The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045466	Salmonella enterica subsp. enterica serovar Anatum strain Sal-3973 chromosome, complete genome	4671091	310431	319513	4671091	integrase,protease	Ralstonia_phage(16.67%)	8	308824:308836	328010:328022
308824:308836	attL	CTGTTTTACCTTA	NA	NA	NA	NA
WP_024155556.1|310431_311673_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_023243338.1|312200_312578_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|312739_312937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|313149_315426_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|315456_315777_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|316100_316322_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|316451_318398_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|318394_319513_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
328010:328022	attR	TAAGGTAAAACAG	NA	NA	NA	NA
>prophage 2
NZ_CP045466	Salmonella enterica subsp. enterica serovar Anatum strain Sal-3973 chromosome, complete genome	4671091	1677713	1722491	4671091	plate,tRNA,tail	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|1677713_1678712_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242904.1|1678799_1680110_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|1680356_1680872_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|1680971_1681181_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|1681202_1681316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|1681312_1682638_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|1682816_1683425_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|1683533_1683902_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|1684072_1686493_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|1686591_1687464_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|1687477_1687975_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001749156.1|1688155_1689073_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|1689236_1690595_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|1690683_1691793_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|1692154_1693345_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023242906.1|1693476_1695021_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_020845801.1|1695035_1695926_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|1696091_1696502_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|1696644_1698741_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|1698740_1699478_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|1699474_1700143_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|1700176_1700419_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|1700862_1702512_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|1702856_1704206_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|1704336_1704684_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|1705259_1705547_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|1705549_1706155_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|1706167_1706482_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|1706641_1707097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|1707093_1707291_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|1707280_1708708_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_110962133.1|1708707_1709232_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	8.1e-68
WP_001003640.1|1709283_1709601_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|1709560_1709689_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|1709785_1712140_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|1712139_1713093_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|1713092_1713302_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|1713289_1714333_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|1714342_1715065_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|1715392_1715755_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|1715751_1716681_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|1716680_1718228_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|1718391_1718751_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|1718741_1719857_+	bacteriophage protein	NA	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|1719849_1720482_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|1720484_1721966_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_001177097.1|1721975_1722491_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
>prophage 3
NZ_CP045466	Salmonella enterica subsp. enterica serovar Anatum strain Sal-3973 chromosome, complete genome	4671091	3199273	3205077	4671091		Enterobacteria_phage(100.0%)	8	NA	NA
WP_021000674.1|3199273_3201607_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	84.5	0.0e+00
WP_000743150.1|3201621_3201942_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001604623.1|3201938_3202166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023243884.1|3202162_3202714_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	8.6e-36
WP_001604627.1|3202710_3202977_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_024155472.1|3203514_3204252_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.0	8.4e-79
WP_000984211.1|3204248_3204494_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000210078.1|3204510_3205077_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
>prophage 4
NZ_CP045466	Salmonella enterica subsp. enterica serovar Anatum strain Sal-3973 chromosome, complete genome	4671091	3236733	3300094	4671091	integrase,holin,portal,capsid,tRNA,terminase,tail,head	Cronobacter_phage(55.26%)	61	3244711:3244726	3274088:3274103
WP_000469807.1|3236733_3237501_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|3237541_3237889_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|3238045_3239266_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212380.1|3239258_3239777_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|3240216_3241287_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225191.1|3241296_3242418_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210990.1|3242475_3243384_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200080.1|3243344_3244505_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|3244604_3244652_-	hypothetical protein	NA	NA	NA	NA	NA
3244711:3244726	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_024132356.1|3244815_3245808_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.2	1.4e-108
WP_000185337.1|3245874_3246180_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	47.5	1.6e-15
WP_000661531.1|3246277_3246616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079960662.1|3246641_3246974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079960661.1|3246983_3247553_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.3	3.4e-43
WP_076009995.1|3247555_3247774_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.7	5.2e-05
WP_079960660.1|3247812_3250470_+	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	47.3	7.9e-244
WP_000088096.1|3250497_3250821_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_023210894.1|3250820_3251840_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.1	1.1e-134
WP_054175274.1|3251836_3253621_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
WP_023375469.1|3253831_3254668_+|capsid	capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	3.6e-46
WP_001176503.1|3254702_3255731_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|3255742_3256441_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_031602415.1|3256500_3256992_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.3e-48
WP_000080871.1|3256988_3257471_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|3257467_3258172_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_001748058.1|3258168_3259296_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
WP_054175275.1|3259292_3259748_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|3259760_3260057_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|3260053_3260395_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|3260394_3260727_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_000411500.1|3260873_3261131_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811098.1|3261318_3263286_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
WP_001002797.1|3263282_3263612_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|3263608_3264793_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_006772868.1|3264785_3265373_+	protein phage	NA	F1BUK5	Cronobacter_phage	81.5	2.4e-89
WP_054175279.1|3265382_3267395_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|3267397_3267928_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267951.1|3267917_3268643_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200789.1|3268614_3269160_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_054175283.1|3269162_3270863_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_000777801.1|3271980_3273453_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_080073196.1|3273588_3273975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|3274132_3274471_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
3274088:3274103	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_000197660.1|3274742_3275480_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|3275611_3276592_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992639.1|3276588_3277320_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235092.1|3277449_3280023_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_023243218.1|3285896_3286352_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_000807818.1|3286455_3287757_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_001264467.1|3287753_3288077_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|3288119_3289475_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_023243219.1|3289589_3292250_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000183649.1|3292303_3292984_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098732.1|3293056_3293476_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|3293679_3294717_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|3294832_3295522_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|3295840_3296224_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|3296285_3296873_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001521114.1|3296975_3297875_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023244485.1|3297892_3299227_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	2.7e-43
WP_000083347.1|3299356_3300094_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP045466	Salmonella enterica subsp. enterica serovar Anatum strain Sal-3973 chromosome, complete genome	4671091	3757330	3766501	4671091	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|3757330_3758278_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|3758261_3758993_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|3758973_3759081_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|3759140_3759872_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|3760094_3761780_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|3761776_3762496_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|3762542_3763010_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|3763066_3763597_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|3763768_3764227_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|3764467_3766501_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 6
NZ_CP045466	Salmonella enterica subsp. enterica serovar Anatum strain Sal-3973 chromosome, complete genome	4671091	3834593	3840890	4671091		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|3834593_3835997_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|3836174_3837068_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|3837444_3838530_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|3838529_3839429_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|3839476_3840355_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|3840359_3840890_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 7
NZ_CP045466	Salmonella enterica subsp. enterica serovar Anatum strain Sal-3973 chromosome, complete genome	4671091	3951180	3958429	4671091		Morganella_phage(33.33%)	8	NA	NA
WP_023243860.1|3951180_3951600_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|3951602_3952871_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|3953325_3953538_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|3953548_3953737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|3953996_3955190_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|3955838_3956150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|3956229_3956925_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|3956998_3958429_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 8
NZ_CP045466	Salmonella enterica subsp. enterica serovar Anatum strain Sal-3973 chromosome, complete genome	4671091	4061697	4069460	4671091	integrase	Enterobacteria_phage(28.57%)	12	4063907:4063929	4076030:4076052
WP_000856224.1|4061697_4061928_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|4062065_4062440_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|4062440_4063316_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|4063332_4063686_+	YebY family protein	NA	NA	NA	NA	NA
4063907:4063929	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_020438172.1|4064057_4065137_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|4065133_4066240_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|4066270_4066501_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|4066554_4067088_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|4067344_4067512_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|4067576_4067765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|4067819_4068311_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_023244117.1|4068863_4069460_+	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	43.1	7.8e-35
4076030:4076052	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 1
NZ_CP045467	Salmonella enterica subsp. enterica serovar Anatum strain Sal-3973 plasmid pSal-3973_DHA_CMY, complete sequence	195486	15132	64045	195486	transposase,integrase	Stx2-converting_phage(17.65%)	62	32957:32972	61902:61917
WP_000543934.1|15132_16143_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|16145_16682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000575657.1|16980_17262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|17523_18126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|18141_18594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011872911.1|18760_19060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787563.1|19354_19627_-	MafI family immunity protein	NA	NA	NA	NA	NA
WP_001067855.1|20070_20775_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000936896.1|21290_22718_-	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_000647189.1|22721_23222_-	hypothetical protein	NA	I3UMJ0	Colwellia_phage	43.3	1.7e-19
WP_002210541.1|23230_23542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005507681.1|23547_23979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344151.1|24046_24721_-	thymidylate kinase	NA	NA	NA	NA	NA
WP_014342216.1|24707_24827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001125905.1|24969_25347_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	2.2e-22
WP_000939033.1|25665_25809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074431.1|25900_26536_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_000703827.1|26588_26861_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001207227.1|26909_28091_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_001151304.1|28094_28880_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_014342215.1|28907_29039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338945.1|29053_29365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|29671_30487_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|30547_31351_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|31350_32187_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000844627.1|32492_32735_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000164043.1|32766_33417_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
32957:32972	attL	TCGCTGTCGCCGGCCT	NA	NA	NA	NA
WP_000804063.1|33522_34722_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|34988_35294_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023300759.1|35321_36536_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_021598067.1|36752_37637_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001250345.1|37667_38804_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000079941.1|39170_39440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000970007.1|39436_39718_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_021265674.1|39757_40606_+	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.1	3.5e-28
WP_001334658.1|40722_41196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001459505.1|41938_42433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517695.1|42488_43091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132032.1|43444_44791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001283341.1|45069_46950_+	colicin 1B	NA	NA	NA	NA	NA
WP_000762570.1|46967_47315_-	colicin 1B immunity protein	NA	NA	NA	NA	NA
WP_001407239.1|47433_47781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194553.1|47800_48391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371888.1|48390_48648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774874.1|48998_50000_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_000793307.1|50175_50520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000678527.1|51018_51273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290416.1|51317_52244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465043.1|52775_53189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021265673.1|53190_53970_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	4.0e-55
WP_001144036.1|54149_54794_+	ParA family protein	NA	NA	NA	NA	NA
WP_000030199.1|54880_55189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688514.1|55602_56583_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
WP_001278818.1|56575_56992_+	recombinase	NA	NA	NA	NA	NA
WP_000381395.1|57584_59156_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|59175_59523_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|59522_60200_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000109071.1|60974_61412_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|61408_61657_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_077250494.1|62005_62977_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
61902:61917	attR	TCGCTGTCGCCGGCCT	NA	NA	NA	NA
WP_010891263.1|62973_63285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086178.1|63361_64045_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.0e-30
>prophage 2
NZ_CP045467	Salmonella enterica subsp. enterica serovar Anatum strain Sal-3973 plasmid pSal-3973_DHA_CMY, complete sequence	195486	118990	174658	195486	transposase,integrase	Escherichia_phage(26.67%)	61	112152:112165	174651:175470
112152:112165	attL	CGGGGCAGCCAGCG	NA	NA	NA	NA
WP_001139957.1|118990_120145_-|integrase	integrase	integrase	B5WZU7	Pseudomonas_phage	43.0	1.3e-46
112152:112165	attL	CGGGGCAGCCAGCG	NA	NA	NA	NA
WP_001349157.1|121336_121585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417545.1|121581_122874_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_001193553.1|122873_123530_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_000014116.1|123514_124075_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000959785.1|124084_124699_-	pilus assembly protein PilX	NA	NA	NA	NA	NA
WP_001208805.1|124716_125814_-	pilus biosynthesis protein PilR	NA	NA	NA	NA	NA
WP_000362202.1|125826_127380_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_001247334.1|127390_127843_-	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
WP_000752772.1|127829_129125_-	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_000748143.1|129117_130800_-	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
WP_000539807.1|130813_131251_-	type IV pilus biogenesis protein PilM	NA	NA	NA	NA	NA
WP_001302629.1|131250_132318_-	type IV pilus biogenesis lipoprotein PilL	NA	NA	NA	NA	NA
WP_000494779.1|132941_133238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001136187.1|133413_133668_-	PilI type IV pilus biogenesis protein	NA	NA	NA	NA	NA
WP_000744644.1|133829_134381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213859.1|134553_135237_-	conjugal transfer protein TraC	NA	NA	NA	NA	NA
WP_165885257.1|135490_136024_-	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_000483804.1|136465_136702_-	conjugal transfer protein TraA	NA	NA	NA	NA	NA
WP_001324596.1|136670_136934_-	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	54.0	6.1e-08
WP_000907870.1|137906_138938_+	replication initiation protein	NA	NA	NA	NA	NA
138913:138926	attR	CGCTGGCTGCCCCG	NA	NA	NA	NA
WP_021265676.1|139633_139846_+	hypothetical protein	NA	NA	NA	NA	NA
138913:138926	attR	CGCTGGCTGCCCCG	NA	NA	NA	NA
WP_000198533.1|139960_141169_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000019163.1|141149_141422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|141636_142452_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|142538_142841_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|142734_142986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|143016_144510_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|144720_144945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|144941_145679_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001044210.1|146164_146305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|146310_147015_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001162012.1|147598_148156_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|148158_151131_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_110962188.1|151209_152214_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_042849136.1|152949_153297_+	hypothetical protein	NA	A0A1V0SB21	Catovirus	39.4	2.6e-06
WP_001143450.1|153296_153857_+	trimethoprim-resistant dihydrofolate reductase DfrA23	NA	A0A076FMI9	Aureococcus_anophage	29.0	1.6e-05
WP_001274976.1|153837_154284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000256638.1|154309_154927_+	hypothetical protein	NA	G3BM17	Salmonella_phage	28.3	2.3e-05
WP_000050481.1|155048_156590_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|156994_157834_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_052238321.1|157827_158163_-	ethidium bromide resistance protein	NA	NA	NA	NA	NA
WP_025999322.1|158055_158421_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_004193231.1|158424_159300_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004236386.1|159410_160550_+	class C beta-lactamase DHA-1	NA	NA	NA	NA	NA
WP_004193241.1|161900_162131_-	phage shock protein PspD	NA	NA	NA	NA	NA
WP_004193243.1|162139_162499_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_110962189.1|162498_162723_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_110962190.1|162776_163445_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_004193248.1|163615_164590_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_017900990.1|164672_165317_+	quinolone resistance pentapeptide repeat protein QnrB4	NA	NA	NA	NA	NA
WP_001067855.1|165721_166426_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000939727.1|166578_167400_-	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_001206356.1|167531_168323_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_004163135.1|168468_169428_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001067855.1|169318_170023_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004574636.1|170231_171521_-|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	9.5e-86
WP_003821921.1|171542_172055_-	signal peptidase II	NA	NA	NA	NA	NA
WP_004364974.1|172058_172955_-	cation transporter	NA	NA	NA	NA	NA
WP_004364961.1|173050_173458_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|173953_174658_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
174651:175470	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCTTTTCAACACAAGCGTGATCATCGGTGCATCCGCACCCTATACATTTAGCAGTGAGCATAAGCGCCTCCCCAAGTAAATTAACAACATCATAGTATCATTATGTGATGCTGTAAATATTAAAAAGAAAGCGGCCATAGCCGCCCTTCCGAAGTAATTTTCCTTTAGTGGTTGTCTTGGCCCTGTTTCCAAGCGACGAATGCCTGCACTAGCGGTACGCCATCATCACTCAAGGCATTCCCTTCTATCCATCCGCCTCGTATGACGACAGACTGCCCTGATTCCAAGCCAAAAGGTTCCCACTCAGAAGCCACCGGGGAACCGTCCACCAGCAGGTCGAGATCTTCAATCCATTTATCCCGGCCATCCAGAGTTTTCCAAACTGAGTCATCGACCCAAAAGGCCTTGATTTGTTCTGGTGTGGCATTGGTCCAATCGTTGTCTTTCCCGTCAGCAAGTGAAAGTACAGAGTCAACCGTTTGCTGCCAGTTCGGCCAATCTTCTTCGACAACAACGCAAGTAAGCGAGCTCTTGCCATTTGCTCTGCGGCCATCATCAACCTTCCGGATCAGCCTTTCCAGTGTCGCCAGCTCCTCATCGCAGAGCACGGCCTGTGCATCGCTTATCTTTGCCACGAAGTAACGTGCTTCAAGCATCGACATAATTATTTTCCTCCCCAGGGCACAAGTTTTGTCGAATATCCAAGCATTAGTGGGTGCTTCGGGTCCCCCGAACCAGTCACGCCAAATGCCAATACCGGCT	NA	NA	NA	NA
