1497890_+|tail	tail assembly protein	tail	A0A1W6JNY8	Morganella_phage	91.5	1.6e-99
WP_165894579.1|1497922_1501099_+	host specificity protein J	NA	A0A1W6JNZ7	Morganella_phage	94.7	0.0e+00
WP_004238646.1|1501100_1501421_+	hypothetical protein	NA	A0A1W6JNW9	Morganella_phage	99.1	6.9e-62
WP_165894580.1|1501417_1502104_+	hypothetical protein	NA	A0A1W6JNU1	Morganella_phage	99.1	3.4e-135
WP_165894774.1|1503524_1504064_+	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	98.1	6.5e-89
WP_132274261.1|1504109_1504889_-	DUF4393 domain-containing protein	NA	NA	NA	NA	NA
WP_046024483.1|1505214_1505565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_132274279.1|1505769_1505985_+	hypothetical protein	NA	Q77Z09	Phage_21	92.6	3.0e-21
WP_165894581.1|1506324_1509576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048822335.1|1509630_1509873_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	74.6	4.4e-21
WP_073970158.1|1510077_1510473_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	68.5	2.0e-42
WP_004239793.1|1510609_1510990_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032098665.1|1511079_1511928_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_080654119.1|1512405_1512681_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	97.8	4.7e-43
WP_004235029.1|1513012_1513369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004235031.1|1513659_1514706_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_062771455.1|1514705_1515419_+	solute-binding protein	NA	NA	NA	NA	NA
WP_015422798.1|1515520_1516093_+	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_004239806.1|1516423_1516732_+	DUF3088 family protein	NA	NA	NA	NA	NA
WP_004235037.1|1517289_1517556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004239807.1|1517709_1517931_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_015422796.1|1517999_1518488_+	acetyltransferase	NA	NA	NA	NA	NA
WP_004235045.1|1518606_1518792_+	YegP family protein	NA	NA	NA	NA	NA
WP_001339197.1|1519368_1520577_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000428546.1|1521090_1521684_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089072.1|1521796_1523002_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
1522722:1522737	attR	AGCGCACTTGAAAAAG	NA	NA	NA	NA
WP_000088605.1|1523083_1523707_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001284954.1|1523684_1524371_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460651.1|1524378_1524765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562370.1|1524757_1525078_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000599533.1|1525521_1526727_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001352368.1|1527092_1528301_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 4
NZ_CP043955	Morganella morganii subsp. morganii strain 171229813 chromosome, complete genome	3982591	1534110	1537037	3982591		Morganella_phage(85.71%)	7	NA	NA
WP_004235063.1|1534110_1534818_-	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	56.1	4.4e-69
WP_004239822.1|1535183_1535621_+	hypothetical protein	NA	A0A1W6JNY5	Morganella_phage	47.8	1.2e-27
WP_004235068.1|1535693_1535888_+	hypothetical protein	NA	A0A1W6JNY9	Morganella_phage	73.0	2.6e-24
WP_004235069.1|1535877_1536354_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	77.7	6.2e-67
WP_004239826.1|1536335_1536494_+	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	67.4	1.8e-10
WP_004235070.1|1536490_1536868_+	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	38.4	7.7e-12
WP_036417780.1|1536839_1537037_+	hypothetical protein	NA	A0A1W6JP52	Morganella_phage	67.9	1.1e-12
>prophage 5
NZ_CP043955	Morganella morganii subsp. morganii strain 171229813 chromosome, complete genome	3982591	1739559	1823629	3982591	portal,terminase,integrase,tail,tRNA,transposase	Enterobacteria_phage(31.25%)	97	1736527:1736542	1829733:1829748
1736527:1736542	attL	CAGTGCCACGGCAATC	NA	NA	NA	NA
WP_165894587.1|1739559_1740783_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	50.1	6.0e-114
WP_004239999.1|1740739_1740946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036425739.1|1740942_1741260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036425737.1|1741246_1742023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036421283.1|1742012_1742264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004240826.1|1742260_1742482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105212822.1|1742494_1743067_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	39.5	8.3e-34
WP_165894775.1|1743105_1743294_-	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_165894776.1|1743488_1743956_-	hypothetical protein	NA	A0A286S260	Klebsiella_phage	55.6	3.4e-33
WP_165894588.1|1744192_1744408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165894589.1|1744407_1744614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057448.1|1744600_1744948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115072282.1|1745438_1745699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165894590.1|1745732_1745954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024473771.1|1745955_1746144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165894591.1|1746145_1746373_-	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	40.0	5.5e-05
WP_036421913.1|1746669_1746864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165894592.1|1746898_1747417_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_165894593.1|1747406_1748564_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_165894594.1|1748701_1749409_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	41.2	3.1e-46
WP_036405665.1|1749510_1749756_+	helix-turn-helix domain-containing protein	NA	A0A2D1GLN0	Escherichia_phage	57.4	1.5e-11
WP_165894595.1|1750267_1751845_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.4	1.2e-210
WP_036425727.1|1751841_1752828_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	60.6	2.4e-113
WP_036425726.1|1752827_1753613_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	39.5	1.2e-46
WP_036425724.1|1753640_1754402_+	NYN domain-containing protein	NA	A0A2P0VNQ4	Tetraselmis_virus	30.1	2.2e-05
WP_165894596.1|1754608_1754803_+	hypothetical protein	NA	A0A1W6JP28	Morganella_phage	96.9	4.3e-27
WP_165894597.1|1754941_1756000_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	94.2	5.3e-175
WP_115356057.1|1756221_1757217_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_162598914.1|1757523_1757676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024474664.1|1757841_1758033_+	hypothetical protein	NA	A0A1W6JP85	Morganella_phage	100.0	4.9e-31
WP_165894598.1|1758025_1758502_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	92.4	2.6e-81
WP_165894462.1|1758501_1758642_+	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	97.8	1.0e-17
WP_165894599.1|1758638_1759166_+	hypothetical protein	NA	H9C185	Pectobacterium_phage	40.4	2.0e-18
WP_004242385.1|1759463_1759649_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	60.3	1.4e-11
WP_024474667.1|1759972_1760476_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	57.2	2.3e-40
WP_115356060.1|1760472_1762587_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	4.6e-295
WP_115356061.1|1762583_1762802_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	57.1	4.3e-15
WP_126616426.1|1762798_1764274_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	66.7	7.6e-188
WP_001339197.1|1765954_1767163_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_119312555.1|1767706_1768048_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	56.5	4.3e-22
WP_126616423.1|1768052_1768331_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_004242398.1|1768332_1768896_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	55.6	1.6e-45
WP_036425712.1|1768895_1769294_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	62.4	2.3e-43
WP_165894600.1|1769303_1769819_+|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	75.5	4.1e-64
WP_165894601.1|1769834_1770236_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	36.6	2.8e-12
WP_036413646.1|1770259_1770568_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	51.5	9.7e-21
WP_165894602.1|1770548_1773473_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	35.6	9.5e-142
WP_024474676.1|1773475_1773805_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	52.3	1.0e-28
WP_165894603.1|1773819_1774461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004242407.1|1774677_1775460_+	hypothetical protein	NA	Q9MCN2	Enterobacteria_phage	45.0	6.9e-55
WP_165894604.1|1775471_1776170_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	50.4	7.2e-64
WP_024474678.1|1776187_1776916_+	C40 family peptidase	NA	A0A0P0ZE89	Stx2-converting_phage	60.6	7.5e-88
WP_046024959.1|1776819_1777464_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	46.7	3.9e-48
WP_165894605.1|1777476_1780638_+	host specificity protein J	NA	A0A1W6JNW2	Morganella_phage	50.2	3.6e-288
WP_036421959.1|1780631_1781000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036421961.1|1781001_1781616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165894777.1|1782469_1783006_+	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	90.3	1.2e-79
WP_051456193.1|1783038_1783320_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_036423065.1|1783401_1783686_-	DinI-like family protein	NA	A0A1W6JP10	Morganella_phage	88.6	2.8e-38
WP_032098088.1|1784203_1785253_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	46.6	1.6e-78
WP_004235416.1|1785399_1786263_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_004239083.1|1786481_1788860_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.3	3.4e-174
WP_015422756.1|1789334_1790450_-	AI-2E family transporter YdiK	NA	NA	NA	NA	NA
WP_015422755.1|1790659_1793728_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_032098089.1|1793762_1794188_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_004235425.1|1794526_1794907_+	Fe-S cluster assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	35.9	1.4e-13
WP_062771521.1|1794922_1796407_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_004235432.1|1796458_1797205_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	28.8	4.9e-10
WP_062771523.1|1797179_1798484_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_062771525.1|1798483_1799722_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.2	1.3e-84
WP_062771527.1|1799730_1800150_+	cysteine desulfuration protein SufE	NA	NA	NA	NA	NA
WP_004235440.1|1800248_1801331_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_004239093.1|1801471_1801708_-	major outer membrane lipoprotein	NA	NA	NA	NA	NA
WP_004235443.1|1802033_1803446_-	pyruvate kinase PykF	NA	NA	NA	NA	NA
WP_062771529.1|1804163_1805537_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_049242399.1|1805749_1806415_+	riboflavin synthase subunit alpha	NA	A0A2I2L4R9	Orpheovirus	36.8	1.4e-24
WP_062771531.1|1806496_1807660_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.5	8.0e-84
WP_004239098.1|1807925_1809137_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.3	2.6e-16
WP_004235453.1|1809258_1810161_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004235455.1|1810164_1811190_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.5	2.4e-31
WP_123805126.1|1811455_1811551_+	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_004235459.1|1811635_1812214_-	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_046024521.1|1812611_1812920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004235472.1|1812989_1813529_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_004235474.1|1813552_1814314_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.6	5.2e-07
WP_004239106.1|1814392_1814851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036414975.1|1814914_1815535_-	homoserine/homoserine lactone efflux protein	NA	NA	NA	NA	NA
WP_004235478.1|1815818_1816160_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_062771533.1|1816298_1816979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004235480.1|1817046_1817694_-	ribonuclease T	NA	NA	NA	NA	NA
WP_004235481.1|1817803_1818211_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_032098095.1|1818363_1818600_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_015422751.1|1819115_1819550_+	transcriptional regulator SlyA	NA	NA	NA	NA	NA
WP_004235484.1|1819609_1820077_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_032098096.1|1820395_1821514_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_004235487.1|1821568_1822219_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_032098097.1|1822354_1823629_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	3.3e-83
1829733:1829748	attR	CAGTGCCACGGCAATC	NA	NA	NA	NA
>prophage 6
NZ_CP043955	Morganella morganii subsp. morganii strain 171229813 chromosome, complete genome	3982591	2001699	2026102	3982591	integrase,transposase	Salmonella_phage(45.45%)	25	2005336:2005395	2020853:2021054
WP_001138073.1|2001699_2004672_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|2004674_2005232_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
2005336:2005395	attL	TGTCGTTTTCAGAAGACGGCTGCACTGAACGTCAGAAGCCGACTGCACTATAGCAGCGGA	NA	NA	NA	NA
WP_165894610.1|2005537_2006551_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.1	2.3e-71
WP_001424636.1|2006696_2007494_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA13	NA	NA	NA	NA	NA
WP_000470556.1|2007575_2007866_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_000679427.1|2007970_2008318_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|2008311_2009151_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376616.1|2009278_2009482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|2009706_2010411_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000612791.1|2010641_2011505_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001354008.1|2011542_2011788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|2012256_2013048_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	NA	NA	NA	NA
WP_109023896.1|2013050_2013326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000800531.1|2014227_2014560_-	quaternary ammonium compound efflux SMR transporter QacL	NA	E5E3Y9	Acinetobacter_phage	35.3	2.0e-08
WP_001206316.1|2014729_2015521_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|2015613_2016873_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001261740.1|2017134_2017926_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000050382.1|2017983_2018592_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001456218.1|2018687_2019530_-	alpha/beta fold putative hydrolase EstX	NA	W8EKH7	Mycobacterium_phage	26.1	3.0e-08
WP_000845048.1|2019696_2020710_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|2020912_2021263_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
2020853:2021054	attR	TCCGCTGCTATAGTGCAGTCGGCTTCTGACGTTCAGTGCAGCCGTCTTCTGAAAACGACAATGGAGGTGGTAGCCGAGGGTGTGGAAACACCCGACTGCCTTGCGTGGTTGCGGCAGGCGGGTTGCGACACGGTGCAGGGTTTCCTGTTCGCCAGGCCGATGCCGGCGGCGGCCTTCGTCGGCTTCGTCAACCAATGGAGGA	NA	NA	NA	NA
WP_000147567.1|2021388_2021949_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_015344976.1|2021951_2024903_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_046788546.1|2024911_2025313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|2025397_2026102_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
>prophage 7
NZ_CP043955	Morganella morganii subsp. morganii strain 171229813 chromosome, complete genome	3982591	2029786	2058124	3982591	transposase	Escherichia_phage(50.0%)	32	NA	NA
WP_015344975.1|2029786_2031280_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|2031310_2031562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|2031455_2031758_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|2031844_2032660_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_085940648.1|2032749_2033839_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_165488106.1|2034036_2034408_-	phenol hydroxylase	NA	NA	NA	NA	NA
WP_000602738.1|2036846_2037599_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000742814.1|2038020_2039046_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001199192.1|2039274_2040051_-	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_001067855.1|2040164_2040869_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|2041012_2041567_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|2041697_2042528_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|2042665_2043298_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|2043382_2043835_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|2044057_2044405_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|2044398_2045238_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|2045365_2045866_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|2046372_2047137_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000993245.1|2047374_2047587_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|2047549_2047669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|2047652_2047889_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|2047885_2048251_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|2048268_2049954_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|2049992_2050418_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|2050445_2050721_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|2050736_2051102_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|2051173_2051629_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_046024562.1|2052610_2053513_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004237632.1|2053628_2054816_+	MFS transporter	NA	NA	NA	NA	NA
WP_004237631.1|2054937_2055912_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_036417224.1|2055908_2056544_+	LysE family transporter	NA	NA	NA	NA	NA
WP_001339197.1|2056915_2058124_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 8
NZ_CP043955	Morganella morganii subsp. morganii strain 171229813 chromosome, complete genome	3982591	2323589	2366485	3982591	integrase,terminase,tail	Morganella_phage(98.04%)	55	2325505:2325520	2369358:2369373
WP_087826395.1|2323589_2323874_+	DinI-like family protein	NA	A0A1W6JP10	Morganella_phage	86.5	4.3e-39
WP_087826449.1|2324435_2324954_-	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	93.5	1.3e-81
2325505:2325520	attL	GGGACTGTGGTGGCAA	NA	NA	NA	NA
WP_004242380.1|2325858_2326125_-	hypothetical protein	NA	A0A1W6JNS1	Morganella_phage	98.9	5.7e-46
WP_165894624.1|2326127_2326814_-	hypothetical protein	NA	A0A1W6JNU1	Morganella_phage	97.8	1.9e-133
WP_004238646.1|2326810_2327131_-	hypothetical protein	NA	A0A1W6JNW9	Morganella_phage	99.1	6.9e-62
WP_004242379.1|2327132_2330267_-	host specificity protein J	NA	A0A1W6JNW2	Morganella_phage	98.4	0.0e+00
WP_165894625.1|2330267_2330834_-|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	97.7	4.6e-61
WP_036421935.1|2330776_2331490_-	C40 family peptidase	NA	A0A1W6JNU8	Morganella_phage	99.2	7.7e-146
WP_036423162.1|2331493_2332192_-|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	99.6	2.3e-134
WP_004242374.1|2332188_2332518_-|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	99.1	1.5e-59
WP_004242373.1|2332557_2335881_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	99.5	0.0e+00
WP_165894626.1|2335924_2336617_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	99.1	3.9e-126
WP_165894627.1|2336667_2337423_-	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	96.8	7.4e-131
WP_036421933.1|2337487_2337859_-	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	98.4	2.8e-67
WP_004242365.1|2337855_2338224_-	hypothetical protein	NA	A0A1W6JNX7	Morganella_phage	97.5	4.3e-60
WP_064483251.1|2338225_2338567_-	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	95.6	1.2e-59
WP_004242363.1|2338568_2338946_-	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	98.4	4.0e-61
WP_004242362.1|2338970_2339951_-	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	98.5	4.9e-175
WP_165894628.1|2339956_2340643_-	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	97.4	2.7e-95
WP_004242360.1|2340708_2341770_-	hypothetical protein	NA	A0A1W6JNT7	Morganella_phage	98.9	4.3e-193
WP_062772588.1|2341773_2343153_-	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	99.1	2.5e-262
WP_004242356.1|2343154_2344639_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	99.4	2.1e-299
WP_004242355.1|2344640_2345168_-|terminase	terminase small subunit	terminase	A0A1W6JNT5	Morganella_phage	99.4	1.9e-93
WP_004242354.1|2345170_2345368_-	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	95.4	3.6e-29
WP_165894778.1|2345637_2346153_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	99.4	2.1e-97
WP_004242351.1|2346776_2347154_-	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	82.4	4.2e-50
WP_163656464.1|2347150_2347309_-	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	82.6	3.8e-13
WP_165894779.1|2347290_2347740_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	92.6	4.8e-77
WP_004240322.1|2347759_2347951_-	hypothetical protein	NA	A0A1W6JNY9	Morganella_phage	98.4	1.9e-30
WP_015422643.1|2348620_2348830_-	hypothetical protein	NA	A0A1W6JNU4	Morganella_phage	67.2	8.5e-21
WP_004242347.1|2349599_2350058_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_015422642.1|2350364_2350805_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	54.0	5.2e-28
WP_079549287.1|2351133_2351895_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004242343.1|2351966_2352896_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	98.5	1.4e-147
WP_004242341.1|2353122_2353335_-	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	100.0	2.0e-33
WP_036424737.1|2353710_2354148_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	97.2	9.4e-78
WP_036420965.1|2354437_2355067_-	Lambda NinG family protein	NA	A0A1W6JNX3	Morganella_phage	97.1	2.7e-102
WP_064483767.1|2355176_2355620_+	universal stress protein	NA	NA	NA	NA	NA
WP_165894629.1|2355647_2356052_-	hypothetical protein	NA	A0A1W6JNY5	Morganella_phage	89.4	1.7e-65
WP_046024444.1|2356257_2356701_-	NinB protein	NA	A0A1W6JNZ4	Morganella_phage	100.0	1.1e-81
WP_052927416.1|2356949_2357678_-	ATP-binding protein	NA	A0A1W6JP39	Morganella_phage	99.6	1.0e-132
WP_165894630.1|2357677_2358469_-	replication protein	NA	A0A1W6JNY0	Morganella_phage	99.2	2.8e-133
WP_036414494.1|2358610_2358937_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	100.0	1.8e-54
WP_036414492.1|2359067_2359277_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW6	Morganella_phage	97.8	4.8e-16
WP_036414490.1|2359376_2360024_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNY2	Morganella_phage	100.0	4.0e-117
WP_036414488.1|2360062_2360404_+	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	100.0	1.6e-61
WP_036414486.1|2360555_2360753_-	DUF2767 family protein	NA	A0A1W6JNW1	Morganella_phage	100.0	8.0e-29
WP_036415812.1|2361149_2361458_+	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	100.0	1.3e-49
WP_004240099.1|2361486_2361696_-	hypothetical protein	NA	A0A1W6JP23	Morganella_phage	100.0	5.9e-30
WP_125460924.1|2362050_2362314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004240098.1|2363086_2363263_+	hypothetical protein	NA	A0A1W6JNY7	Morganella_phage	100.0	6.3e-25
WP_015422640.1|2363420_2363783_+	hypothetical protein	NA	A0A1W6JNZ2	Morganella_phage	85.8	6.4e-56
WP_049240423.1|2363785_2364400_+	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	99.0	1.7e-109
WP_165894631.1|2364400_2364796_+	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	96.9	3.8e-70
WP_004240095.1|2365333_2366485_+|integrase	site-specific integrase	integrase	A0A2H5BFK7	Salmonella_phage	69.8	8.6e-155
2369358:2369373	attR	TTGCCACCACAGTCCC	NA	NA	NA	NA
>prophage 9
NZ_CP043955	Morganella morganii subsp. morganii strain 171229813 chromosome, complete genome	3982591	2415856	2461340	3982591	terminase,coat,integrase,head,holin	Cronobacter_phage(26.53%)	65	2415646:2415666	2461367:2461387
2415646:2415666	attL	TTACACCGGCATTGACATAAT	NA	NA	NA	NA
WP_165894633.1|2415856_2416081_+	DNA polymerase II	NA	H9C187	Pectobacterium_phage	59.7	7.3e-18
WP_024472895.1|2416158_2416521_+	GtrA family protein	NA	B9UDL8	Salmonella_phage	61.5	2.4e-31
WP_098935805.1|2416520_2417435_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	86.5	2.3e-150
WP_098935806.1|2417436_2418864_+	hypothetical protein	NA	F1C5A9	Cronobacter_phage	26.8	3.1e-13
WP_165894634.1|2418904_2420872_-	hypothetical protein	NA	E9NII8	Enterobacter_phage	52.0	2.8e-174
WP_165894635.1|2420933_2423405_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	52.2	8.1e-251
WP_070577968.1|2423391_2423784_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	58.7	4.8e-41
WP_096862212.1|2423780_2424251_-	DUF1833 family protein	NA	F1C5F1	Cronobacter_phage	50.6	1.2e-41
WP_165894636.1|2424250_2424727_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	64.6	2.1e-59
WP_165894637.1|2424723_2428185_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	52.6	1.3e-238
WP_165894638.1|2428228_2428921_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	97.4	8.0e-124
WP_165894639.1|2428971_2429727_-	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	96.8	3.9e-132
WP_112544284.1|2429791_2430160_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	33.6	6.8e-13
WP_165894640.1|2430156_2430525_-	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	70.5	6.3e-43
WP_165894641.1|2430526_2430868_-	hypothetical protein	NA	R9TRK0	Aeromonas_phage	42.5	3.4e-19
WP_062772891.1|2430864_2431236_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	45.5	2.9e-19
WP_112544292.1|2431235_2431505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165894642.1|2431514_2432591_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	66.9	4.6e-134
WP_165894643.1|2432601_2433039_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	59.3	9.1e-41
WP_165894644.1|2433045_2434446_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	64.7	6.8e-154
WP_165894645.1|2434462_2435458_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	61.7	7.0e-105
WP_165894646.1|2435411_2436869_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	48.7	3.5e-121
WP_165894647.1|2436868_2438350_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	97.7	2.1e-286
WP_159227814.1|2438351_2438954_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	77.3	1.0e-74
WP_049245839.1|2438956_2439154_-	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	93.8	1.4e-28
WP_165894648.1|2439368_2439818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165894649.1|2439929_2440697_-	DNA-binding protein	NA	Q9MCN2	Enterobacteria_phage	61.9	4.3e-86
WP_165894650.1|2440958_2441171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098935931.1|2441216_2441435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165894651.1|2441570_2441948_-	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	55.7	5.0e-19
WP_165894652.1|2441949_2442432_-	TIGR02594 family protein	NA	A0A1U9ZAE8	Proteus_phage	71.2	6.7e-61
WP_036412744.1|2442424_2442739_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	66.7	3.2e-35
WP_165894653.1|2442932_2443391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132274631.1|2443599_2444103_-	DUF1133 family protein	NA	A0A1P8DTF1	Proteus_phage	80.8	6.1e-73
WP_165894654.1|2444292_2444664_-	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	65.0	2.5e-39
WP_036421457.1|2444660_2444951_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	76.0	1.5e-36
WP_165894655.1|2445141_2445573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070577864.1|2445569_2446013_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	54.9	2.1e-37
WP_165894656.1|2446021_2446222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165894657.1|2446220_2446877_+	DUF4145 domain-containing protein	NA	V5URE2	Shigella_phage	52.0	4.0e-56
WP_165894658.1|2446919_2447108_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_165894659.1|2447094_2447289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165894660.1|2447309_2447474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165894661.1|2447498_2448194_-	DNA replication protein	NA	A0A077KCC8	Edwardsiella_phage	49.1	4.5e-58
WP_132274672.1|2449137_2449932_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	55.1	8.5e-69
WP_025154244.1|2449956_2450283_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	91.7	6.1e-50
WP_062772828.1|2450408_2450615_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	65.6	4.0e-15
WP_052927997.1|2450717_2451404_+	helix-turn-helix transcriptional regulator	NA	M9NZE3	Enterobacteria_phage	55.8	3.6e-68
WP_112544327.1|2451412_2452567_+	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	28.9	2.3e-35
WP_112548092.1|2453073_2453373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085987535.1|2453704_2453869_+	hypothetical protein	NA	A0A1W6JP47	Morganella_phage	87.0	7.1e-23
WP_165894662.1|2453909_2454062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165894663.1|2454071_2454344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165894664.1|2454340_2454586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165894665.1|2454582_2455506_+	recombinase RecT	NA	F1C5B8	Cronobacter_phage	67.2	6.5e-113
WP_165894780.1|2455508_2456204_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	59.6	7.4e-77
WP_165894781.1|2456251_2457238_+	DNA cytosine methyltransferase	NA	W0LM09	Edwardsiella_phage	63.3	1.1e-118
WP_165894666.1|2457240_2457750_+	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	29.2	8.0e-12
WP_165894667.1|2457752_2458019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165894668.1|2458036_2458327_+	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	38.0	5.5e-10
WP_165894669.1|2458493_2458682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165894670.1|2458665_2459034_+	DUF2591 family protein	NA	E9NID9	Enterobacter_phage	64.8	5.7e-36
WP_165894671.1|2459020_2459620_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	61.6	6.2e-64
WP_115983705.1|2459818_2460055_+	DUF1233 family excisionase	NA	S4TND0	Salmonella_phage	55.8	1.5e-21
WP_165894672.1|2460062_2461340_+|integrase	site-specific integrase	integrase	A0A0P0ZGA8	Escherichia_phage	48.7	3.2e-118
2461367:2461387	attR	TTACACCGGCATTGACATAAT	NA	NA	NA	NA
>prophage 10
NZ_CP043955	Morganella morganii subsp. morganii strain 171229813 chromosome, complete genome	3982591	2793104	2802947	3982591	protease,tRNA	Bacillus_phage(16.67%)	8	NA	NA
WP_165894690.1|2793104_2794874_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.4	9.8e-25
WP_062772316.1|2794876_2796643_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.9	5.8e-17
WP_004235802.1|2796620_2797340_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211347.1|2797490_2797709_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004235801.1|2797785_2800071_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.5	2.8e-173
WP_015422570.1|2800104_2800425_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.7	2.6e-16
WP_004235798.1|2800683_2800914_+	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	56.7	2.6e-15
WP_049246904.1|2801000_2802947_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.3	1.5e-37
>prophage 11
NZ_CP043955	Morganella morganii subsp. morganii strain 171229813 chromosome, complete genome	3982591	2987284	2995338	3982591	tRNA	Mycobacterium_phage(33.33%)	8	NA	NA
WP_004235583.1|2987284_2987494_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	4.5e-22
WP_004235582.1|2987693_2988161_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004240857.1|2988342_2989425_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_024474189.1|2989733_2989952_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	51.4	2.3e-16
WP_004240863.1|2989973_2990390_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	40.4	8.5e-12
WP_004235574.1|2990420_2992541_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	52.6	3.6e-207
WP_036417132.1|2992565_2993528_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	73.4	2.8e-135
WP_024474192.1|2994132_2995338_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.5	4.2e-27
>prophage 12
NZ_CP043955	Morganella morganii subsp. morganii strain 171229813 chromosome, complete genome	3982591	3652283	3694121	3982591	plate,portal,terminase,capsid,integrase,tail,tRNA,head	Morganella_phage(11.54%)	43	3655710:3655723	3672182:3672195
WP_004238244.1|3652283_3653630_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	69.6	5.5e-153
WP_064483639.1|3653891_3654686_+	M15 family metallopeptidase	NA	L7TND1	Rhizobium_phage	35.6	5.1e-05
WP_004241554.1|3654692_3655442_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_004238248.1|3655612_3656170_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	31.7	1.2e-05
3655710:3655723	attL	CGAAAGCCGCGCTG	NA	NA	NA	NA
WP_004238249.1|3656212_3656497_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_062773497.1|3656514_3658206_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.2	1.3e-63
WP_004238253.1|3659398_3659920_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	86.0	2.2e-49
WP_036418937.1|3660196_3663031_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.6	0.0e+00
WP_036418940.1|3663161_3663428_+	DksA/TraR family C4-type zinc finger protein	NA	A0A2C9CZU7	Yersinia_phage	54.5	2.1e-16
WP_165894718.1|3663479_3664676_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_036418946.1|3664731_3665811_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.0	6.8e-29
WP_015422419.1|3665890_3667297_-	replicative DNA helicase	NA	O80281	Escherichia_phage	75.0	3.3e-193
WP_004238260.1|3667529_3668513_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_004241541.1|3668674_3668989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165894719.1|3669039_3670086_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	A0A1W6JP59	Morganella_phage	72.1	8.4e-08
WP_165894783.1|3670184_3671267_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	98.6	7.7e-206
WP_165894720.1|3671512_3671797_+	DinI family protein	NA	A0A1W6JP10	Morganella_phage	80.9	2.6e-36
WP_165894721.1|3671879_3672140_+	helix-turn-helix transcriptional regulator	NA	A0A1B2LRR7	Wolbachia_phage	40.6	6.3e-05
WP_165894784.1|3672635_3674171_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
3672182:3672195	attR	CAGCGCGGCTTTCG	NA	NA	NA	NA
WP_165894722.1|3674201_3674552_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	47.4	3.3e-09
WP_165894723.1|3674548_3675520_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	41.1	8.1e-13
WP_165894724.1|3675570_3676164_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_165894725.1|3676160_3677300_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	33.5	8.8e-35
WP_165894726.1|3677300_3677738_-	hypothetical protein	NA	B5TK74	Pseudomonas_phage	55.2	8.3e-18
WP_165894727.1|3677737_3678322_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_004904800.1|3678324_3679395_-|tail	phage tail protein	tail	A0A2I7S9G1	Vibrio_phage	30.7	3.8e-40
WP_165894728.1|3679391_3680792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087769812.1|3680855_3681644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165894729.1|3681640_3683551_-	hypothetical protein	NA	T1SBJ1	Salmonella_phage	37.4	1.6e-17
WP_165894730.1|3683669_3683960_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_165894731.1|3683962_3684331_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_165894732.1|3684340_3685822_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	45.3	9.5e-106
WP_004904824.1|3685818_3685986_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	54.8	4.7e-06
WP_165894733.1|3685988_3686537_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_165894734.1|3686536_3686875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165894735.1|3686864_3687236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165894736.1|3687248_3688295_-|capsid	major capsid protein	capsid	V5Q8X6	Xylella_phage	34.1	2.2e-48
WP_098935635.1|3688368_3688761_-|head	head decoration protein	head	A0A2D1GMY6	Marinobacter_phage	31.6	2.0e-07
WP_165894737.1|3688760_3689381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165894738.1|3689383_3690238_-	S49 family peptidase	NA	A0A0B4SK12	Proteus_phage	44.3	1.1e-50
WP_165894785.1|3690234_3691830_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	36.5	9.9e-93
WP_004904843.1|3691886_3692138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165894739.1|3692147_3694121_-|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	46.1	1.8e-144
>prophage 13
NZ_CP043955	Morganella morganii subsp. morganii strain 171229813 chromosome, complete genome	3982591	3697435	3714866	3982591		Morganella_phage(71.43%)	29	NA	NA
WP_046894074.1|3697435_3697912_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	93.6	8.1e-83
WP_024474664.1|3697904_3698096_-	hypothetical protein	NA	A0A1W6JP85	Morganella_phage	100.0	4.9e-31
WP_165894743.1|3698352_3698529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165894744.1|3698531_3699827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165894745.1|3700266_3700644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165894746.1|3700674_3701691_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	94.4	2.0e-192
WP_165894747.1|3701690_3702404_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	53.0	7.6e-53
WP_165894748.1|3702421_3702829_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1W6JP40	Morganella_phage	98.1	2.7e-55
WP_165894749.1|3702825_3703209_-	hypothetical protein	NA	A0A1W6JP80	Morganella_phage	91.3	7.2e-58
WP_165894750.1|3703205_3703601_-	hypothetical protein	NA	A0A1W6JP58	Morganella_phage	43.4	4.6e-15
WP_165894751.1|3703597_3704134_-	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	93.8	2.5e-96
WP_165894752.1|3704133_3704376_-	hypothetical protein	NA	A0A1W6JP32	Morganella_phage	55.0	5.1e-17
WP_165894753.1|3704372_3705512_-	replication protein 15	NA	K7PLZ7	Enterobacterial_phage	57.1	1.7e-46
WP_025154972.1|3705508_3705700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036422706.1|3705764_3706229_-	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	74.5	4.2e-60
WP_049246845.1|3706258_3706459_-	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	63.6	8.4e-18
WP_165894754.1|3706555_3707200_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	61.0	3.3e-71
WP_165894755.1|3707320_3707533_+	hypothetical protein	NA	A0A1W6JP89	Morganella_phage	82.9	6.8e-26
WP_165894756.1|3707776_3708028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036423216.1|3708335_3708698_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	64.5	1.4e-34
WP_165894757.1|3708763_3709591_+	YfdQ family protein	NA	U5P439	Shigella_phage	54.6	5.5e-79
WP_165894758.1|3709699_3710227_+	HD family hydrolase	NA	A0A1W6JP41	Morganella_phage	94.2	1.7e-89
WP_109882394.1|3710229_3710490_+	antitoxin	NA	NA	NA	NA	NA
WP_025152948.1|3710977_3711178_+	hypothetical protein	NA	A0A1W6JP56	Morganella_phage	98.5	6.2e-29
WP_165894787.1|3711191_3711740_+	3'-5' exoribonuclease	NA	A0A1W6JP74	Morganella_phage	90.1	1.2e-93
WP_036413576.1|3711770_3712028_+	pyocin activator protein PrtN	NA	A0A1W6JP35	Morganella_phage	100.0	1.6e-40
WP_036418970.1|3712304_3713486_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_004241538.1|3714245_3714458_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004241537.1|3714512_3714866_+	helix-turn-helix transcriptional regulator	NA	A0A223W054	Agrobacterium_phage	36.5	1.6e-06
